FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2109356886> ?p ?o ?g. }

• W2109356886 endingPage "11440" @default.
• W2109356886 startingPage "11433" @default.
• W2109356886 abstract "In this study we have investigated the role of a specific corepressor of EGR-1, NAB2, to down-regulate vascular endothelial growth factor (VEGF)-induced gene expression in endothelial cells and to inhibit angiogenesis. Firstly, we show a reciprocal regulation of EGR-1 and NAB2 following VEGF treatment. During the initial phase EGR-1 is rapidly induced and NAB2 levels are down-regulated. This is followed by a reduction of EGR-1 and a concomitant increase of NAB2. Secondly, using the tissue factor gene as a readout for VEGF-induced and EGR-1-regulated gene expression we demonstrate that NAB2 can completely block VEGF-induced tissue factor reporter gene activity. Thirdly, by adenovirus-mediated expression we show that NAB2 inhibits up-regulation of tissue factor, VEGF receptor-1, and urokinase plasminogen activator mRNAs even when a combination of VEGF and bFGF is used for induction. In addition, NAB2 overexpression significantly reduced tubule and sprout formation in two different in vitro angiogenesis assays and largely prevented the invasion of cells and formation of vessel-like structures in the murine Matrigel model. These data suggest that NAB2 regulation represents a mechanism to guarantee transient EGR-1 activity following exposure of endothelial cells to VEGF and that NAB2 overexpression could be used to inhibit signals involved in the early phase of angiogenesis. In this study we have investigated the role of a specific corepressor of EGR-1, NAB2, to down-regulate vascular endothelial growth factor (VEGF)-induced gene expression in endothelial cells and to inhibit angiogenesis. Firstly, we show a reciprocal regulation of EGR-1 and NAB2 following VEGF treatment. During the initial phase EGR-1 is rapidly induced and NAB2 levels are down-regulated. This is followed by a reduction of EGR-1 and a concomitant increase of NAB2. Secondly, using the tissue factor gene as a readout for VEGF-induced and EGR-1-regulated gene expression we demonstrate that NAB2 can completely block VEGF-induced tissue factor reporter gene activity. Thirdly, by adenovirus-mediated expression we show that NAB2 inhibits up-regulation of tissue factor, VEGF receptor-1, and urokinase plasminogen activator mRNAs even when a combination of VEGF and bFGF is used for induction. In addition, NAB2 overexpression significantly reduced tubule and sprout formation in two different in vitro angiogenesis assays and largely prevented the invasion of cells and formation of vessel-like structures in the murine Matrigel model. These data suggest that NAB2 regulation represents a mechanism to guarantee transient EGR-1 activity following exposure of endothelial cells to VEGF and that NAB2 overexpression could be used to inhibit signals involved in the early phase of angiogenesis. vascular endothelial growth factor protein kinase B protein kinase C mitogen-activated protein kinase/extracellular signal-regulated kinase kinase extracellular signal-regulated kinase mitogen-activated protein tissue factor urokinase-type plasminogen activator early growth response protein human umbilical vein endothelial cells human uterine microvascular endothelial cells supplemented calf serum human lung microvascular endothelial cells green fluorescent protein phosphate-buffered saline cytomegalovirus kallikrein-inactivating unit plaque-forming unit charge-coupled device multiplicity of infection 4′,6-diamidino-2-phenylindole Vascular endothelial growth factor, VEGF,1 has a predominant role in vasculogenesis as well as in physiological and pathological angiogenesis (1Yancopoulos G.D. Davis S. Gale N.W. Rudge J.S. Wiegand S.J. Holash J. Nature. 2000; 407: 242-248Google Scholar, 2Carmeliet P. Jain R.K. Nature. 2000; 407: 249-257Google Scholar, 3Ferrara N. Alitalo K. Nat. Med. 1999; 5: 1359-1364Google Scholar). Major signals induced by VEGF via VEGFR-2 in endothelial cells include activation of the phosphoinositol 3-kinase/PKB and phospholipase C-γ/PKC pathways (4Petrova T.V. Makinen T. Alitalo K. Exp. Cell Res. 1999; 253: 117-130Google Scholar, 5Blum S. Issbruker K. Willuweit A. Hehlgans S. Lucerna M. Mechtcheriakova D. Walsh K. von der Ahe D. Hofer E. Clauss M. J. Biol. Chem. 2001; 276: 33428-33434Google Scholar). Whereas activation of PKB has been primarily implicated in cell survival (6Carmeliet P. Lampugnani M.G. Moons L. Breviario F. Compernolle V. Bono F. Balconi G. Spagnuolo R. Oostuyse B. Dewerchin M. Zanetti A. Angellilo A. Mattot V. Nuyens D. Lutgens E. Clotman F. de Ruiter M.C. Gittenberger-de Groot A. Poelmann R. Lupu F. Herbert J.M. Collen D. Dejana E. Cell. 1999; 98: 147-157Google Scholar), recent in vitro studies have shown that VEGF treatment of endothelial cells leads to a PKC-dependent activation of the MEK/ERK module of MAP kinases resulting in a rapid up-regulation of the transcription factor EGR-1 (7Mechtcheriakova D. Wlachos A. Holzmüller H. Binder B.R. Hofer E. Blood. 1999; 93: 3811-3823Google Scholar, 8Mechtcheriakova D. Schabbauer G. Lucerna M. Clauss M. De Martin R. Binder B.R. Hofer E. FASEB J. 2001; 15: 230-242Google Scholar), which has been associated with growth and differentiation of various cell types (9Qu Z. Wolfraim L.A. Svaren J. Ehrengruber M.U. Davidson N. Milbrandt J. J. Cell Biol. 1998; 142: 1075-1082Google Scholar,10Sakamoto K.M. Fraser J.K. Lee H.J. Lehman E. Gasson J.C. Mol. Cell. Biol. 1994; 14: 5975-5985Google Scholar). Furthermore, EGR-1 is critically involved in the up-regulation of genes such as tissue factor (TF) (7Mechtcheriakova D. Wlachos A. Holzmüller H. Binder B.R. Hofer E. Blood. 1999; 93: 3811-3823Google Scholar, 8Mechtcheriakova D. Schabbauer G. Lucerna M. Clauss M. De Martin R. Binder B.R. Hofer E. FASEB J. 2001; 15: 230-242Google Scholar), VEGF receptor-1 (VEGFR-1) (11Wang D. Donner D.B. Warren R.S. J. Biol. Chem. 2000; 275: 15905-15911Google Scholar,12Vidal F. Aragones J. Alfranca A. de Landazuri M.O. Blood. 2000; 95: 3387-3395Google Scholar), and urokinase-type plasminogen activator (uPA) (13Khachigian L.M. Lindner V. Williams A.J. Collins T. Science. 1996; 271: 1427-1431Google Scholar). These genes have been proposed to fulfill important functions for different aspects of vasculogenesis and angiogenesis (1Yancopoulos G.D. Davis S. Gale N.W. Rudge J.S. Wiegand S.J. Holash J. Nature. 2000; 407: 242-248Google Scholar, 2Carmeliet P. Jain R.K. Nature. 2000; 407: 249-257Google Scholar, 14Blasi F. Immunol. Today. 1997; 18: 415-417Google Scholar). Comparable to some other transactivators, EGR-1 associates with corepressor proteins that can modulate transcription of EGR-dependent genes. Two corepressors of EGR-1, NAB1 and NAB2, have been identified using yeast two-hybrid screening (15Swirnoff A.H. Apel E.D. Svaren J. Sevetson B.R. Zimonjic D.B. Popescu N.C. Milbrandt J. Mol. Cell. Biol. 1998; 18: 512-524Google Scholar, 16Svaren J. Sevetson B.R. Apel E.D. Zimonjic D.B. Popescu N.C. Milbrandt J. Mol. Cell. Biol. 1996; 16: 3545-3553Google Scholar). These factors bind to EGR-1 by direct protein-protein interactions with a conserved R1 region found in several members of the EGR family (EGR-1, -2 and -3), thus inhibiting the transactivating potential of EGR-1. Whereas NAB1 is constitutively expressed in most tissues and appears to be a general transcriptional regulator (15Swirnoff A.H. Apel E.D. Svaren J. Sevetson B.R. Zimonjic D.B. Popescu N.C. Milbrandt J. Mol. Cell. Biol. 1998; 18: 512-524Google Scholar), NAB2 may function as an important inducible regulator of gene expression (16Svaren J. Sevetson B.R. Apel E.D. Zimonjic D.B. Popescu N.C. Milbrandt J. Mol. Cell. Biol. 1996; 16: 3545-3553Google Scholar). Initially, the physiologic activities of NAB2 have been analyzed in nerve cells where the EGR-1-mediated differentiation process stimulated by nerve growth factor was blocked by the corepressor NAB2 (9Qu Z. Wolfraim L.A. Svaren J. Ehrengruber M.U. Davidson N. Milbrandt J. J. Cell Biol. 1998; 142: 1075-1082Google Scholar). Furthermore, an inhibition of EGR-1-dependent transcription and growth factor production in smooth muscle cells with implications for tissue repair and angiogenesis was recently reported (17Silverman E.S. Khachigian L.M. Santiago F.S. Williams A.J. Lindner V. Collins T. Am. J. Pathol. 1999; 155: 1311-1317Google Scholar, 18Houston P. Campbell C.J. Svaren J. Milbrandt J. Braddock M. Biochem. Biophys. Res. Comm. 2001; 283: 480-486Google Scholar). In general, gene regulation mediated by the interplay of EGR-1 and NAB2 might be a unifying principle in different invasive processes such as neurite outgrowth, wound healing, angiogenesis, and tumor invasion (19Abdulkadir S.A. Qu Z. Garabedian E. Song S.K. Peters T.J. Svaren J. Carbone J.M. Naughton C.K. Catalona W.J. Ackerman J.J. Gordon J.I. Humphrey P.A. Milbrandt J. Nat. Med. 2001; 7: 101-107Google Scholar). Based on our previous finding that the transcription factor EGR-1 is decisively involved in the up-regulation of the TF gene by VEGF in endothelial cells (7Mechtcheriakova D. Wlachos A. Holzmüller H. Binder B.R. Hofer E. Blood. 1999; 93: 3811-3823Google Scholar, 8Mechtcheriakova D. Schabbauer G. Lucerna M. Clauss M. De Martin R. Binder B.R. Hofer E. FASEB J. 2001; 15: 230-242Google Scholar), we have here analyzed to what extent NAB2 can down-modulate expression of several different genes induced by angiogenic growth factors and thus plays a direct role in the control of angiogenesis-related responses of endothelial cells. In this respect NAB2 gene transfer to endothelial cells by recombinant adenoviruses was further evaluated as a potential approach to inhibit angiogenesis. Our results show that NAB2 can strongly inhibit VEGF- and bFGF-induced expression of the TF, VEGFR-1, and uPA genes. Furthermore, the adenovirus-mediated overexpression of NAB2 led to significant inhibition of migration, sprouting, and tubule formation in angiogenesis models in vitro and in vivo without obvious cytotoxic side effects. Human umbilical vein endothelial cells (HUVEC) and human uterine microvascular endothelial cells (HUMEC) were isolated and cultured in medium 199 with 20% SCS or a 1:1 mixture of SCS and fetal calf serum (HyClone, Logan, UT), respectively, supplemented with 1 unit/ml heparin, 50 μg/ml endothelial cell growth supplement (Technoclone, Vienna, Austria), 2 mmglutamine, 100 units/ml penicillin, and 0.1 mg/ml streptomycin as described in more detail in Refs. 8Mechtcheriakova D. Schabbauer G. Lucerna M. Clauss M. De Martin R. Binder B.R. Hofer E. FASEB J. 2001; 15: 230-242Google Scholar and 20Tschugguel W. Zhegu Z. Schneeberger C. Tantscher E. Czerwenka K. Fabry A. Wojta J. Zeillinger R. Huber J.C. J. Vasc. Res. 1997; 34: 281-288Google Scholar. Human lung microvascular cells (HLMEC) were obtained from Bio-Whittaker (Walkersville, MD) and cultured as described in the protocol provided. Short-starved cells were obtained by starving with 1% serum for 5 h. Recombinant human VEGF165 and bFGF was obtained from PromoCell (Heidelberg, Germany). Polyclonal anti-EGR-1 and anti-Sp1 antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA) and polyclonal anti-GFP antibodies were from New England Biolabs (Beverly, MA). Monoclonal anti-NAB2 antibodies 1C4 (21Kirsch K.H. Korradi Y. Johnson J.P. Oncogene. 1996; 12: 963-971Google Scholar) were a gift of Dr. Judith Johnson (Institute of Immunology, University of Munich, Munich, Germany). Peroxidase-conjugated donkey anti-rabbit immunoglobulin G (IgG) and sheep anti-mouse IgG were purchased from Amersham Biosciences), and goat anti-rat IgG was from Serotec (Oxford, UK). RNA was extracted from endothelial cells with TRIzol Reagent (Invitrogen). 2 μg of total RNA was reverse-transcribed using SuperScriptTM II enzyme using oligo-dT primers as specified by Invitrogen. Real-time PCR including SYBR Green PCR reagent was performed on a Light CyclerTMinstrument (Hoffmann-La Roche) according to instructions provided by the manufacturer (22Pfaffl M.W. Nucleic Acids Res. 2001; 29: E45Google Scholar). Oligonucleotides used were TF-forward: ccgaacagttaaccggaaga, TF-reverse: tcagtggggagttctccttc; EGR-1-forward: cagcaccttcaaccctcag, EGR-1-reverse: cacaaggtgttgccactgtt; NAB2-forward: acatcctgcagcagacactg, NAB2-reverse: ctccactttcacgctgctc; VEGFR-1-forward: tgctcagctgtctgcttctc, VEGFR-1-reverse: ccatttcaggcaaagaccat; and uPA-forward: tgaggtggaaaacctcatcc, uPA-reverse: ggcaggcagatggtctgtat. Cells were washed twice with PBS, lysed in 100 μl of Laemmli buffer, scraped, and heated for 5 min at 95 °C. Total cell lysates were separated by SDS-PAGE and transferred to Immobilon-P membrane (Millipore, Bedford, MA). The membrane was blocked for 30 min with PBS containing 0.1% Tween 20 and 3% skim milk and incubated for 1 h at room temperature with the primary antibody diluted in blocking buffer. Then the membrane was washed three times for 5 min with PBS containing 0.1% Tween 20 and incubated with peroxidase-conjugated secondary antibodies for 1 h at room temperature. After a washing step, the membrane was incubated for 1 min with ECL reagent (Amersham Biosciences) and exposed to film. For reprobing with another antibody, the membrane was washed twice in PBS, stripped for 30 min at 55 °C with stripping buffer (62.5 mm Tris-HCl, pH 6.8, 2% SDS, 100 mm2-mercaptoethanol), and washed three times for 5 min with PBS at room temperature. The TF reporter gene construct containing the TF promoter from −330 to +118 bp in a luciferase expression vector was previously described (7Mechtcheriakova D. Wlachos A. Holzmüller H. Binder B.R. Hofer E. Blood. 1999; 93: 3811-3823Google Scholar, 23Moll T. Czyz M. Holzmüller H. Hofer-Warbinek R. Wagner E. Winkler H. Bach F.H. Hofer E. J. Biol. Chem. 1995; 270: 3849-3857Google Scholar). The coding region of the human EGR-1 gene including a single intron was obtained from the PAC clone E13873Q3 (library number 704, RZPD, Berlin, Germany) by PCR amplification. The resulting 2.3-kb DNA product was subcloned intoHindIII-EcoRI-digested pACCMVplpASR+ vector (24Gomez-Foix A.M. Coats W.S. Baque S. Alam T. Gerard R.D. Newgard C.B. J. Biol. Chem. 1992; 267: 25129-25134Google Scholar). The expression constructs for the human full-length NAB2 (pCMVNAB2) and the alternatively spliced NAB2.AS (pCMVNAB2.AS) (16Svaren J. Sevetson B.R. Apel E.D. Zimonjic D.B. Popescu N.C. Milbrandt J. Mol. Cell. Biol. 1996; 16: 3545-3553Google Scholar) were kindly provided by J. Milbrandt and J. Svaren (Departments of Pathology and Internal Medicine, Washington University, St. Louis, MO). Transient transfections of HUVEC were carried out by using the LipofectAMINE PLUS™ reagent (Invitrogen) as previously described (8Mechtcheriakova D. Schabbauer G. Lucerna M. Clauss M. De Martin R. Binder B.R. Hofer E. FASEB J. 2001; 15: 230-242Google Scholar). 24 h prior to transfection, HUVEC were seeded in six-well tissue culture plates to reach 70–90% confluency the next morning. Cells were incubated with transfection mixtures containing a total of 1.5 μg of DNA (0.5 μg of TF promoter/luciferase reporter, 0.5 μg of a CMV-β-galactosidase construct as internal control and various amounts of NAB2, NAB2.AS, and EGR-1 expression plasmids or empty control vector), 6 μl of PLUS reagent, and 4 μl of LipofectAMINE in a total volume of 1 ml of medium 199 per well for 2 h. All experimental values were determined from triplicate wells. Construction of recombinant adenoviruses was done as previously described (25Wrighton C.J. Hofer Warbinek R. Moll T. Eytner R. Bach F.H. De Martin R. J. Exp. Med. 1996; 183: 1013-1022Google Scholar, 26De Martin R. Raidl M. Hofer E. Binder B.R. Gene Ther. 1997; 4: 493-495Google Scholar). NAB2 and NAB2.AS cDNAs (16Svaren J. Sevetson B.R. Apel E.D. Zimonjic D.B. Popescu N.C. Milbrandt J. Mol. Cell. Biol. 1996; 16: 3545-3553Google Scholar) were first subcloned into the XmaI site of the pBluescript II SK +/− vector and then transferred to the BamHI site of the vector pACCMVpLpASR+ (24Gomez-Foix A.M. Coats W.S. Baque S. Alam T. Gerard R.D. Newgard C.B. J. Biol. Chem. 1992; 267: 25129-25134Google Scholar). The obtained constructs were verified by sequencing and cotransfected with pJM17, a plasmid containing the adenoviral genome with a deletion in the E1 region (27McGrory W.J. Bautista D.S. Graham F.L. Virology. 1988; 163: 614-617Google Scholar), into 293 cells. Clones were tested for protein expression by Western blots. Purification of large batches of the recombinant adenoviruses was done by two consecutive cesium chloride centrifugations (28Graham F.L. van der Eb A.J. Virology. 1973; 52: 456-467Google Scholar). Adenoviruses without cDNA inserts and viruses expressing GFP (26De Martin R. Raidl M. Hofer E. Binder B.R. Gene Ther. 1997; 4: 493-495Google Scholar) were grown in parallel and used as controls. For infection HUVEC were incubated in PBS complete for 30 min at a m.o.i. of 100. Thereafter, cells were washed and cultured in normal medium 199. The formation of capillary tube-like structures by HUVEC was analyzed on tumor-derived extracellular membrane matrix (Matrigel; Becton Dickinson, Franklin Lakes, NJ). 48-well culture dishes (Costar, Cambridge, MA) were coated with 100 μl/well Matrigel, and the gel was allowed to solidify. Cells were starved for 4 h in medium 199 with 1% SCS, seeded on the polymerized Matrigel (3 × 104 cells/well), further incubated for 16 h, and then fixed in PBS containing 3% formaldehyde and 2% sucrose (29Morales D.E. McGowan K.A. Grant D.S. Maheshwari S. Bhartiya D. Cid M.C. Kleinman H.K. Schnaper H.W. Circulation. 1995; 91: 755-763Google Scholar). Images of the network formed were taken on a phase contrast microscope (Nikon Diaphot TMD) using a cooled charge-coupled device camera (Kappa DX30, Kappa GmbH, Gleichen, Germany). The total length of the tube-like structures formed was then determined with the help of the Analysis Software (Softimaging System, Munster, Germany). An endothelial sprouting angiogenesis assay was performed using HLMEC or HUMEC according to a modification of the method used by Nehlset al. (30Nehls V. Schuchardt E. Drenckhahn D. Microvasc. Res. 1994; 48: 349-363Google Scholar). Briefly, microcarrier beads coated with denatured collagen (Cytodex 3; Sigma) were seeded with the infected cells, the cells were grown overnight on the beads in medium 199, and the beads then embedded in fibrin gels in 12-well plates (Costar). To prepare the fibrin gel, human fibrinogen (Sigma) was dissolved in PBS complete at a concentration of 2 mg/ml and aprotinin (Bayer, Leverkusen, Germany) was added at a concentration of 200 KIU/ml. The fibrinogen solution was then supplemented with 50 ng/ml VEGF. The solutions were transferred to 12-well plates together with the beads covered by cells at a density of about 200 beads/well, and fibrin formation was induced by addition of 1.2 units/ml thrombin (Sigma). Fibrin gels were equilibrated with serum-free medium containing aprotinin (200 KIU/ml) for 1 h and then incubated with M199 medium supplemented with 20% FCS and growth factors as indicated. After 1 to 2 days the number of capillary-like sprouts formed was counted in the microscope. Only sprouts with a minimal length of ∼150 μm were counted. To visualize cell nuclei, cells were fixed with 3.7% formaldehyde and 2% sucrose in PBS and permeabilized with 0.5% Triton X-100 in PBS. Then Hoechst 333258 was added to the cells at 500 ng/ml for 30 min. The cytoskeleton was stained with rhodamine-phalloidin (Molecular Probes, Eugene, OR) for 1 h in the dark. Cells were analyzed by phase contrast microscopy and images taken using a CCD camera. Matrigel solution (BD Biosciences) was supplemented with 1.5 × 108 pfu/ml of recombinant adenoviruses and 300 ng/ml VEGF and injected subcutaneously into the flank of C57BL/6 mice (31Passaniti A. Taylor R.M. Pili R. Guo Y. Long P.V. Haney J.A. Pauly R.R. Grant D.S. Martin G.R. Lab. Invest. 1992; 67: 519-528Google Scholar). On day 6 post injection the mice were sacrificed, and the Matrigel plug was removed and embedded in paraffin. Freeze sections of the plug were prepared and stained with hematoxylin (Merck), DAPI (Vector Laboratories, Burlingame, CA), or rat anti-mouse CD31 antibodies (Oxford, UK) as described in Ref. 31Passaniti A. Taylor R.M. Pili R. Guo Y. Long P.V. Haney J.A. Pauly R.R. Grant D.S. Martin G.R. Lab. Invest. 1992; 67: 519-528Google Scholar. Pictures were taken on an AX-70 Olympus microscope (Olympus Optical Co.) using an Optronics DEI-750D CCD camera (Optronics, Muskogee, OK). The number of cells in the Matrigel plugs were quantitated on pictures displaying largely complete sections of the plugs, which were established from serial images taken from the individual sections. The circular images of the sections were divided into 10-degree segments, and the number of the cells within six segments were counted for each section. The transcription factor EGR-1 has been previously shown by us to be induced by VEGF in endothelial cells with the kinetics typical for an immediate-early gene product showing maximal levels ∼60 min after stimulation (7Mechtcheriakova D. Wlachos A. Holzmüller H. Binder B.R. Hofer E. Blood. 1999; 93: 3811-3823Google Scholar). Here we tested the regulation of NAB2 mRNA and protein expression in endothelial cells following VEGF treatment in comparison to EGR-1. HUVEC were short-starved for 5 h in medium containing 1% serum and then treated with VEGF (1.25 nm) for various time periods up to 6 h, and the amount of EGR-1 and NAB2 mRNA and protein was determined by real-time reverse transcription-PCR and Western blotting, respectively. A transient induction of EGR-1 mRNA was observed with maximal expression at about 30 min (Fig.1 A), which was followed by a transient increase in NAB2 mRNA displaying highest values at 120 min. EGR-1 protein levels decreased during starvation (data not shown), were very low in 5 h serum-starved endothelial cells, and reached maximal values 60 min after VEGF treatment (Fig. 1 B). NAB2 levels also decreased during starvation reaching a constant basal level within 5 h. In contrast to EGR-1, VEGF treatment resulted first in a further 4- to 5-fold decrease of NAB2 within 60 min, the time period when EGR-1 levels reached highest values. Thereafter, concomitant with a decrease in EGR-1, NAB2 protein increased again about 10-fold reaching levels at least 2- to 3-fold over initial values. Thus, NAB2 and EGR-1 expression are regulated in a reciprocal way by VEGF. In accordance with important roles of EGR-1 and NAB2 for TF gene transcription, TF mRNA levels reached highest levels at 60 min (Fig. 1 C) at a time period when maximal EGR-1 and lowest NAB2 levels were observed. We have previously shown (7Mechtcheriakova D. Wlachos A. Holzmüller H. Binder B.R. Hofer E. Blood. 1999; 93: 3811-3823Google Scholar, 8Mechtcheriakova D. Schabbauer G. Lucerna M. Clauss M. De Martin R. Binder B.R. Hofer E. FASEB J. 2001; 15: 230-242Google Scholar) that EGR-1 plays an essential role in the activation of the TF gene by VEGF. Therefore, overexpression of NAB2 was tested for its ability to repress VEGF-induced TF promoter activity in reporter gene assays in comparison to EGR-1-triggered activation. Indeed, overexpression of NAB2 resulted in a dose-dependent complete inhibition of VEGF-induced TF promoter activity (Fig. 2), which was comparable to the inhibition of EGR-1-triggered promoter activity. NAB2.AS, a truncated variant of NAB2, which lacks the C-terminal part interacting with EGR-1 (16Svaren J. Sevetson B.R. Apel E.D. Zimonjic D.B. Popescu N.C. Milbrandt J. Mol. Cell. Biol. 1996; 16: 3545-3553Google Scholar) and does not localize to the nucleus, 2D. Mechtcheriakova, M. Lucerna, and E. Hofer, unpublished observation. did not block VEGF- and EGR-1-mediated transactivation. These results demonstrate that the transcriptional corepressor NAB2 is able to block VEGF-induced gene regulation mediated by EGR-1 in endothelial cells. To test the effect of overexpression of NAB2 on VEGF-inducible responses of endothelial cells that are linked to and regulated by EGR-1, we constructed a recombinant adenovirus expressing NAB2 and infected human endothelial cells with 107 pfu/105 cells. Infected HUVEC showed increasing levels of NAB2 expression from day 1 to day 3 following infection that persisted for over 7 days (Fig.3). These expression levels were significantly higher than physiological levels in endothelial cells as indicated by the fact that the endogenous NAB2 is not visible on images of short Western blot exposures displaying strong bands of adenovirus-expressed NAB2. We first evaluated the effect of adenovirus-mediated NAB2 expression on the induction of mRNAs for TF, uPA, and VEGFR-1 by VEGF (data not shown) and a combination of VEGF and bFGF (Fig.4). uPA and VEGFR-1 were chosen in addition to TF since EGR-1 has been reported to be involved in the up-regulation of the respective genes (12Vidal F. Aragones J. Alfranca A. de Landazuri M.O. Blood. 2000; 95: 3387-3395Google Scholar, 13Khachigian L.M. Lindner V. Williams A.J. Collins T. Science. 1996; 271: 1427-1431Google Scholar). Furthermore, several lines of evidence support an important role of uPA for migration and invasion and of VEGFR-1 for pathological angiogenesis, respectively (2Carmeliet P. Jain R.K. Nature. 2000; 407: 249-257Google Scholar,14Blasi F. Immunol. Today. 1997; 18: 415-417Google Scholar). A combination of VEGF and bFGF was tested because both factors induce EGR-1, have been described to be present in the Matrigel preparations used for the angiogenesis assays described below, and contribute to tumor angiogenesis in vivo (2Carmeliet P. Jain R.K. Nature. 2000; 407: 249-257Google Scholar, 32Santiago F.S. Lowe H.C. Day F.L. Chesterman C.N. Khachigian L.M. Am. J. Pathol. 1999; 154: 937-944Google Scholar). When endothelial cells were infected with the NAB2-expressing virus and induced with the growth factors 2 days thereafter, the normally observed induction of all three mRNAs was inhibited to a large degree (Fig. 4). This shows that by blocking EGR-1 activity NAB2 can inhibit the expression of several genes induced by angiogenic growth factors and involved in angiogenesis. Next we have tested whether this inhibition of gene up-regulation by NAB2 would have consequences for the cellular angiogenic responses of endothelial cells in two different in vitro angiogenesis assays. In one assay we have evaluated the potential of Ad.NAB2 to inhibit migration and tubular network formation after plating of endothelial cells on Matrigel. In the second assay the capacity of endothelial cells to form sprouts and migrate into fibrin gels was investigated. In both cases cells infected with Ad.NAB2 were compared with cells infected with control virus for 24 h. Infection with Ad.NAB2 reduced by 52 ± 14% the tubular network established by HUVEC 16 h after seeding on Matrigel (Fig.5). Parallel cultures seeded on gelatin-coated plates did not display any cytotoxicity caused by the virus infection (data not shown). For the sprouting assay HLMEC or HUMEC were seeded on microcarrier beads, and the beads incorporated into fibrin gels. In this assay the sprouting of the microvascular endothelial cells from the beads into the fibrin gel was dependent to a large degree on the presence of VEGF in the medium (Fig.6). Individual sprouts contained usually between 1 to 3 cells in a string and displayed thin protrusions into the fibrin gel. Also in this assay the capacity of the VEGF-induced cells to form sprouts and to migrate into the fibrin gel was significantly reduced (45 ± 18%, Fig. 6 B).Figure 6Overexpression of NAB2 reduces sprouting in fibrin gels. Cultures of HLMEC or HUMEC were infected with Ad.NAB2 or control virus. After 24 h cells were trypsinized, seeded onto microcarrier beads and further cultivated overnight. On the following day the microcarrier beads covered by a dense monolayer of cells were incorporated into fibrin gels in 24-well tissue culture plates and incubated with growth medium without added growth factors or supplemented with VEGF. 24 to 48 h after incorporation into fibrin gels and incubation with the growth factor cells migrated and formed sprouts into the fibrin gel. A, shows an example of sprouts formed by HLMEC in the presence of VEGF. The cytoskeleton of the cells and the nuclei were stained with rhodamine-phalloidin and Hoechst 333258, respectively. An overlay of the stained cytoskeleton (red) and nuclei (blue) is displayed. Typically between 0.5 and 3 sprouts per bead were observed for growth factor-treated cells. B, shows the analysis of the inhibition in the number of sprouts observed in VEGF-containing culture when Ad.NAB2 infected cells were used in comparison to control virus-infected cells. The mean value ± S.D. calculated from three independent experiments performed with duplicate wells is given.View Large Image Figure ViewerDownload (PPT) Finally, we have evaluated to which degree Ad.NAB2 would inhibit the invasion of cells and the formation of vessel-like structures in the murine Matrigel model in vivo(31Passaniti A. Taylor R.M. Pili R. Guo Y. Long P.V. Haney J.A. Pauly R.R. Grant D.S. Martin G.R. Lab. Invest. 1992; 67: 519-528Google Scholar). For this purpose GFP- or NAB2-expressing adenoviruses were mixed into Matrigel solution without or supplemented with VEGF. These mixtures were injected subcutaneously into mice and analyzed 6 days thereafter. We have first tested whether adenoviruses would efficiently infect cells invading the Matrigel plug by staining sections of Ad.GFP- and VEGF-containing plugs with anti-GFP antibodies and DAPI. By comparing the number of GFP-expressing cells inside the plug (Fig.7, picture 1) with the number of nuclei stained with DAPI (Fig. 7, picture 2), it was evident that the cells inside the Matrigel plug were almost completely infected. This is best displayed in the overlay of both stainin" @default.
• W2109356886 created "2016-06-24" @default.
• W2109356886 creator A5005275355 @default.
• W2109356886 creator A5007069377 @default.
• W2109356886 creator A5008096996 @default.
• W2109356886 creator A5021230845 @default.
• W2109356886 creator A5025839091 @default.
• W2109356886 creator A5026140682 @default.
• W2109356886 creator A5027612798 @default.
• W2109356886 creator A5032093610 @default.
• W2109356886 creator A5054347355 @default.
• W2109356886 creator A5059071205 @default.
• W2109356886 creator A5060502597 @default.
• W2109356886 creator A5069818904 @default.
• W2109356886 date "2003-03-01" @default.
• W2109356886 modified "2023-10-17" @default.
• W2109356886 title "NAB2, a Corepressor of EGR-1, Inhibits Vascular Endothelial Growth Factor-mediated Gene Induction and Angiogenic Responses of Endothelial Cells" @default.
• W2109356886 cites W1485904813 @default.
• W2109356886 cites W1496680932 @default.
• W2109356886 cites W1566540765 @default.
• W2109356886 cites W1567559129 @default.
• W2109356886 cites W1573363574 @default.
• W2109356886 cites W1588051837 @default.
• W2109356886 cites W1679229092 @default.
• W2109356886 cites W1762724222 @default.
• W2109356886 cites W1783580437 @default.
• W2109356886 cites W1875554126 @default.
• W2109356886 cites W1965372133 @default.
• W2109356886 cites W1976523980 @default.
• W2109356886 cites W1979012323 @default.
• W2109356886 cites W1982724357 @default.
• W2109356886 cites W1985038223 @default.
• W2109356886 cites W1985712533 @default.
• W2109356886 cites W1987454669 @default.
• W2109356886 cites W1990698300 @default.
• W2109356886 cites W1993573575 @default.
• W2109356886 cites W2012710893 @default.
• W2109356886 cites W2015111081 @default.
• W2109356886 cites W2016435634 @default.
• W2109356886 cites W2018512891 @default.
• W2109356886 cites W2037067246 @default.
• W2109356886 cites W2037137289 @default.
• W2109356886 cites W2046432580 @default.
• W2109356886 cites W2051109788 @default.
• W2109356886 cites W2059671369 @default.
• W2109356886 cites W2060971578 @default.
• W2109356886 cites W2071366179 @default.
• W2109356886 cites W2075829745 @default.
• W2109356886 cites W2075859939 @default.
• W2109356886 cites W2078676742 @default.
• W2109356886 cites W2082392313 @default.
• W2109356886 cites W2082452446 @default.
• W2109356886 cites W2104231986 @default.
• W2109356886 cites W2108244474 @default.
• W2109356886 cites W2117540633 @default.
• W2109356886 cites W2123995229 @default.
• W2109356886 cites W2125086777 @default.
• W2109356886 cites W2146508957 @default.
• W2109356886 cites W2147176626 @default.
• W2109356886 cites W2155439939 @default.
• W2109356886 cites W57751054 @default.
• W2109356886 doi "https://doi.org/10.1074/jbc.m204937200" @default.
• W2109356886 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12427750" @default.
• W2109356886 hasPublicationYear "2003" @default.
• W2109356886 type Work @default.
• W2109356886 sameAs 2109356886 @default.
• W2109356886 citedByCount "90" @default.
• W2109356886 countsByYear W21093568862012 @default.
• W2109356886 countsByYear W21093568862013 @default.
• W2109356886 countsByYear W21093568862014 @default.
• W2109356886 countsByYear W21093568862015 @default.
• W2109356886 countsByYear W21093568862018 @default.
• W2109356886 countsByYear W21093568862019 @default.
• W2109356886 countsByYear W21093568862020 @default.
• W2109356886 countsByYear W21093568862021 @default.
• W2109356886 countsByYear W21093568862022 @default.
• W2109356886 countsByYear W21093568862023 @default.
• W2109356886 crossrefType "journal-article" @default.
• W2109356886 hasAuthorship W2109356886A5005275355 @default.
• W2109356886 hasAuthorship W2109356886A5007069377 @default.
• W2109356886 hasAuthorship W2109356886A5008096996 @default.
• W2109356886 hasAuthorship W2109356886A5021230845 @default.
• W2109356886 hasAuthorship W2109356886A5025839091 @default.
• W2109356886 hasAuthorship W2109356886A5026140682 @default.
• W2109356886 hasAuthorship W2109356886A5027612798 @default.
• W2109356886 hasAuthorship W2109356886A5032093610 @default.
• W2109356886 hasAuthorship W2109356886A5054347355 @default.
• W2109356886 hasAuthorship W2109356886A5059071205 @default.
• W2109356886 hasAuthorship W2109356886A5060502597 @default.
• W2109356886 hasAuthorship W2109356886A5069818904 @default.
• W2109356886 hasBestOaLocation W21093568861 @default.
• W2109356886 hasConcept C103041312 @default.
• W2109356886 hasConcept C104317684 @default.
• W2109356886 hasConcept C146285616 @default.
• W2109356886 hasConcept C146777309 @default.
• W2109356886 hasConcept C150194340 @default.
• W2109356886 hasConcept C15215337 @default.
• W2109356886 hasConcept C158448853 @default.

• next