FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2113176230> ?p ?o ?g. }

• W2113176230 endingPage "38572" @default.
• W2113176230 startingPage "38565" @default.
• W2113176230 abstract "Okazaki fragments contain an initiator RNA/DNA primer that must be removed before the fragments are joined. In eukaryotes, the primer region is raised into a flap by the strand displacement activity of DNA polymerase δ. The Dna2 helicase/nuclease and then flap endonuclease 1 (FEN1) are proposed to act sequentially in flap removal. Dna2 and FEN1 both employ a tracking mechanism to enter the flap 5′ end and move toward the base for cleavage. In the current model, Dna2 must enter first, but FEN1 makes the final cut at the flap base, raising the issue of how FEN1 passes the Dna2. To address this, nuclease-inactive Dna2 was incubated with a DNA flap substrate and found to bind with high affinity. FEN1 was then added, and surprisingly, there was little inhibition of FEN1 cleavage activity. FEN1 was later shown, by gel shift analysis, to remove the wild type Dna2 from the flap. RNA can be cleaved by FEN1 but not by Dna2. Pre-bound wild type Dna2 was shown to bind an RNA flap but not inhibit subsequent FEN1 cleavage. These results indicate that there is a novel interaction between the two proteins in which FEN1 disengages the Dna2 tracking mechanism. This interaction is consistent with the idea that the two proteins have evolved a special ability to cooperate in Okazaki fragment processing. Okazaki fragments contain an initiator RNA/DNA primer that must be removed before the fragments are joined. In eukaryotes, the primer region is raised into a flap by the strand displacement activity of DNA polymerase δ. The Dna2 helicase/nuclease and then flap endonuclease 1 (FEN1) are proposed to act sequentially in flap removal. Dna2 and FEN1 both employ a tracking mechanism to enter the flap 5′ end and move toward the base for cleavage. In the current model, Dna2 must enter first, but FEN1 makes the final cut at the flap base, raising the issue of how FEN1 passes the Dna2. To address this, nuclease-inactive Dna2 was incubated with a DNA flap substrate and found to bind with high affinity. FEN1 was then added, and surprisingly, there was little inhibition of FEN1 cleavage activity. FEN1 was later shown, by gel shift analysis, to remove the wild type Dna2 from the flap. RNA can be cleaved by FEN1 but not by Dna2. Pre-bound wild type Dna2 was shown to bind an RNA flap but not inhibit subsequent FEN1 cleavage. These results indicate that there is a novel interaction between the two proteins in which FEN1 disengages the Dna2 tracking mechanism. This interaction is consistent with the idea that the two proteins have evolved a special ability to cooperate in Okazaki fragment processing. Replication of eukaryotic cellular DNA involves the synthesis and joining of Okazaki fragments on the lagging strand. These fragments are 100-150 nucleotides long in eukaryotes (1Kornberg A. Baker T.A. DNA Replication, 2nd Ed. W. H. Freeman, New York1992: 140-144Google Scholar). They are initiated by polymerase α/primase (pol α) 2The abbreviations used are: pol, polymerase; FEN1, flap endonuclease 1; OFP, Okazaki fragment processing; RPA, replication protein A; ssDNA, single-stranded DNA; ssRNA, single-stranded RNA; DTT, dithiothreitol. 2The abbreviations used are: pol, polymerase; FEN1, flap endonuclease 1; OFP, Okazaki fragment processing; RPA, replication protein A; ssDNA, single-stranded DNA; ssRNA, single-stranded RNA; DTT, dithiothreitol. complex, which synthesizes 10-12 nucleotides of RNA followed by ∼20 nucleotides of DNA (2Bambara R.A. Murante R.S. Henricksen L.A. J. Biol. Chem. 1997; 272: 4647-4650Abstract Full Text Full Text PDF PubMed Scopus (298) Google Scholar). pol α is then replaced by a complex consisting of proliferating cell nuclear antigen and polymerase δ (pol δ) through a process known as polymerase switching. Polymerase ϵ (pol ϵ) may also play a role in lagging strand synthesis or processing, because some portion of the cellular proliferating cell nuclear antigen is bound by pol ϵ during S-phase (3Hubscher U. Maga G. Spadari S. Annu. Rev. Biochem. 2002; 71: 133-163Crossref PubMed Scopus (584) Google Scholar, 4Rytkonen A.K. Vaara M. Nethanel T. Kaufmann G. Sormunen R. Laara E. Nasheuer H.P. Rahmeh A. Lee M.Y. Syvaoja J.E. Pospiech H. FEBS J. 2006; 273: 2984-3001Crossref PubMed Scopus (23) Google Scholar). DNA synthesis continues until pol δ encounters a downstream Okazaki fragment, at which time strand displacement synthesis creates a single-stranded flap (5Ayyagari R. Gomes X.V. Gordenin D.A. Burgers P.M. J. Biol. Chem. 2003; 278: 1618-1625Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar, 7Podust V.N. Podust L.M. Goubin F. Ducommun B. Hubscher U. Biochemistry. 1995; 34: 8869-8875Crossref PubMed Scopus (107) Google Scholar). This flap must then be processed to form a continuous strand of DNA, a pathway known as Okazaki fragment processing (OFP).Several models of OFP have been developed from reconstitution studies in vitro in which nuclease activity is used to remove the primer made by pol α followed by ligation to form a continuous strand (6Maga G. Villani G. Tillement V. Stucki M. Locatelli G.A. Frouin I. Spadari S. Hubscher U. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 14298-14303Crossref PubMed Scopus (110) Google Scholar, 8Hubscher U. Seo Y.S. Mol. Cells. 2001; 12: 149-157PubMed Google Scholar, 9Rossi M.L. Purohit V. Brandt P.D. Bambara R.A. Chem. Rev. 2006; 106: 453-473Crossref PubMed Scopus (54) Google Scholar). One model, proposed by the Burgers group (5Ayyagari R. Gomes X.V. Gordenin D.A. Burgers P.M. J. Biol. Chem. 2003; 278: 1618-1625Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar, 10Jin Y.H. Ayyagari R. Resnick M.A. Gordenin D.A. Burgers P.M. J. Biol. Chem. 2003; 278: 1626-1633Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar), suggests that short flaps are created by pol δ strand displacement synthesis and are successively cleaved by flap endonuclease 1 (FEN1). Saccharomyces cerevisiae FEN1, also known as Rad27p, is a 42-kDa protein with 5′ to 3′ single-stranded DNA (ssDNA) endonuclease activity and minor 5′ to 3′ exonuclease activity (11Harrington J.J. Lieber M.R. EMBO J. 1994; 13: 1235-1246Crossref PubMed Scopus (371) Google Scholar). FEN1 has been shown to cleave at the base of a 5′ single-stranded flap substrate (11Harrington J.J. Lieber M.R. EMBO J. 1994; 13: 1235-1246Crossref PubMed Scopus (371) Google Scholar, 13Murante R.S. Rust L. Bambara R.A. J. Biol. Chem. 1995; 270: 30377-30383Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar). Additionally, FEN1 has been shown to prefer short flaps to long flaps (5Ayyagari R. Gomes X.V. Gordenin D.A. Burgers P.M. J. Biol. Chem. 2003; 278: 1618-1625Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar, 14Kao H.I. Veeraraghavan J. Polaczek P. Campbell J.L. Bambara R.A. J. Biol. Chem. 2004; 279: 15014-15024Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar).S. cerevisiae Dna2 was first implicated in OFP when it was found to associate both genetically and physically with FEN1 (15Budd M.E. Campbell J.L. Mol. Cell. Biol. 1997; 17: 2136-2142Crossref PubMed Scopus (192) Google Scholar). It has recently been shown to be associated with other components of OFP, including ExoI, RNaseH2, Rrm3, Sgs1, and Pol32 (16Budd M.E. Tong A.H. Polaczek P. Peng X. Boone C. Campbell J.L. PLoS Genet. 2005; 1: e61Crossref PubMed Scopus (0) Google Scholar). Dna2 is a 172-kDa protein that is essential in yeast (17Budd M.E. Choe W.C. Campbell J.L. J. Biol. Chem. 1995; 270: 26766-26769Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar, 20Kang H.Y. Choi E. Bae S.H. Lee K.H. Gim B.S. Kim H.D. Park C. MacNeill S.A. Seo Y.S. Genetics. 2000; 155: 1055-1067Crossref PubMed Google Scholar) and has two domains, as determined by limited proteolysis studies (21Bae S.H. Kim J.A. Choi E. Lee K.H. Kang H.Y. Kim H.D. Kim J.H. Bae K.H. Cho Y. Park C. Seo Y.S. Nucleic Acids Res. 2001; 29: 3069-3079Crossref PubMed Scopus (40) Google Scholar). One domain, found at the C terminus, possesses ssDNA-dependent ATPase activity and ATP-dependent 5′ to 3′ helicase activity (17Budd M.E. Choe W.C. Campbell J.L. J. Biol. Chem. 1995; 270: 26766-26769Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar, 22Budd M.E. Campbell J.L. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 7642-7646Crossref PubMed Scopus (150) Google Scholar, 23Bae S.H. Seo Y.S. J. Biol. Chem. 2000; 275: 38022-38031Abstract Full Text Full Text PDF PubMed Scopus (158) Google Scholar). The second domain, located between residues 650 and 700, contains homology to the RecB nuclease domain. This domain contains 5′ to 3′, and minor 3′ to 5′, ssDNA nuclease activities (23Bae S.H. Seo Y.S. J. Biol. Chem. 2000; 275: 38022-38031Abstract Full Text Full Text PDF PubMed Scopus (158) Google Scholar, 24Bae S.H. Choi E. Lee K.H. Park J.S. Lee S.H. Seo Y.S. J. Biol. Chem. 1998; 273: 26880-26890Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar). The ratio of helicase and nuclease activities can be regulated in vitro by ATP concentration (18Budd M.E. Choe W. Campbell J.L. J. Biol. Chem. 2000; 275: 16518-16529Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar, 25Bae S.H. Kim D.W. Kim J. Kim J.H. Kim D.H. Kim H.D. Kang H.Y. Seo Y.S. J. Biol. Chem. 2002; 277: 26632-26641Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar, 26Kao H.I. Henricksen L.A. Liu Y. Bambara R.A. J. Biol. Chem. 2002; 277: 14379-14389Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar). Dna2 was further implicated in OFP when the ssDNA-binding protein, replication protein A (RPA), was shown to physically interact with Dna2 (27Bae K.H. Kim H.S. Bae S.H. Kang H.Y. Brill S. Seo Y.S. Nucleic Acids Res. 2003; 31: 3006-3015Crossref PubMed Scopus (49) Google Scholar, 28Bae S.H. Bae K.H. Kim J.A. Seo Y.S. Nature. 2001; 412: 456-461Crossref PubMed Scopus (281) Google Scholar) and stimulate Dna2 activity while repressing FEN1 activity on a flap substrate (5Ayyagari R. Gomes X.V. Gordenin D.A. Burgers P.M. J. Biol. Chem. 2003; 278: 1618-1625Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar, 10Jin Y.H. Ayyagari R. Resnick M.A. Gordenin D.A. Burgers P.M. J. Biol. Chem. 2003; 278: 1626-1633Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar, 14Kao H.I. Veeraraghavan J. Polaczek P. Campbell J.L. Bambara R.A. J. Biol. Chem. 2004; 279: 15014-15024Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar, 25Bae S.H. Kim D.W. Kim J. Kim J.H. Kim D.H. Kim H.D. Kang H.Y. Seo Y.S. J. Biol. Chem. 2002; 277: 26632-26641Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar, 28Bae S.H. Bae K.H. Kim J.A. Seo Y.S. Nature. 2001; 412: 456-461Crossref PubMed Scopus (281) Google Scholar, 29Garg P. Stith C.M. Sabouri N. Johansson E. Burgers P.M. Genes Dev. 2004; 18: 2764-2773Crossref PubMed Scopus (174) Google Scholar). This led to the RPA/Dna2/FEN1 model, proposed by the Seo group (23Bae S.H. Seo Y.S. J. Biol. Chem. 2000; 275: 38022-38031Abstract Full Text Full Text PDF PubMed Scopus (158) Google Scholar). In this model, flaps displaced by pol δ reach a length that allows them to be coated by RPA. Bound RPA inhibits cleavage by FEN1 but not by Dna2. Dna2 would then cleave these RPA-coated flaps, releasing RPA. Dna2 does not have cleavage specificity for the flap base (14Kao H.I. Veeraraghavan J. Polaczek P. Campbell J.L. Bambara R.A. J. Biol. Chem. 2004; 279: 15014-15024Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar). Instead it produces short (5-7 nucleotides), RPA-free flaps that are substrates for FEN1. The current view is that some portion of OFP occurs by the RPA/Dna2/FEN1 pathway (9Rossi M.L. Purohit V. Brandt P.D. Bambara R.A. Chem. Rev. 2006; 106: 453-473Crossref PubMed Scopus (54) Google Scholar).The model above suggests that a unique interplay between Dna2 and FEN1 exists. As stated previously, FEN1 and Dna2 interact physically with each other. The experiments discussed in this paper are used to further understand the interaction between these two proteins. Both FEN1 and Dna2 have been shown to employ a tracking mechanism to cleave the flap substrate (13Murante R.S. Rust L. Bambara R.A. J. Biol. Chem. 1995; 270: 30377-30383Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar, 30Kao H.I. Campbell J.L. Bambara R.A. J. Biol. Chem. 2004; 279: 50840-50849Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar, 31Tom S. Henricksen L.A. Bambara R.A. J. Biol. Chem. 2000; 275: 10498-10505Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar). They both must interact with the 5′ end of the flap and then move to the site of cleavage. Dna2 was found to act as if it were threaded onto the flap like a bead on a string (30Kao H.I. Campbell J.L. Bambara R.A. J. Biol. Chem. 2004; 279: 50840-50849Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar). Because they are proposed to act in order, the Dna2 must cleave but then allow the FEN1 to have access to the 5′ end of the shorter flap. In this study, we used a nuclease-inactive Dna2 to block the base of a flap substrate and then determined whether FEN1 could access the substrate. Surprisingly, FEN1 was capable of efficient cleavage. We then explored the mechanism by which FEN1 could reach its cleavage site.EXPERIMENTAL PROCEDURESMaterials—Synthetic oligonucleotides, including the 5′-biotin conjugation, were produced by Integrated DNA Technologies. Radionucleotide [α-32P]dCTP (6000 Ci/mmol) was obtained from PerkinElmer Life Sciences. The Klenow fragment of DNA polymerase I and ATP were from Roche Applied Science. All other reagents were the best available commercial grade.Enzyme Expression and Purification—S. cerevisiae Dna2 was cloned into the Sf9 baculovirus expression vector (Invitrogen). It was then expressed and purified as described previously (18Budd M.E. Choe W. Campbell J.L. J. Biol. Chem. 2000; 275: 16518-16529Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar), except that High Five cells were utilized for the final expression step of the protein. S. cerevisiae Dna2 E675A was created by site-directed mutagenesis as described in Ref. 18Budd M.E. Choe W. Campbell J.L. J. Biol. Chem. 2000; 275: 16518-16529Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar. It was then expressed and purified as described above for the wild type Dna2. S. cerevisiae FEN1 was cloned into the T7 expression vector pET-FCH and overexpressed in Escherichia coli. It was then purified as described previously (26Kao H.I. Henricksen L.A. Liu Y. Bambara R.A. J. Biol. Chem. 2002; 277: 14379-14389Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar).Oligonucleotides—All downstream primers were labeled at the 3′ terminus with [α-32P]dCTP (6000 Ci/mmol) by the Klenow enzyme. They were then purified on a 12% polyacrylamide gel containing 7 m urea. DNA substrates were annealed in 50 mm Tris, pH 8.0, 50 mm NaCl, and 1 mm dithiothreitol (DTT), and substrates containing RNA were annealed in 10 mm Tris, pH 8.0, 1 mm EDTA, and 50 mm NaCl. For annealing, substrates were incubated at 95 °C for 5 min and then cooled slowly to room temperature. Protector RNase Inhibitor (Roche Applied Science) was then added to RNA-containing substrates. All substrates were annealed in a 1:2:4 ratio of downstream primer to template to upstream primer. Most experiments described were done using a 53-nucleotide DNA flap substrate. This substrate consisted of the following: downstream primer-5′-/biotin/GTACCGAGCTCGAATTCGCCCGTTTCACGCCTGTTAGTTAATTCACTGGCCGTCGTTTTACAACGACGTGACTGGG-3′, upstream primer-5′-CGCCAGGGTTTTCCCAGTCACGACA-3′, and template-5′-GCCCAGTCACGTCGTTGTAAAACGGGTCGTGACTGGGAAAACCCTGGCG-3′. The experiments shown in Fig. 5 involved a 30-nucleotide RNA flap substrate, which consisted of the following primers (RNA is in bold): downstream primer-5′-GUCACGCCUGUUAGUUAAUUCACUGGCCGUCCACCCGUCCACCCGACG-3′, upstream primer-5′-CGACCGTGCCAGCCTAAATTTCAAGA-3′, and template-5′-GCGTCGGGTGGACGGGTGGCTTGAAATTTAGGCTGGCACGGTCG-3′.Nuclease Assay—The reaction buffer for both Dna2 and FEN1 reactions consisted of 50 mm Tris-HCl, pH 8.0, 30 mm NaCl, 2 mm DTT, 0.1 mg/ml bovine serum albumin, 2 mm MgCl2, 5% glycerol, and 10 μm ATP. The reaction mixture volume was 20 μl, which included 5 fmol of labeled substrate and various amounts of enzymes, as indicated in the figure legends. Reactions were then incubated for 10 min at 37 °C, unless otherwise indicated, and stopped with a 2× termination dye (90% formamide (v/v), 10 mm EDTA, with 0.01% bromphenol blue and xylene cyanol). Reactions were then separated on a 15% polyacrylamide gel containing 7 m urea. Pre-binding Dna2 conditions were as follows. Dna2 and labeled substrate were mixed, incubated for 10 min on ice, and then incubated for 5 min at 37 °C. In Figs. 1B and 5B, Dna2 was pre-bound prior to FEN1 addition. In Figs. 1B and 3, streptavidin was used in 50-fold excess over substrate and was conjugated to the 5′-biotin by incubation at 37 °C for 10 min. In Fig. 2, 50 microunits of micrococcal nuclease (Fermentas) in 50 mm Tris-HCl, pH 8.0, 30 mm NaCl, 2 mm DTT, 0.1 mg/ml bovine serum albumin, and 2 mm CaCl2 was added after Dna2 E675A was bound to substrate, as described previously. The reaction was then incubated at 37 °C for 10 min. For experiments using RNA, Protector RNase Inhibitor (Roche Applied Science) was added to help prevent RNA degradation.FIGURE 1FEN1 cleavage is not inhibited by Dna2 E675A-bound flaps. A, a gel shift assay was preformed with 100 fmol (lane 2) and 200 fmol (lane 3) of Dna2 E675A and 5 fmol of the 53-nucleotide flap substrate as indicated under “Experimental Procedures.” Lane 1 is the substrate alone control. Percent bound, shown below the gel, is defined as: (bound/(bound + unbound)) × 100. B, 5 fmol of the 53-nucleotide flap substrate was incubated under the following conditions (described under “Experimental Procedures”): circles, 5 fmol of FEN1 was added at time zero; squares, 200 fmol of Dna2 E675A was pre-bound with substrate prior to FEN1 addition at time zero; diamonds, 250 fmol of streptavidin was pre-bound with substrate prior to FEN1 addition at time zero. Time points were taken at 0, 0.25, 0.5, 1, 2.5, 5, and 10 min. Percent cleavage is defined as: (cleaved/(cleaved + uncleaved)) × 100. The graph is an average of two experiments, and error bars indicate S.D. The substrate, used in both A and B, is depicted above the gel in A, where the asterisk indicates the site of the 3′ 32P radiolabel and B indicates the 5′-biotin.View Large Image Figure ViewerDownload Hi-res image Download (PPT)FIGURE 3Bound Dna2 E675A does not allow bypass of FEN1 tracking. A nuclease assay was used to assess the cleavage of FEN1 on the 53-nucleotide flap as described under “Experimental Procedures.” Streptavidin (lanes 1-6) and Dna2 E675A (lanes 2 and 4-6) were preincubated with the substrate as described under “Experimental Procedures.” Dna2 E675A (500 fmol) was pre-bound to 5 fmol of substrate, which was then blocked with streptavidin. 0.1 (lane 4), 0.5 (lane 5), and 1 fmol (lane 6) of FEN1 was then added. Lane 7 indicates the amount of FEN1 (1 fmol) cleavage without pre-bound streptavidin compared with lane 3 with streptavidin. Lane 1 is substrate alone, and lane 2 is substrate bound by Dna2 E675A (500 fmol) without FEN1 added. Percent cleavage, shown below the gel, is defined as: (cleaved/(cleaved + uncleaved)) × 100. The substrate is depicted above the gel, the asterisk indicates the site of the 3′ 32P radiolabel, and B indicates the 5′-biotin.View Large Image Figure ViewerDownload Hi-res image Download (PPT)FIGURE 2Dna2 blocks micrococcal nuclease cleavage. Dna2 E675A, 100 fmol (lane 3), 200 fmol (lane 4), and 500 fmol (lane 5), was pre-bound to 5 fmol of the labeled 53-nucleotide flap, and micrococcal nuclease (MNase) was then added at time zero as described under “Experimental Procedures.” The reaction was then incubated at 37 °C for 10 min. Lane 1 is the substrate alone control, lane 2 is micrococcal nuclease without Dna2 present, and lane 6 is the highest Dna2 E675A concentration without micrococcal nuclease. In lane 7, FEN1 was used to identify the base of the flap. Percent protection is defined as: (area of protection/(area of protection + uncleaved substrates)) × 100. The substrate used is depicted above the gel, the asterisk indicates the site of the 3′ 32P radiolabel, and B indicates the 5′-biotin.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Gel Shift Assay—This assay was used to determine the binding of Dna2 and/or FEN1 to various labeled substrates. Reactions were performed in 50 mm Tris-HCl, pH 8.0, 30 mm NaCl, 2 mm DTT, 0.1 mg/ml bovine serum albumin, 5% glycerol, 10 μm ATP, and either 2 mm MgCl2, with Dna2 E675A, or 4 mm CaCl2, with wild type Dna2. The reaction mixture volume was 20 μl, which included 5 fmol of labeled substrate and various amounts of enzymes, as indicated in the figure legends. In Figs. 1A and 5A, various amounts of Dna2 were pre-bound, as described above. In Fig. 4, Dna2 was pre-bound, and then FEN1 was added to the reaction mix at various concentrations and incubated for 5 min at 37 °C. The 5′ terminus of the substrate was then blocked by the addition of 250 fmol of streptavidin, which was conjugated to the 5′-biotin on the flap. In Fig. 6, streptavidin (250 fmol) was incubated with substrate for 10 min at 37 °C. Dna2 was then added, and reactions were incubated again at 37 °C for 10 min. Reactions were then run on a pre-run 5% (Bio-Rad) or 6% (Invitrogen) Tris borate-EDTA gel at 200 V for 20-40 min.FIGURE 4FEN1 removes Dna2 from the flap substrate. Dna2 (200 fmol) was pre-bound to 5 fmol of labeled substrate; 10 (lane 7), 25 (lane 8), and 50 fmol (lane 9) of FEN1 was then added followed by the addition of streptavidin as described under “Experimental Procedures.” Lanes 3-5 indicate binding of FEN1 alone at the same concentrations as in lanes 7-9, respectively. Lane 6 is a control of pre-bound Dna2 (200 fmol) without FEN1 addition. Lane 1 is the substrate alone, and lane 2 the substrate plus streptavidin. The substrate is depicted above the gel, the asterisk indicates the site of the 3′ 32P radiolabel, and B indicates the 5′-biotin. WT, wild type.View Large Image Figure ViewerDownload Hi-res image Download (PPT)FIGURE 6Dna2 binds to blocked flap substrates. 5 fmol of the 53-nucleotide substrate was incubated with 250 fmol of streptavidin for 10 min at 37 °C. Dna2 was then added to the reaction at 100 fmol (lane 2) and 200 fmol (lane 3), followed by incubated at 37 °C for 10 min. Reactions were then run by gel shift, as described under “Experimental Procedures,” to assess Dna2 binding. Lane 1 is the substrate plus streptavidin control. The substrate is depicted above the gel, the asterisk indicates the site of the 3′ 32P radiolabel, and B indicates the 5′-biotin.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Gel Analysis—All experiments were done at least in duplicate, and representative gels are shown. All gels, after running conditions, were transferred to filter paper and dried on a gel dryer (Bio-Rad) with vacuum (Savant) for 1 h at 80°C. They were then exposed to a Phosphor screen and imaged using a PhosphorImager (GE Healthcare). Gel analysis was then performed using ImageQuantMac, version 1.2 (GE Healthcare).RESULTSDna2 is expected to precede FEN1 in tracking on a flap during OFP. Even after cleavage by Dna2 its helicase activity would be expected to drive it onto the flap so that it would block the entry of FEN1. It is known that FEN1 can access the flap after Dna2 cleavage. We hypothesized that the two proteins are designed to allow efficient, successive action. To understand how Dna2 works with FEN1, we assessed FEN1 binding and cleavage to a flap already occupied by a Dna2 molecule.Dna2 E675A Binds Flaps but Does Not Inhibit FEN1—Dna2 E675A was characterized previously and shown to be defective in nuclease activity while retaining helicase activity (18Budd M.E. Choe W. Campbell J.L. J. Biol. Chem. 2000; 275: 16518-16529Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar). We confirmed both a defect in cleavage activity and retention of helicase activity of Dna2 E675A on a flap substrate (data not shown). It was previously shown that Dna2 binds to flap substrates by gel shift assay (28Bae S.H. Bae K.H. Kim J.A. Seo Y.S. Nature. 2001; 412: 456-461Crossref PubMed Scopus (281) Google Scholar). We tested whether Dna2 E675A could bind to a flap substrate and block FEN1 cleavage. Because we have previously shown that FEN1 requires a free 5′ end for tracking to the base of the flap and cleavage (13Murante R.S. Rust L. Bambara R.A. J. Biol. Chem. 1995; 270: 30377-30383Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar), we hypothesized that Dna2 E675A binding would inhibit FEN1 cleavage at the base of the flap. The approach was to load Dna2 so that it tracks or binds to the base of the flap but does not cleave. We used an ATP concentration that allows the Dna2 to bind onto the flap but does not make the helicase function so potently that it displaces the flap and dissociates the primer from the template (data not shown). Fig. 1A shows native PAGE separation of the 53-nucleotide flap substrate with Dna2 E675A present. Upon addition of purified Dna2 E675A (Fig. 1A, lanes 2 and 3), we saw a gel shift from the position of the DNA only band (Fig. 1A, lane 1) to a higher molecular weight band signifying binding. The fraction of shifted DNA was dependent on Dna2 E675A concentration. At 200 fmol of Dna2 E675A (Fig. 1A, lane 3), at least 80% of the DNA was bound with protein, as some portion of the protein may have been dissociated during electrophoresis.Dna2 E675A was then pre-bound, under the same conditions shown in Fig. 1A, lane 3, to the 53-nucleotide flap substrate. This should have prevented FEN1 access to at least 80% of the substrate molecules. FEN1 was added to the reaction mixture at the end of the pre-binding period. When FEN1 was incubated with the substrate in the absence of Dna2 E675A (Fig. 1B, circles), an increasing amount of flaps were cleaved over time. Upon addition of FEN1 to pre-bound substrate (Fig. 1B, squares), the flaps were also cleaved efficiently. Surprisingly, the presence of the Dna2 E675A made only a slight difference in the amount of cleavage, indicating that the FEN1 had access to its cleavage site on nearly all of the substrates. Inhibition of FEN1 cleavage by Dna2 E675A was compared with that of a 5′ streptavidin-biotin-blocked flap (Fig. 1B, diamonds). The almost complete elimination of cleavage activity verifies that prevention of FEN1 entry to the flap is an effective deterrent to cleavage.The early time points can be used to compare relative rates of cleavage (Fig. 1B, 0.5 and 1 min). Blockage of the flaps by Dna2 E675A resulted in a less than 2-fold decrease in cleavage rate (compare Fig. 1B, squares and circles), strikingly less inhibitory than the effect of streptavidin (Fig. 1B, diamonds). The difference in rate was reduced to only 4% by 10 min, simply because cleavage goes to near completion even in the presence of Dna2 E675A. Moreover, cleavage products made by FEN1, as seen on the gel, appeared identical on both unblocked and Dna2 E475A-blocked substrates (data not shown). This demonstrates that FEN1 reached the base of the flap for cleavage at its preferred site in both cases. Titrations of Dna2 E675A up to 200 fmol were performed in the pre-binding reaction and showed no significant effect on the amount of FEN1 cleavage (data not shown). Overall, these results show that FEN1 can bypass Dna2 bound on a flap, thus gaining access to the flap base for cleavage.Dna2 E675A Should Block FEN1 Access to the Flap—Because Dna2 appears to thread onto the flap, it is difficult to visualize how FEN1 could cleave around a bound Dna2 molecule. We determined whether FEN1 would have access to the flap during brief absences of Dna2, as might occur if Dna2 proteins occasionally slide off the 5′ end of the flap. Dna2 E675A was bound to the 53-nucleotide labeled DNA flap substrate, and micrococcal nuclease was then added (Fig. 2). Micrococcal nuclease is an endonuclease, which, unlike Dna2 or FEN1, has no loading requirement and can readily cleave exposed DNA. In addition, it prefers ssDNA over double-stranded DNA. In Fig. 2, Dna2 E675A was bound prior to micrococcal nuclease addition. This allowed us to evaluate the percent of substrates that were inaccessible to micrococcal nuclease and thus protected by bound Dna2 E675A. Fig. 2, lane 2, shows the amount of micrococcal nuclease cleavage without Dna2 E675A present. In contrast, when Dna2 E675A was bound to the substrate prior to micrococcal nuclease addition, there was a decrease in the amount of products formed after a 10-min incubation with micrococcal nuclease (Fig. 2, lanes 3-5). Upon quantitation of the protected area (indicated in Fig. 2), we" @default.
• W2113176230 created "2016-06-24" @default.
• W2113176230 creator A5000378293 @default.
• W2113176230 creator A5005315226 @default.
• W2113176230 creator A5044595207 @default.
• W2113176230 date "2006-12-01" @default.
• W2113176230 modified "2023-09-26" @default.
• W2113176230 title "Flap Endonuclease Disengages Dna2 Helicase/Nuclease from Okazaki Fragment Flaps" @default.
• W2113176230 cites W1575110117 @default.
• W2113176230 cites W1729887059 @default.
• W2113176230 cites W1752089945 @default.
• W2113176230 cites W1774053018 @default.
• W2113176230 cites W1966219094 @default.
• W2113176230 cites W1966666560 @default.
• W2113176230 cites W1972746487 @default.
• W2113176230 cites W1986113777 @default.
• W2113176230 cites W1994232734 @default.
• W2113176230 cites W1997002747 @default.
• W2113176230 cites W2003329456 @default.
• W2113176230 cites W2010302368 @default.
• W2113176230 cites W2010544809 @default.
• W2113176230 cites W2010634289 @default.
• W2113176230 cites W2016218438 @default.
• W2113176230 cites W2024939635 @default.
• W2113176230 cites W2034535098 @default.
• W2113176230 cites W2037987328 @default.
• W2113176230 cites W2052893592 @default.
• W2113176230 cites W2055566423 @default.
• W2113176230 cites W2055652654 @default.
• W2113176230 cites W2061754995 @default.
• W2113176230 cites W2062043277 @default.
• W2113176230 cites W2064264662 @default.
• W2113176230 cites W2067745501 @default.
• W2113176230 cites W2100626549 @default.
• W2113176230 cites W2107856790 @default.
• W2113176230 cites W2110161513 @default.
• W2113176230 cites W2111313204 @default.
• W2113176230 cites W2114600109 @default.
• W2113176230 cites W2131856778 @default.
• W2113176230 cites W2135015314 @default.
• W2113176230 cites W2144835937 @default.
• W2113176230 cites W2146851796 @default.
• W2113176230 cites W2159127144 @default.
• W2113176230 cites W2160735284 @default.
• W2113176230 cites W2161248815 @default.
• W2113176230 cites W2163221081 @default.
• W2113176230 cites W2165336005 @default.
• W2113176230 cites W2167124397 @default.
• W2113176230 doi "https://doi.org/10.1074/jbc.m606884200" @default.
• W2113176230 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17038322" @default.
• W2113176230 hasPublicationYear "2006" @default.
• W2113176230 type Work @default.
• W2113176230 sameAs 2113176230 @default.
• W2113176230 citedByCount "29" @default.
• W2113176230 countsByYear W21131762302012 @default.
• W2113176230 countsByYear W21131762302015 @default.
• W2113176230 countsByYear W21131762302016 @default.
• W2113176230 countsByYear W21131762302018 @default.
• W2113176230 countsByYear W21131762302019 @default.
• W2113176230 countsByYear W21131762302021 @default.
• W2113176230 countsByYear W21131762302022 @default.
• W2113176230 crossrefType "journal-article" @default.
• W2113176230 hasAuthorship W2113176230A5000378293 @default.
• W2113176230 hasAuthorship W2113176230A5005315226 @default.
• W2113176230 hasAuthorship W2113176230A5044595207 @default.
• W2113176230 hasBestOaLocation W21131762301 @default.
• W2113176230 hasConcept C104317684 @default.
• W2113176230 hasConcept C11305352 @default.
• W2113176230 hasConcept C134935766 @default.
• W2113176230 hasConcept C153911025 @default.
• W2113176230 hasConcept C161223559 @default.
• W2113176230 hasConcept C185592680 @default.
• W2113176230 hasConcept C2777028655 @default.
• W2113176230 hasConcept C2777271071 @default.
• W2113176230 hasConcept C54355233 @default.
• W2113176230 hasConcept C552990157 @default.
• W2113176230 hasConcept C67705224 @default.
• W2113176230 hasConcept C86803240 @default.
• W2113176230 hasConcept C95444343 @default.
• W2113176230 hasConcept C98086919 @default.
• W2113176230 hasConceptScore W2113176230C104317684 @default.
• W2113176230 hasConceptScore W2113176230C11305352 @default.
• W2113176230 hasConceptScore W2113176230C134935766 @default.
• W2113176230 hasConceptScore W2113176230C153911025 @default.
• W2113176230 hasConceptScore W2113176230C161223559 @default.
• W2113176230 hasConceptScore W2113176230C185592680 @default.
• W2113176230 hasConceptScore W2113176230C2777028655 @default.
• W2113176230 hasConceptScore W2113176230C2777271071 @default.
• W2113176230 hasConceptScore W2113176230C54355233 @default.
• W2113176230 hasConceptScore W2113176230C552990157 @default.
• W2113176230 hasConceptScore W2113176230C67705224 @default.
• W2113176230 hasConceptScore W2113176230C86803240 @default.
• W2113176230 hasConceptScore W2113176230C95444343 @default.
• W2113176230 hasConceptScore W2113176230C98086919 @default.
• W2113176230 hasIssue "50" @default.
• W2113176230 hasLocation W21131762301 @default.
• W2113176230 hasLocation W21131762302 @default.
• W2113176230 hasOpenAccess W2113176230 @default.

• next