FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2108698914> ?p ?o ?g. }

• W2108698914 endingPage "17643" @default.
• W2108698914 startingPage "17635" @default.
• W2108698914 abstract "Protein S (PS) is a vitamin K-dependent plasma protein that inhibits blood coagulation by serving as a nonenzymatic cofactor for activated protein C in the protein C anticoagulant pathway. Low PS levels are a risk factor for the development of deep venous thrombosis. The regulation of PS levels through transcriptional regulation of the PS gene was investigated in this report. A minimal PS gene promoter 370 bp upstream from the translational initiation codon was sufficient for maximal promoter activity in transient transfections regardless of the cell type. A pivotal role for Sp1 in the constitutive expression of the PS gene was demonstrated through electrophoretic mobility shift assay experiments, transient expression of mutant PS promoter-reporter gene constructs, and chromatin immunoprecipitations in HepG2 cells. At least four Sp-binding sites were identified. The two sites most proximal to the translational start codon were found to be indispensable for PS promoter activity, whereas mutation of the two most distal Sp-binding sites had a negligible influence on basal promoter activity. In addition, all other major promoter-binding proteins that were found by electrophoretic mobility shift assay could be positively identified in supershift assays. We identified binding sites for the hepatocyte-specific forkhead transcription factor FOXA2, nuclear factor Y, and the cAMP-response element-binding protein/activating transcription factor family of transcription factors. Their relevance was investigated using site-directed mutagenesis. Protein S (PS) is a vitamin K-dependent plasma protein that inhibits blood coagulation by serving as a nonenzymatic cofactor for activated protein C in the protein C anticoagulant pathway. Low PS levels are a risk factor for the development of deep venous thrombosis. The regulation of PS levels through transcriptional regulation of the PS gene was investigated in this report. A minimal PS gene promoter 370 bp upstream from the translational initiation codon was sufficient for maximal promoter activity in transient transfections regardless of the cell type. A pivotal role for Sp1 in the constitutive expression of the PS gene was demonstrated through electrophoretic mobility shift assay experiments, transient expression of mutant PS promoter-reporter gene constructs, and chromatin immunoprecipitations in HepG2 cells. At least four Sp-binding sites were identified. The two sites most proximal to the translational start codon were found to be indispensable for PS promoter activity, whereas mutation of the two most distal Sp-binding sites had a negligible influence on basal promoter activity. In addition, all other major promoter-binding proteins that were found by electrophoretic mobility shift assay could be positively identified in supershift assays. We identified binding sites for the hepatocyte-specific forkhead transcription factor FOXA2, nuclear factor Y, and the cAMP-response element-binding protein/activating transcription factor family of transcription factors. Their relevance was investigated using site-directed mutagenesis. The coagulation cascade is a complex system in which the consecutive activation of multiple coagulation factors leads to the production of thrombin and ultimately to the formation of fibrin polymers, the primary component of blood clots (for a recent review see Ref. 1Schenone M. Furie B.C. Furie B. Curr. Opin. Hematol. 2004; 11: 272-277Crossref PubMed Scopus (107) Google Scholar). Protein S (PS) 2The abbreviations used are: PS, protein S; ChIP, chromatin immunoprecipitation; CREB/ATF, cAMP-response element-binding protein/activating transcription factor; EMSA, electrophoretic mobility shift assay; FOXA2, forkhead box A2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HUVEC, human umbilical vein endothelial cell; MCS, multiple cloning site; NE, nuclear extract; NFY, nuclear factor Y; ELISA, enzyme-linked immunosorbent assay; CRE, cAMP-response element. is a vitamin K-dependent plasma protein that functions as a nonenzymatic cofactor for activated protein C in the down-regulation of the coagulation cascade via proteolytic inactivation of coagulant factors Va and VIIIa (2Walker F.J. J. Biol. Chem. 1980; 255: 5521-5524Abstract Full Text PDF PubMed Google Scholar, 3Fulcher C.A. Gardiner J.E. Griffin J.H. Zimmerman T.S. Blood. 1984; 63: 486-489Crossref PubMed Google Scholar, 4Rosing J. Hoekema L. Nicolaes G.A. Thomassen M.C. Hemker H.C. Varadi K. Schwarz H.P. Tans G. J. Biol. Chem. 1995; 270: 27852-27858Abstract Full Text Full Text PDF PubMed Scopus (217) Google Scholar, 5Yegneswaran S. Wood G.M. Esmon C.T. Johnson A.E. J. Biol. Chem. 1997; 272: 25013-25021Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar). PS has also been shown to display activated protein C-independent anticoagulant activity in purified systems as well as in plasma (6Hackeng T.M. van't Veer C. Meijers J.C. Bouma B.N. J. Biol. Chem. 1994; 269: 21051-21058Abstract Full Text PDF PubMed Google Scholar, 7Koppelman S.J. Hackeng T.M. Sixma J.J. Bouma B.N. Blood. 1995; 86: 1062-1071Crossref PubMed Google Scholar, 8Heeb M.J. Koenen R.R. Fernandez J.A. Hackeng T.M. J. Thromb. Haemostasis. 2004; 2: 1766-1773Crossref PubMed Scopus (20) Google Scholar). Recent studies indicate that PS may have a second function unrelated to coagulation in the clearance of apoptotic cells (9Webb J.H. Blom A.M. Dahlbäck B. J. Immunol. 2002; 169: 2580-2586Crossref PubMed Scopus (101) Google Scholar, 10Kask L. Trouw L.A. Dahlbäck B. Blom A.M. J. Biol. Chem. 2004; 279: 23869-23873Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar). Over the past two decades low PS plasma levels have become a well established risk factor for the development of deep venous thrombosis (11Schwarz H.P. Fischer M. Hopmeier P. Batard M.A. Griffin J.H. Blood. 1984; 64: 1297-1300Crossref PubMed Google Scholar, 12Engesser L. Broekmans A.W. Briet E. Brommer E.J. Bertina R.M. Ann. Intern. Med. 1987; 106: 677-682Crossref PubMed Scopus (354) Google Scholar, 13Makris M. Leach M. Beauchamp N.J. Daly M.E. Cooper P.C. Hampton K.K. Bayliss P. Peake I.R. Miller G.J. Preston F.E. Blood. 2000; 95: 1935-1941Crossref PubMed Google Scholar). However, not all mechanisms underlying low plasma PS levels have been fully characterized. Hereditary PS deficiency has been shown to be an autosomal dominant trait, and many causative genetic mutations have been described in the PS gene (14Gandrille S. Borgel D. Ireland H. Lane D.A. Simmonds R. Reitsma P.H. Mannhalter C. Pabinger I. Saito H. Suzuki K. Formstone C. Cooper D.N. Espinosa Y. Sala N. Bernardi F. Aiach M. Thromb. Haemostasis. 1997; 77: 1201-1214Crossref PubMed Scopus (93) Google Scholar, 15Gandrille S. Borgel D. Sala N. Espinosa-Parrilla Y. Simmonds R. Rezende S. Lind B. Mannhalter C. Pabinger I. Reitsma P.H. Formstone C. Cooper D.N. Saito H. Suzuki K. Bernardi F. Aiach M. Thromb. Haemostasis. 2000; 84: 918Crossref PubMed Scopus (129) Google Scholar). On the other hand, PS deficiency can also be acquired throughout life by conditions such as oral contraceptive use and liver disease (16D'Angelo A. Vigano-D'Angelo S. Esmon C.T. Comp P.C. J. Clin. Investig. 1988; 81: 1445-1454Crossref PubMed Scopus (184) Google Scholar). To better understand the different functions of PS and the possible causes of PS deficiency, more information is needed on the regulation of the PS gene, mRNA, and protein. The major source of circulating plasma PS is the hepatocyte (17Fair D.S. Marlar R.A. Blood. 1986; 67: 64-70Crossref PubMed Google Scholar), but PS is also produced constitutively at low levels by a variety of other cell types throughout the body (18Ogura M. Tanabe N. Nishioka J. Suzuki K. Saito H. Blood. 1987; 70: 301-306Crossref PubMed Google Scholar, 19Fair D.S. Marlar R.A. Levin E.G. Blood. 1986; 67: 1168-1171Crossref PubMed Google Scholar, 20Stitt T.N. Conn G. Gore M. Lai C. Bruno J. Radziejewski C. Mattsson K. Fisher J. Gies D.R. Jones P.F. Cell. 1995; 80: 661-670Abstract Full Text PDF PubMed Scopus (612) Google Scholar, 21Malm J. He X.H. Bjartell A. Shen L. Abrahamsson P.A. Dahlbäck B. Biochem. J. 1994; 302: 845-850Crossref PubMed Scopus (28) Google Scholar, 22Maillard C. Berruyer M. Serre C.M. Dechavanne M. Delmas P.D. Endocrinology. 1992; 130: 1599-1604Crossref PubMed Scopus (77) Google Scholar, 23Schwarz H.P. Heeb M.J. Wencel-Drake J.D. Griffin J.H. Blood. 1985; 66: 1452-1455Crossref PubMed Google Scholar, 24Stern D. Brett J. Harris K. Nawroth P. J. Cell Biol. 1986; 102: 1971-1978Crossref PubMed Scopus (108) Google Scholar, 25Benzakour O. Kanthou C. Blood. 2000; 95: 2008-2014Crossref PubMed Google Scholar). PS circulates in human plasma at a concentration of ∼0.35 μm in a free form (40%) and a C4b-binding protein-bound form (60%) (26Dahlbäck B. Stenflo J. Proc. Natl. Acad. Sci. U. S. A. 1981; 78: 2512-2516Crossref PubMed Scopus (296) Google Scholar, 27Dahlbäck B. J. Biol. Chem. 1986; 261: 12022-12027Abstract Full Text PDF PubMed Google Scholar, 28Griffin J.H. Gruber A. Fernandez J.A. Blood. 1992; 79: 3203-3211Crossref PubMed Google Scholar). The PS genetic locus, PROS, consists of an active PS gene (PROS1) and an inactive pseudogene (PROS2) that share 96% homology in their coding sequence. The promoter and the first exon are absent from the PROS2 gene, however (29Schmidel D.K. Tatro A.V. Phelps L.G. Tomczak J.A. Long G.L. Biochemistry. 1990; 29: 7845-7852Crossref PubMed Scopus (128) Google Scholar, 30Ploos van Amstel H.K. Reitsma P.H. van der Logt C.P. Bertina R.M. Biochemistry. 1990; 29: 7853-7861Crossref PubMed Scopus (83) Google Scholar, 31Edenbrandt C.M. Lundwall A. Wydro R. Stenflo J. Biochemistry. 1990; 29: 7861-7868Crossref PubMed Scopus (66) Google Scholar). Transcription from the PROS1 promoter is directed from multiple start sites (32De Wolf C.J.F. Cupers R.M. Bertina R.M. Vos H.L. J. Thromb. Haemostasis. 2005; 3: 410-412Crossref PubMed Scopus (6) Google Scholar), and recently the PROS1 promoter was shown to contain a forkhead box A2 (FOXA2)-binding site and an Sp1-binding site (33Tatewaki H. Tsuda H. Kanaji T. Yokoyama K. Hamasaki N. Thromb. Haemostasis. 2003; 90: 1029-1039Crossref PubMed Google Scholar). In this study, we further characterized the transcriptional regulation of the PROS1 promoter. We identified binding sites for various transcription factors within the first 400 bp proximal to the PROS1 translational start codon, among which are multiple binding sites for the ubiquitous transcription factors Sp1 and Sp3, single sites for nuclear factor Y (NFY), and the cAMP-response element-binding protein/activating transcription factor (CREB/ATF) family of transcription factors. Chromatin immunoprecipitations of chromatin from hepatocytic cell line HepG2 with an Sp1 antibody demonstrated the in vivo relevance of our findings. The results presented here show that Sp1 and Sp3 have a crucial role in the basal expression of the PS gene, whereas transcription factors FOXA2, NFY, and CREB/ATF do not. Plasmids—The PROS1 promoter reporter constructs used in this study originated from a 7-kb EcoRI promoter fragment that was isolated from BAC clone 2513H18 from the CITBI-E1 genomic library (Research Genetics, Invitrogen). The complete sequence was determined through automated sequencing (ABI PRISM and Beckman CEQ2000 sequencers) and deposited in GenBank™ under accession number AY605182. The PROS1 sequence was cloned into pcDNA3 (Invitrogen) and modified to contain nucleotides –5948 to –1 from the translational start codon. PROS1 fragment –5948/–1 was cloned directly 5′ to the luciferase reporter gene in the pGL3basic vector (Promega, Madison, WI) after digestion with KpnI and XhoI that cut in the multiple cloning site. This construct was named PS5948-luc (contact authors for exact cloning details). PS5948-luc was linearized with KpnI and NdeI (at position –5798 in the promoter sequence) and was subsequently subjected to exonuclease III digestion (Erase-a-Base kit, Promega). The size of the resulting 5′-deletion was determined by sequence analysis. The 5′-deletion constructs were used for transient transfection assays. Mutation of Putative Transcription Factor Binding Sites—Mutant constructs were generated by use of the QuikChange XL site-directed mutagenesis kit from Stratagene (La Jolla, CA). The sequence of the mutant oligonucleotides is depicted in Table 1. Successful incorporation of the mutations was confirmed by automated sequencing.TABLE 1Mutant oligonucleotides for site-directed mutagenesisOligonucleotidePositionaNumbering of the position is relative to the PROS1 translational start codon.SequencebUnderlining of nucleotides denotes mutations.Sp1mta-175/-144GAGCGGGCGGTCTCATATGCCCCCGGCTGTTCSp1mtb-262/-220CCTCCAACACTAGAGCCCATATCATAGCTCCGAAAAGCTTCCSp1mtc-306/-263CTAGGGAGCTGGTGAATAGTCATGTCTCAGCAGTGTTTACTAGGSp1mtd-366/-327GAACTGCGTTCCCCACATCTTCATCTTTGGAAACGTCACNFYmt-391/-353CTGGAAGTTGTCTTGCCTTGTTTGAGAACTGCGTTCCCCCREmt-350/-321CCCTTCCCCTTTGGAATGGTCACACTGTGGFOXA2mt-287/-253GGATGTCTCAGCCGTGAGTACAAGGCCTCCAACACa Numbering of the position is relative to the PROS1 translational start codon.b Underlining of nucleotides denotes mutations. Open table in a new tab Expression Vectors—Expression vectors containing human Sp1 and Sp3 (pCMV-Sp) transcription factors were a kind gift from J. Horowitz (Roswell Park Cancer Institute) (34Udvadia A.J. Rogers K.T. Higgins P.D. Murata Y. Martin K.H. Humphrey P.A. Horowitz J.M. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 3265-3269Crossref PubMed Scopus (187) Google Scholar, 35Udvadia A.J. Templeton D.J. Horowitz J.M. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 3953-3957Crossref PubMed Scopus (198) Google Scholar), and the expression vector containing murine FOXA2 (pcDNA3-FOXA2) was a kind gift from P. Holthuizen (University of Utrecht, Netherlands). The pcDNA3-FOXA2 vector was created by inserting the cDNA for FOXA2, as reported by Lai and co-workers (36Lai E. Prezioso V.R. Tao W.F. Chen W.S. Darnell Jr., J.E. Genes Dev. 1991; 5: 416-427Crossref PubMed Scopus (434) Google Scholar), into the EcoRI cloning site of vector pcDNA3. Cell Culture—Leukocytes isolated from blood obtained from healthy donors (Sanquin Bloodbank, Leiden, Netherlands) were a kind gift from E. Paffen (Leiden University Medical Center, Leiden, Netherlands). The human hepatoblastoma cell line HepG2 and cervical adenocarcinoma cell line HeLa were purchased from the American Type Culture Collection (ATCC, Manassas, VA). Megakaryocytic cell line Meg01 was a kind gift from G. van Willigen (Utrecht Medical Center, Utrecht, Netherlands). The hepatoma cell line HuH7 was a kind gift from M. Verschuur (TNO Prevention and Health, Leiden, Netherlands). Primary human umbilical vein endothelial (HUVEC) cells were a kind gift from J. Grimbergen (TNO Prevention and Health, Leiden, Netherlands). HepG2, HeLa, and HuH7 cells were grown in minimal essential medium, 10% fetal bovine serum, 100 μg/ml penicillin, 100 μg/ml streptomycin, and 1× minimal essential medium nonessential amino acids (all purchased from Invitrogen). Meg01 cells were grown in RPMI 1640 medium, 20% fetal bovine serum, 100 μg/ml penicillin, 100 μg/ml streptomycin (all purchased from Invitrogen). HUVECs were grown in M199 medium (BioWhittaker, Walkersville, MD), 10% heat-inactivated human serum (Sanquin Bloodbank), 10% newborn calf serum (TNO Prevention and Health), 10 units/ml heparin (BioWhittaker), 150 units/ml endothelial cell growth factor, 100 μg/ml penicillin (BioWhittaker), and 100 μg/ml streptomycin (BioWhittaker). 24 h before transfection, HUVEC medium was replaced with heparin-free medium to prevent interference with the transfection. PS Measurements—Total PS antigen levels in culture media were determined by ELISA as described previously (37Deutz-Terlouw P.P. Ballering L. van Wijngaarden A. Bertina R.M. Clin. Chim. Acta. 1990; 186: 321-324Crossref PubMed Scopus (36) Google Scholar), with the following modifications. ELISA plates were coated with goat anti-human PS IgG (Kordia, Leiden, The Netherlands) overnight at 4 °C. A second coating with 2.5% ovalbumin (Sigma) at 37 °C for 1 h was performed to reduce background absorbance. Complexes were detected with horseradish peroxidase-conjugated rabbit anti-human IgG (Dako, Glostrup, Denmark). Absorbance at 450 nm was determined with an Organon Teknika plate reader (Turnhout, Belgium). Reporter Gene Assays—1 × 106 Meg01 suspension cells were used per transfection. All adherent cells (HepG2, HuH7, HeLa, and HUVEC) were transfected at 60–80% confluency. HUVEC cells were transfected in passage 2–3, whereas the other cell types were used up to passage 25. Each transfection was performed in triplicate in 12-well plates. All assays were conducted with two different DNA preparations of each construct. Transfections in HepG2, HeLa, HUVEC, and HuH7 cells were carried out using 3 μl of Tfx-20 lipids (Promega) per μg of transfected DNA. Meg01 cells were transfected using 5 μg of DAC-30 (Eurogentec, Seraing, BE) per μg of DNA. In each transfection an equimolar concentration of construct was used, supplemented with pUC13-MCS vector to obtain a fixed amount of transfected DNA. In pUC13-MCS the MCS had been removed by digestion with PvuII and recircularization. Control vector pRL-SV40 (Promega), expressing the Renilla luciferase, was co-transfected to correct for transfection efficiency in a 1:500 ratio to the total transfected amount (microgram) of DNA in HepG2, HuH7, and HeLa cell lines, and a 1:100 ratio in transfections with HUVEC and Meg01 cells. 250 ng of transcription factor expression vector was used for co-transfections, and expression vector without the transcription factor cDNA was used as a negative control. Cell extracts were harvested at either 24 (HepG2 and HuH7) or 48 h (Meg01, HUVEC, and HeLa) after transfection. Cells were lysed in 250 μl of Passive Lysis Buffer (Promega) per well, after which 20–100 μl was used to measure luciferase activity. Luciferase activity was measured according to the Dual Luciferase Assay System Protocol (Promega) using a Lumat LB9507 luminometer (Berthold, Bad Wildbad, Germany). Preparation of Nuclear Extracts—Nuclear extracts (NE) were prepared according to the method of Dignam et al. (38Dignam J.D. Lebovitz R.M. Roeder R.G. Nucleic Acids Res. 1983; 11: 1475-1489Crossref PubMed Scopus (9160) Google Scholar). Nuclear extract buffer contained 20 mm Hepes (pH 7.9), 0.2 mm EDTA, 100 mm KCl, 0.5 mm dithiothreitol, 0.2 mm phenylmethylsulfonyl fluoride, and the EDTA-free protease inhibitor mixture (Roche Applied Science). NEs were aliquoted and frozen at –80 °C until further use. Protein concentration of the NEs was measured with the BCA assay (Pierce). Electrophoretic Mobility Shift Assays (EMSA)—EMSAs were performed in a 13-μl binding reaction containing 10 μg of NE and 195 ng of denatured herring sperm DNA. EMSA buffers were purchased from Active Motif (Carlsbad, CA) and used according to the manufacturer's recommendations. Double-stranded oligonucleotides were end-labeled using [γ-32P]ATP and T4 polynucleotide kinase. The position numbers for the oligonucleotides in Fig. 2 show their location respective to the PROS1 translational start codon. Reaction mixtures were incubated on ice for 20 min with or without an unlabeled competitor. Subsequently, the 32P-labeled double-stranded probe was added, and the incubation was continued for another 20 min. In supershift experiments, NE was incubated on ice for 10 min with the 32P-labeled double-stranded probe after which an anti-Sp1 (sc59x), anti-Sp3 (sc664x), anti-NFYA (sc7711x), anti-CREB/ATF (sc270x), or anti-FOXA2 antibody (sc6554x) (Santa Cruz Biotechnology, Santa Cruz, CA) was added, and the incubation was allowed to continue for another 10 min. Samples were loaded on a 3 or 5% nondenaturing polyacrylamide gel, which was electrophoresed for 2 h at 200V, after which gels were vacuum-dried and exposed to x-ray film. Chromatin Immunoprecipitation Assay (ChIP)—Chromatin immunoprecipitation assays were conducted with chromatin isolated from HepG2 cells with the Chip-IT kit (Active Motif, Rixensart, Belgium) according to the manufacturer's instructions. Briefly, HepG2 cells were grown to 80% confluency in 75-cm2 flasks after which chromatin was fixed in vivo by addition of 1% formaldehyde in culture medium. Fixed chromatin was isolated and sheared five times for 20 s to an average fragment size of 500 bp using a Soniprep 150 homogenizer (Sanyo/MSE, Kent, UK) at 25% power. Approximately 20 μg of sheared chromatin was incubated for 4 h with 3 μg of transcription factor-specific antibody at 4 °C with gentle rotation, after which protein G beads were added, and the incubation was continued overnight. An antibody against TFIIB was used as a positive control, and nonspecific IgG was used as a negative control. The same Sp1 antibody was used for the ChIP experiments as for the supershift assays. The antibody-chromatin complexes on the protein G beads were pelleted, washed extensively, eluted from the protein G beads, and treated with proteinase K and RNase A. DNA was purified over a mini-column and resuspended in 100 μl of H2O. 3 μl was used as a template for PCR using primers surrounding the suspected transcription factor binding site. For the PROS1-specific PCR the following primers were used: –322/–299 (sense) 5′-GGA GGA AAA GCA GCA ACT AGG GAG-3′, –91/–106 (antisense) 5′-TCG GTC TGA GCC GTG-3′. For the positive control primers located in the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter were used. The background control consisted of a PCR with primers located in the chromosome condensation-related SMC-associated protein (CNAP1) gene. Protein S Expression in Cell Lines—Protein S levels in cell culture medium were determined by ELISA analysis for HepG2, HuH7, HeLa, Meg01, and HUVEC cells (Table 2). Hepatocytic cell types HuH7 and HepG2 had the highest PS production. PS levels in HeLa and Meg01 cell culture were low when compared with levels in HepG2 and HuH7 culture medium. PS levels were lowest in medium from HUVEC cell culture.TABLE 2PS protein levels over time in cell cultureCell typePS levels24 h48 h72 h96 hnmnmnmnmHepG20.3150.4980.7521.064HuH70.3430.7091.1661.391HeLa0.1710.1890.2680.405HUVEC0.0420.0720.0890.112Meg010.0650.1260.1490.185 Open table in a new tab PROS1 Promoter Activity in Transient Transfection of Various Cell Types—Transient transfection studies were conducted in unstimulated HepG2, HuH7, HeLa, HUVEC, and Meg01 cells with PROS1 promoter constructs cloned upstream from the firefly luciferase reporter gene (Fig. 1). These studies pointed out that the first 370 bp of the PROS1 5′-flanking region were necessary for maximal promoter activity in all cell lines. When compared with expression in other cell types, the shortest PROS1 construct, PS197-luc, had relatively high activity in HeLa and HuH7 cells. However, background pGL3basic activity was also higher in these cells. Optimal promoter activity was maintained up to a 5′ region with a length of 1062 bp. Constructs longer than 1062 bp had reduced activity in transfections in HepG2 and HeLa cells, whereas in HuH7 and Meg01 cells the promoter activity remained at a high level. This difference in expression indicates that tissue-specific expression of transcription factors that bind to sites in this region may play a role in the regulation of PROS1 activity. Computational analysis of the PROS1 promoter sequence with the MatInspector professional software (39Quandt K. Frech K. Karas H. Wingender E. Werner T. Nucleic Acids Res. 1995; 23: 4878-4884Crossref PubMed Scopus (2424) Google Scholar) did not reveal the presence of distinct upstream inhibitory or stimulatory elements, however. Multiple Transcription Factors Bind to the PS Promoter—In a previous study we determined that PROS1 transcription is driven from three possible start sites, namely –100, –114/–117, and –147/–150 (32De Wolf C.J.F. Cupers R.M. Bertina R.M. Vos H.L. J. Thromb. Haemostasis. 2005; 3: 410-412Crossref PubMed Scopus (6) Google Scholar). Here we show that maximal promoter activity is reached with a minimal PROS1 promoter of 370 bp. On basis of these observations we investigated transcription factor binding to the PROS1 region encompassing bp 100 –370 upstream from the translational start. For this purpose, a series of overlapping double-stranded oligonucleotides covering the aforementioned region was designed. The duplexes were all 24 bp long, each having a 12-bp overlap with its neighboring probes. The liver cell line HepG2 was chosen for these more detailed experiments, because it had a high PS expression level and has been more intensely investigated than the HuH7 cell line. Incubation of HepG2 nuclear extracts with radiolabeled oligonucleotide duplexes located between positions –93 and –152 upstream from the PROS1 translational start did not result in the formation of protein-DNA complexes (Fig. 2). In contrast, almost all double-stranded oligonucleotide probes from duplex –152/–129 up to –382/–359 were complexed with nuclear protein. In further experiments we focused on the more pronounced complexes found with primer walking. Upon computational analysis of the first 400 bp of the PROS1 promoter sequence with the MatInspector professional software (39Quandt K. Frech K. Karas H. Wingender E. Werner T. Nucleic Acids Res. 1995; 23: 4878-4884Crossref PubMed Scopus (2424) Google Scholar), consensus binding sites for various transcription factors were found (Fig. 3). A high degree (>60%) of interspecies conservation (human, chimpanzee, rhesus monkey, dog, bovine, pig, mouse, and rat comparison) was found from ∼250 to ∼100 bp upstream of the PROS1 translational start codon with the VISTA alignment tools (40Mayor C. Brudno M. Schwartz J.R. Poliakov A. Rubin E.M. Frazer K.A. Pachter L.S. Dubchak I. Bioinformatics (Oxf.). 2000; 16: 1046-1047Crossref PubMed Scopus (794) Google Scholar, 41Loots G.G. Ovcharenko I. Pachter L. Dubchak I. Rubin E.M. Genome Res. 2002; 12: 832-839Crossref PubMed Scopus (366) Google Scholar). Binding sites for Sp1 and signal transducer and activator of transcription in this region were found to be conserved by more than 95%. The protein-DNA complexes observed in incubations containing HepG2 nuclear extract and radiolabeled oligonucleotide duplexes –359/–335, –298/–275, –253/–230, and –177/–146 all displayed a similar pattern of retardation on PAGE. Computational analysis pointed out that all oligonucleotides, with the exception of –298/–275, contained putative binding sites for the ubiquitous transcription factor Sp1. Sp3, another member of the Sp family of transcription factors, has similar DNA-binding properties as Sp1 and thus often binds to the same sites as Sp1. Four Sp3 isoforms exist with different molecular weights that can all bind to the Sp1 consensus sequence. The result is the highly recognizable Sp1/Sp3 EMSA banding pattern (Fig. 4) (42Suske G. Gene (Amst.). 1999; 238: 291-300Crossref PubMed Scopus (985) Google Scholar, 43Sapetschnig A. Koch F. Rischitor G. Mennenga T. Suske G. J. Biol. Chem. 2004; 279: 42095-42105Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar). The specificity of Sp binding to the oligonucleotide duplexes was confirmed in competition experiments with unlabeled wild type oligonucleotide duplexes and the Sp consensus oligonucleotide. Mutant oligonucleotides in which the putative Sp-binding site had been modified did not compete for protein binding. Upon incubation with antibodies directed against either Sp1 or Sp3, a supershift of the specific bands, band a and bands b and c respectively, was observed (Fig. 4, panels A–C). These experiments confirmed our hypothesis that all four oligonucleotide duplexes contained Sp-binding sites. Competition experiments demonstrated that not all Sp-binding sites in the PROS1 promoter bind Sp1 with the same affinity (Fig. 4, panels D and E). By addition of a 50-fold excess of unlabeled competitor in the form of one of the three other duplexes to incubations with either labeled duplex –177/–146 or –298/–275, the following order of binding affinity was established: –177/–146 >–253/–230 >–298/–275 >–359/–335. The oligonucleotide for which the Sp proteins displayed the highest affinity, –177/–146, was 8 bp longer than the other oligonucleotides. The computational analysis showed that more than one Sp-binding site may be located within this region. Moreover, the –177/–146 mutant oligonucleotide was still able to compete slightly for Sp1 binding (Fig. 4, panel A). The higher affinity of Sp1 for –177/–146 may therefore be due to the presence of more than a single Sp-binding site. All other oligonucleotide probe-protein complexes had a unique migratory behavior. Computational data (Fig. 3) and a previous publication (33Tatewaki H. Tsuda H. Kanaji T. Yokoyama K. Hamasaki N. Thromb. Haemostasis. 2003; 90: 1029-1039Crossref PubMed Google Scholar) indicated that the protein complex attached to duplex –282/–258 could be the liver-specific transcription factor FOXA2. This was confirmed by EMSA competition experiments with the wild type oligonucleotide and a mutant oligonucleotide in which the putative FOXA2-binding site had been altered. Moreover, incubation of the wild type oligonucleotide probe with a FOXA2-specific antibody resulted in the disappearance of the FOXA2-specific band (Fig. 5, panel A). Computational analysis also revealed the presence of putative CREB/ATF and NFY sites around positions –346 to –323 and –382 to –359, respectively. Protein-DNA complexes were obtained in incubations with HepG2 nuclear extract and labeled primers at these positions. Evidence for binding of both families of transcription factors was subsequently established in supershift assays with transcription factor" @default.
• W2108698914 created "2016-06-24" @default.
• W2108698914 creator A5013882873 @default.
• W2108698914 creator A5015340595 @default.
• W2108698914 creator A5043167641 @default.
• W2108698914 creator A5062533188 @default.
• W2108698914 date "2006-06-01" @default.
• W2108698914 modified "2023-10-16" @default.
• W2108698914 title "The Constitutive Expression of Anticoagulant Protein S Is Regulated through Multiple Binding Sites for Sp1 and Sp3 Transcription Factors in the Protein S Gene Promoter" @default.
• W2108698914 cites W117370420 @default.
• W2108698914 cites W137330460 @default.
• W2108698914 cites W14593717 @default.
• W2108698914 cites W1485104973 @default.
• W2108698914 cites W1510448773 @default.
• W2108698914 cites W1531637520 @default.
• W2108698914 cites W1578912075 @default.
• W2108698914 cites W1834120352 @default.
• W2108698914 cites W1845670861 @default.
• W2108698914 cites W1906338985 @default.
• W2108698914 cites W1971602395 @default.
• W2108698914 cites W1981411229 @default.
• W2108698914 cites W1990283480 @default.
• W2108698914 cites W1990813612 @default.
• W2108698914 cites W1991934627 @default.
• W2108698914 cites W1993059069 @default.
• W2108698914 cites W1993063708 @default.
• W2108698914 cites W1993243592 @default.
• W2108698914 cites W2000143497 @default.
• W2108698914 cites W2002183497 @default.
• W2108698914 cites W2002495914 @default.
• W2108698914 cites W2007197293 @default.
• W2108698914 cites W2008086014 @default.
• W2108698914 cites W2030688236 @default.
• W2108698914 cites W2032851684 @default.
• W2108698914 cites W2038640901 @default.
• W2108698914 cites W2048762777 @default.
• W2108698914 cites W2054111121 @default.
• W2108698914 cites W2059479474 @default.
• W2108698914 cites W2059678611 @default.
• W2108698914 cites W2060728636 @default.
• W2108698914 cites W2064728303 @default.
• W2108698914 cites W2064879068 @default.
• W2108698914 cites W2073619813 @default.
• W2108698914 cites W2076063939 @default.
• W2108698914 cites W2082158472 @default.
• W2108698914 cites W2083592362 @default.
• W2108698914 cites W2086652233 @default.
• W2108698914 cites W2088490017 @default.
• W2108698914 cites W2106169455 @default.
• W2108698914 cites W2107266385 @default.
• W2108698914 cites W2114152867 @default.
• W2108698914 cites W2114270476 @default.
• W2108698914 cites W2144322830 @default.
• W2108698914 cites W2156488244 @default.
• W2108698914 cites W2160436707 @default.
• W2108698914 cites W2161447878 @default.
• W2108698914 cites W2162007651 @default.
• W2108698914 cites W2170677539 @default.
• W2108698914 cites W2297160437 @default.
• W2108698914 cites W2405902444 @default.
• W2108698914 cites W30562015 @default.
• W2108698914 cites W362194484 @default.
• W2108698914 cites W4238431115 @default.
• W2108698914 cites W4248895448 @default.
• W2108698914 cites W4321508697 @default.
• W2108698914 cites W55448828 @default.
• W2108698914 doi "https://doi.org/10.1074/jbc.m603094200" @default.
• W2108698914 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16672217" @default.
• W2108698914 hasPublicationYear "2006" @default.
• W2108698914 type Work @default.
• W2108698914 sameAs 2108698914 @default.
• W2108698914 citedByCount "34" @default.
• W2108698914 countsByYear W21086989142012 @default.
• W2108698914 countsByYear W21086989142013 @default.
• W2108698914 countsByYear W21086989142014 @default.
• W2108698914 countsByYear W21086989142016 @default.
• W2108698914 countsByYear W21086989142017 @default.
• W2108698914 countsByYear W21086989142019 @default.
• W2108698914 countsByYear W21086989142020 @default.
• W2108698914 countsByYear W21086989142022 @default.
• W2108698914 countsByYear W21086989142023 @default.
• W2108698914 crossrefType "journal-article" @default.
• W2108698914 hasAuthorship W2108698914A5013882873 @default.
• W2108698914 hasAuthorship W2108698914A5015340595 @default.
• W2108698914 hasAuthorship W2108698914A5043167641 @default.
• W2108698914 hasAuthorship W2108698914A5062533188 @default.
• W2108698914 hasBestOaLocation W21086989141 @default.
• W2108698914 hasConcept C101762097 @default.
• W2108698914 hasConcept C104317684 @default.
• W2108698914 hasConcept C138885662 @default.
• W2108698914 hasConcept C150194340 @default.
• W2108698914 hasConcept C153911025 @default.
• W2108698914 hasConcept C179926584 @default.
• W2108698914 hasConcept C185592680 @default.
• W2108698914 hasConcept C41895202 @default.
• W2108698914 hasConcept C55493867 @default.
• W2108698914 hasConcept C86339819 @default.
• W2108698914 hasConcept C86803240 @default.

• next