FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2114299563> ?p ?o ?g. }

• W2114299563 endingPage "15526" @default.
• W2114299563 startingPage "15519" @default.
• W2114299563 abstract "Expression of human estrogen receptor-α (ERα) involves the activity from several promoters that give rise to alternate untranslated 5′ exons. However, the genomic locations of the alternate 5′ exons have not been reported previously. We have developed a contig map of the human ERα gene that includes all of the known alternate 5′ exons. By using S1 nuclease and 5′- rapid amplification of cDNA ends, the cap sites for the alternate ERα transcripts E and H were identified. DNase I-hypersensitive sites specific to ERα-positive cells were associated with each of the cap sites. A DNase I-hypersensitive site, HS1, was localized to binding sites for AP2 in the untranslated region of exon 1 and was invariably present in the chromatin structure of ERα-positive cells. Overexpression of AP2γ in human mammary epithelial cells generated the HS1-hypersensitive site. The ERα promoter was induced by AP2γ in mammary epithelial cells, and trans-activation was dependent upon the region of the promoter containing the HS1 site. These results demonstrate that AP2γ trans-activates the ERα gene in hormone-responsive tumors by inducing changes in the chromatin structure of the ERα promoter. These data are further evidence for a critical role for AP2 in the oncogenesis of hormone-responsive breast cancers. Expression of human estrogen receptor-α (ERα) involves the activity from several promoters that give rise to alternate untranslated 5′ exons. However, the genomic locations of the alternate 5′ exons have not been reported previously. We have developed a contig map of the human ERα gene that includes all of the known alternate 5′ exons. By using S1 nuclease and 5′- rapid amplification of cDNA ends, the cap sites for the alternate ERα transcripts E and H were identified. DNase I-hypersensitive sites specific to ERα-positive cells were associated with each of the cap sites. A DNase I-hypersensitive site, HS1, was localized to binding sites for AP2 in the untranslated region of exon 1 and was invariably present in the chromatin structure of ERα-positive cells. Overexpression of AP2γ in human mammary epithelial cells generated the HS1-hypersensitive site. The ERα promoter was induced by AP2γ in mammary epithelial cells, and trans-activation was dependent upon the region of the promoter containing the HS1 site. These results demonstrate that AP2γ trans-activates the ERα gene in hormone-responsive tumors by inducing changes in the chromatin structure of the ERα promoter. These data are further evidence for a critical role for AP2 in the oncogenesis of hormone-responsive breast cancers. estrogen receptor α kilobase pair kilobase rapid amplification of cDNA ends human mammary epithelial cells minimal essential media fetal calf serum polymerase chain reaction phosphate-buffered saline glutathioneS-transferase cytomegalovirus multiplicity of infection base pair green fluorescent protein There are at least two nuclear receptors for estrogen receptor, ERα1 (1Green S. Walter P. Kumar V. Krust A. Bornert J.M. Argos P. Chambon P. Nature. 1986; 320: 134-139Crossref PubMed Scopus (1938) Google Scholar, 2Greene G.L. Gilna P. Waterfield M. Baker A. Hort Y. Shine J. Science. 1986; 231: 1150-1154Crossref PubMed Scopus (1047) Google Scholar) and ERβ (3Mosselman S. Polman J. Dijkema R. FEBS Lett. 1996; 392: 49-53Crossref PubMed Scopus (2032) Google Scholar). Most breast cancers that occur in post-menopausal women overexpress ERα (4Jordan V.C. Wolf M.F. Mirecki D.M. Whitford DA Weshons W.V. CRC Crit. Rev. Clin. Lab. Sci. 1988; 26: 97-152Crossref Scopus (54) Google Scholar). Patients with breast cancers that express ERα are more likely to respond to hormonal therapy (4Jordan V.C. Wolf M.F. Mirecki D.M. Whitford DA Weshons W.V. CRC Crit. Rev. Clin. Lab. Sci. 1988; 26: 97-152Crossref Scopus (54) Google Scholar, 5Bradbeer J.W. Kyngdon J. Clin. Oncol. 1983; 9: 31-34PubMed Google Scholar) and have an improved prognosis compared with patients with ERα-negative tumors (4Jordan V.C. Wolf M.F. Mirecki D.M. Whitford DA Weshons W.V. CRC Crit. Rev. Clin. Lab. Sci. 1988; 26: 97-152Crossref Scopus (54) Google Scholar, 6Knight W.A.I., II Livingston R.B. Gregory E.J. McGuire W.L. Cancer Res. 1977; 37: 4669-4671PubMed Google Scholar, 7Sigurdsson H. Baldetorp B. Borg A. Dalberg M. Ferno M. Killander D. Olsson H. N. Engl. J. Med. 1990; 322: 1045-1053Crossref PubMed Scopus (313) Google Scholar). Studies of breast cancer cell lines (8Weigel R.J. deConinck E.C. Cancer Res. 1993; 53: 3472-3474PubMed Google Scholar) and primary tumors (9Barrett-Lee P.J. Travers M.T. McClelland R.A. Luqmani Y. Coombes R.C. Cancer Res. 1987; 47: 6653-6659PubMed Google Scholar, 10Carmeci C. deConinck E.C. Lawton T. Bloch D.A. Weigel R.J. Am. J. Pathol. 1997; 150: 1563-1570PubMed Google Scholar) have indicated that transcription of the ERα gene plays an important role in regulating the expression of ERα. Thus, understanding transcriptional regulation of the ERα gene will likely provide critical insights into the pathogenesis of hormone-responsive breast cancers. Transcription of the ERα gene is complex and involves activity of several distinct promoters (11Keaveney M. Klug J. Dawson M.T. Nestor P.V. Neilan J.G. Forde R.C. Gannon F. J. Mol. Endocrinol. 1991; 6: 111-115Crossref PubMed Scopus (98) Google Scholar, 12Piva R. Bianchi G. Aguilari L. Gambari R. Del Senno L. J. Steroid Biochem. Mol. Biol. 1993; 46: 531-538Crossref PubMed Scopus (55) Google Scholar, 13Grandien K. Mol. Cell. Endocrinol. 1996; 116: 207-212Crossref PubMed Scopus (93) Google Scholar, 14Thompson D.A. McPherson L.A. Carmeci C. deConinck E.C. Weigel R.J. J. Steroid Biochem. Mol. Biol. 1997; 62: 143-153Crossref PubMed Scopus (42) Google Scholar). Functional promoter studies have concluded that ERα expression in breast cancer cell lines and various tissues is likely to involve trans-acting factors that have a specific cell or tissue distribution pattern (15DeConinck E.C. McPherson L.A. Weigel R.J. Mol. Cell. Biol. 1995; 15: 2191-2196Crossref PubMed Scopus (92) Google Scholar, 16Tang Z. Treilleux I. Brown M. Mol. Cell. Biol. 1997; 17: 1274-1280Crossref PubMed Scopus (60) Google Scholar, 17Tanimoto K. Eguchi H. Yoshida T. Hajiro-Nakanishi K. Hayashi S. Nucleic Acids Res. 1999; 27: 903-909Crossref PubMed Scopus (41) Google Scholar, 18Weigel R.J. Crooks D.L. Iglehart J.D. deConinck E.C. Cell Growth Differ. 1995; 6: 707-711PubMed Google Scholar, 19Grandien K. Backdahl M. Ljunggren O. Gustafsson J. Berkenstam A. Endocrinology. 1995; 136: 2223-2229Crossref PubMed Google Scholar). There appear to be a variety of factors that interact with the ERα promoter with trans-activating (15DeConinck E.C. McPherson L.A. Weigel R.J. Mol. Cell. Biol. 1995; 15: 2191-2196Crossref PubMed Scopus (92) Google Scholar, 16Tang Z. Treilleux I. Brown M. Mol. Cell. Biol. 1997; 17: 1274-1280Crossref PubMed Scopus (60) Google Scholar, 17Tanimoto K. Eguchi H. Yoshida T. Hajiro-Nakanishi K. Hayashi S. Nucleic Acids Res. 1999; 27: 903-909Crossref PubMed Scopus (41) Google Scholar) or trans-repressing (20Penolazzi L. Lambertini E. Aguiari G. del Senno L. Piva R. Biochim. Biophys. Acta. 2000; 1492: 560-567Crossref PubMed Scopus (28) Google Scholar) functions. There is also evidence that ERα can autoregulate its own transcription (21Castles C.G. Oesterreich S. Hansen R. Fuqua S.A. J. Steroid Biochem. Mol. Biol. 1997; 62: 155-163Crossref PubMed Scopus (65) Google Scholar,22Treilleux I. Peloux N. Brown M. Sergeant A. Mol. Endocrinol. 1997; 11: 1319-1331Crossref PubMed Scopus (41) Google Scholar). Other studies suggest that the lack of ERα expression in ERα-negative breast cancer cell lines and tumors may be controlled by methylation of CpG islands in the 5′ end of the ERα gene (23Ottaviano Y. Issa J. Parl F. Smith H. Baylin S. Davidson N. Cancer Res. 1994; 54: 2552-2555PubMed Google Scholar,24Lapdius R.G. Ferguson A.T. Ottaviano Y.L. Parl F.F. Smith H. Weitzman S. Baylin S. Issa J. Davidson N. Clin. Cancer Res. 1996; 2: 805-810PubMed Google Scholar). The main ERα promoter, P1, initiates transcription at a cap site previously mapped at the start of exon 1 (1Green S. Walter P. Kumar V. Krust A. Bornert J.M. Argos P. Chambon P. Nature. 1986; 320: 134-139Crossref PubMed Scopus (1938) Google Scholar). Exon 1 has a 233-base 5′-untranslated region preceding the AUG codon that initiates translation of the ERα protein. Studies in ERα-positive breast cancer cell lines have shown that transcription initiated at exon 1 accounts for 50–90% of all ERα mRNAs (18Weigel R.J. Crooks D.L. Iglehart J.D. deConinck E.C. Cell Growth Differ. 1995; 6: 707-711PubMed Google Scholar, 25Flouriot G. Griffin C. Kenealy M. Sonntag-Buck V. Gannon F. Mol. Endocrinol. 1998; 12: 1939-1954Crossref PubMed Google Scholar). A functional analysis of the main ERα promoter identified a factor, ERF-1, that binds to high affinity sites in the untranslated region of exon 1 and can trans-activate the cloned ERα promoter (15DeConinck E.C. McPherson L.A. Weigel R.J. Mol. Cell. Biol. 1995; 15: 2191-2196Crossref PubMed Scopus (92) Google Scholar, 26McPherson L.A. Weigel R.J. Nucleic Acids Res. 1999; 27: 4040-4049Crossref PubMed Scopus (95) Google Scholar). ERF-1 was found to be a member of the AP2 family of transcription factors and has been renamed AP2γ (27McPherson L.A. Baichwal V.R. Weigel R.J. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 4342-4347Crossref PubMed Scopus (129) Google Scholar). All other ERα transcripts initiate at cap sites upstream of exon 1 and splice into a splice acceptor site at +163 in exon 1 (14Thompson D.A. McPherson L.A. Carmeci C. deConinck E.C. Weigel R.J. J. Steroid Biochem. Mol. Biol. 1997; 62: 143-153Crossref PubMed Scopus (42) Google Scholar). Although some of these upstream exons have open reading frames, there is no evidence that these are translated, and it appears that all alternate 5′ exons are non-coding. Exon 1′ has been reported to have two main cap sites giving rise to alternate 5′ exons of 110 bases or 1206 bases (12Piva R. Bianchi G. Aguilari L. Gambari R. Del Senno L. J. Steroid Biochem. Mol. Biol. 1993; 46: 531-538Crossref PubMed Scopus (55) Google Scholar). The short and long forms of exon 1′ both utilize the splice donor site at −1884 (location relative to cap site of P1). We had previously described two additional alternate ERα transcripts called E and H (14Thompson D.A. McPherson L.A. Carmeci C. deConinck E.C. Weigel R.J. J. Steroid Biochem. Mol. Biol. 1997; 62: 143-153Crossref PubMed Scopus (42) Google Scholar). Both the E and H transcripts are expressed in ERα-positive breast cancer cell lines, primary breast cancers, ERα-positive endometrial carcinoma cell lines, and normal endometrium. The existence of the E and H transcripts of ERα were subsequently confirmed by other investigators, and these exons were reported to be expressed in a variety of tissues (25Flouriot G. Griffin C. Kenealy M. Sonntag-Buck V. Gannon F. Mol. Endocrinol. 1998; 12: 1939-1954Crossref PubMed Google Scholar). The splice donor site of exon E was found to be at −169. The H transcript was found to utilize two upstream exons, Ha and Hb, separated by an intron of 9 kbp (14Thompson D.A. McPherson L.A. Carmeci C. deConinck E.C. Weigel R.J. J. Steroid Biochem. Mol. Biol. 1997; 62: 143-153Crossref PubMed Scopus (42) Google Scholar). The genomic location of the H exons was not determined but was concluded to be at least 20 kbp 5′ to exon 1 (14Thompson D.A. McPherson L.A. Carmeci C. deConinck E.C. Weigel R.J. J. Steroid Biochem. Mol. Biol. 1997; 62: 143-153Crossref PubMed Scopus (42) Google Scholar). An additional liver-specific exon, called exon C, has also been described (13Grandien K. Mol. Cell. Endocrinol. 1996; 116: 207-212Crossref PubMed Scopus (93) Google Scholar). Exon C was reported to be spliced to an exon with sequence matching exon Hb, and it was concluded that exon C is farther 5′ than exon Ha (14Thompson D.A. McPherson L.A. Carmeci C. deConinck E.C. Weigel R.J. J. Steroid Biochem. Mol. Biol. 1997; 62: 143-153Crossref PubMed Scopus (42) Google Scholar). In order to define the location of the ERα promoters active in breast cancer, a detailed analysis of the genomic structure of the 5′ end of the ERα gene including the alternate ERα transcripts E and H was performed. Overlapping BAC clones have been isolated that generated a contig map that includes all known ERα exons. The exon Ha was found to be 124 kbp upstream of exon 1, and exon C was located 30–40 kbp 5′ to exon Ha. Together with the previously known exons of the ERα gene that span a region of over 160 kb, the ERα locus was found to encompass a genomic region of ∼300 kbp. By using S1 nuclease and 5′-RACE, the cap sites for exons E and H have been mapped. Each of the alternate upstream exons was found to be associated with DNase I-hypersensitive sites specific to cells expressing ERα. The DNase I-hypersensitive site, HS1, was mapped to the binding sites for AP2γ in the untranslated leader of exon 1 and was invariably found in the chromatin structure of ERα-positive cells. In human mammary epithelial cells (HMECs), AP2γ expression induced the HS1-hypersensitive site and trans-activated the ERα promoter, which was dependent upon the region of the promoter containing the HS1 site. These findings provide additional evidence for a critical role for AP2γ in the oncogenesis of hormone-responsive breast cancer. All cell lines were obtained from American Type Culture Collection, Manassas, VA. Cells were maintained in minimal essential media (MEM, Life Technologies, Inc.) supplemented with 10% fetal bovine sera (FCS, Gemini BioProducts, Calabasas, CA), 25 mm HEPES, 26 mm sodium bicarbonate, 5000 units/ml penicillin G (Life Technologies, Inc.), 5000 μg/ml streptomycin (Life Technologies, Inc.), and 6 ng/ml bovine insulin (Sigma). HMECs were obtained from reduction mammoplasty and were a gift from Dr. J. Dirk Iglehart, Boston. HMECs were maintained in DFCI-1 media (28Band V. Zajchowski D. Kulesa V. Sager R. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 463-467Crossref PubMed Scopus (267) Google Scholar). All cells were incubated at 37 °C in 5% CO2. BAC clones containing genomic DNA from the 5′ region of the human ERα gene were identified by hybridization of DNA arrays with probes corresponding to the human ERα exons 1′, Ha and Hb. Nylon membranes arrayed with DNA from a human BAC library were purchased from Research Genetics (Huntsville, AL). Gel-purified insert DNA from clones of ERα exons Ha (pHa2.5) and Hb (pHb4.1) were used for hybridization. Exon 1′ sequences between −3090 and −2670 were PCR-amplified from MCF-7 genomic DNA using primers ERSEQ1 (TCTAGAGCATGGGTGGCCAT) and ERSEQ2 (GTGCTCCTAGAGTGCCCACG) and TAQ polymerase. The cycle profile included an initial denaturation step of 94 °C for 2 min followed by 25 cycles of 94 °C for 30 s, 56 °C for 15 s, and 72 °C for 2 min and terminated with a final extension step of 72 °C for 5 min. All DNAs used for hybridization were gel-purified and labeled by random priming with [α-32P]dCTP to specific activities greater than 7 × 108 dpm/μg. Library membranes were prehybridized in 50% formamide, 5× SSC, 7% SDS, 1% polyethylene glycol, 25 mm sodium phosphate buffer, pH 6.7, and 0.5% non-fat dried milk at 42 °C for 1 h. Twenty ml of hybridization solution per membrane were used. For hybridization, the volume of hybridization solution was reduced to 6 ml per membrane, and each probe was added to 5 × 105dpm/ml and hybridized for 12–18 h at 42 °C. Following hybridization the membranes were washed twice in 2× SSC, 1% SDS at 42 °C and then twice in 0.1× SSC, 0.1% SDS at 65 °C. Positive signals were identified by overnight exposure to film. Cultures of Escherichia coli harboring the BACs identified in the initial screen were obtained from Research Genetics. A small amount of DNA was obtained from each culture using the vendor's protocols for secondary screening by PCR. DNA from 19 BACs were PCR-amplified with primers oEXON0INT and oEXON0–3′ (14Thompson D.A. McPherson L.A. Carmeci C. deConinck E.C. Weigel R.J. J. Steroid Biochem. Mol. Biol. 1997; 62: 143-153Crossref PubMed Scopus (42) Google Scholar) for the presence of ERα exon Hb sequences and with primers ERSEQ1 and ERSEQ2 for the presence of ERα exon 1′ sequences as described above. DNA from BACs containing portions of the ERα upstream region was prepared from 1-liter cultures using a Maxiprep kit from Qiagen (Valencia, CA) as described by the manufacturer. For restriction enzyme digest analysis, 1–2 μg of BAC DNA was digested in 20 μl with the appropriate enzyme and then subjected to pulse field gel electrophoresis in 0.5× TBE at 140 V with field switches increasing from 1 to 12 s over 20 h. Bands were visualized by ethidium bromide staining and photographed. Band sizes were calculated from standard curves constructed from molecular weight markers. For Southern blot analysis, DNAs were transferred to positively charged nylon membranes (Hybond N+, Amersham Pharmacia Biotech) using protocols provided by the manufacturer. The blots were hybridized with various probes to identify the locations of the ERα exons relative to the restriction sites mapped in each BAC. Probes used were the ERα exon 1′, Ha and Hb probes described above. In addition, oligonucleotides corresponding to ERα exon C (TTCACAATCAAAAGGATTGG) (13Grandien K. Mol. Cell. Endocrinol. 1996; 116: 207-212Crossref PubMed Scopus (93) Google Scholar) and to the ends of the BAC genomic DNA inserts were used. The sequences of the ends of the BACs were determined by direct sequencing of BAC DNA. S1 nuclease analyses were performed essentially as described (18Weigel R.J. Crooks D.L. Iglehart J.D. deConinck E.C. Cell Growth Differ. 1995; 6: 707-711PubMed Google Scholar) with modifications of the protocols for probe synthesis. Messenger RNA was isolated from MCF-7 cells using a Fast Track mRNA isolation System (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. The probe for analysis of the ERα transcripts originating at the exon Ha promoter was synthesized by single-sided PCR from a template that encompassed exon Ha plus ∼850 bases of upstream sequences. The template was PCR-amplified from MCF-7 genomic DNA using the primer H199.4 (GAGAAGATTATCACTCAGAGAC) as the 3′ primer and H853.3 (CGCCCCATTCTACCATTTTC) as the 5′ primer. PCR conditions were as described above except that the annealing temperature was 50 °C. To synthesize a single-stranded probe complementary to the expected mRNA sequence, PCR was performed using only H199.4 in the presence of [α-32P]dCTP. After PCR the probe DNA was desalted on a spin column to remove unincorporated label. The single-stranded probe for analysis of the ERα transcripts originating from the promoter associated with exon E was synthesized by primer extension using Klenow enzyme. The primer used was ERPRO30 (GTGCAGACCGTGTCCCCGCA) and was annealed to the denatured ER724–210LUC plasmid (15DeConinck E.C. McPherson L.A. Weigel R.J. Mol. Cell. Biol. 1995; 15: 2191-2196Crossref PubMed Scopus (92) Google Scholar) as a template. The 3′ end of the probe was defined by cleavage with PvuII, and the single-stranded probe was isolated from the template by electrophoresis through a 1.5% alkaline agarose gel. The purified probe was eluted from the gel using a Millipore Ultrafree DA spin cartridge (Millipore Corp., New Bedford, MA). Either the Ha or E probe (5 × 105 cpm) was hybridized to 2 μg of MCF-7 mRNA or yeast tRNA overnight at 45 °C. Nuclease S1 (500–2000 units/ml; Amersham Pharmacia Biotech) was added, and the samples were incubated at 37 °C for 1 h. The reactions were stopped, and the samples were extracted once with phenol/chloroform (1:1) before analysis on a 6% acrylamide sequencing gel. Signals were detected by overnight autoradiography. Messenger RNA from MCF-7 cells was analyzed by 5′-RACE using the 5′-RACE System from Life Technologies, Inc., as recommended by the manufacturer. Initial reverse transcription was primed with ERPRO22 (CCCTTGGATCTGATGCAGTA), which is located in exon 1 at approximately +300. The gene-specific primer for the first round of PCR was ERPRO30, which anneals to sequences in exon 1 upstream of ERPRO22. A second round of PCR amplification was performed using the gene-specific primers ERPRO94 (GCTGGATAGAGGCTGAGTTT) and H199.4 for exons E and Ha, respectively. RACE PCR products were cloned into pCR2.1 using a TA Cloning Kit (Invitrogen) as recommended. The location of the 5′ end of each clone was determined by sequencing. DNase I-hypersensitivity was analyzed in a variety of ERα-positive and ERα-negative cell lines. Cells were harvested during exponential growth, and then washed once with cold phosphate-buffered saline (PBS). The cells were then washed once with cold buffer A (15 mm Tris, pH 7.4, 60 mm KCl, 15 mm NaCl, 0.2 mm EGTA, 0.2 mm EDTA, 0.25 m sucrose, 1 mmdithiothreitol, 0.15 mm spermine, 0.5 mmspermidine) and then resuspended in 5 ml of cold buffer A with 0.2% Nonidet P-40. The cells were lysed in a Dounce homogenizer using 10 strokes of a B pestle on ice; lysis was checked by trypan blue exclusion. Nuclei were pelleted and resuspended in 2.5 ml of buffer B (buffer A minus sucrose). To 0.5-ml aliquots of nuclei varying quantities of DNase I (0, 200, 400, 600, 800, 1200, 1600 units/ml; Roche Molecular Biochemicals) were added, and then MgCl2was added to 5 mm, and the samples were incubated on ice for 15 min. The reactions were stopped by addition of EDTA to 50 mm. Following addition of SDS to 0.5% and proteinase K to 1 mg/ml, the samples were incubated overnight at 37 °C. Residual protein was removed by extraction once each with phenol, phenol/chloroform (1:1), and chloroform. Following ethanol precipitation the nucleic acid pellets were dissolved in 10 mm Tris, pH 8.0, 0.5 mm EDTA, and the absorbance at A260 was measured. Ten micrograms of each sample were cleaved with the appropriate restriction enzyme overnight at 37 °C. For analysis of hypersensitive sites near exon 1, the samples were then electrophoresed through 1% agarose (SeaKem GTG, BioWhittaker Molecular Applications, Rockland, ME) using 0.5× Tris/acetate/EDTA buffer and transferred to nylon membranes for hybridization as described above. The resulting blots were hybridized with the exon 1′ probe. For analysis of hypersensitive sites near exons Ha/Hb, samples were subjected to pulse field gel electrophoresis following restriction enzyme cleavage. DNA was immobilized on nylon membranes and hybridized with the same exon Ha probe used to screen the BAC library. Antigen for the production of an AP2γ-specific polyclonal antibody (AP) was generated by cloning a fragment of AP2γ in frame with glutathione S-transferase (GST) to create a fusion protein. A fragment corresponding to nucleotides 474–607, which encodes amino acids 150–187, was generated by PCR and cloned in frame in the pGEX-4T3 vector (Amersham Pharmacia Biotech). The identity of the clone was confirmed by sequencing the entire insert from both directions. The clone was transformed into XL-1 Blue cells (Stratagene), and the production of a fusion protein of the proper size was confirmed by SDS-polyacrylamide gel electrophoresis. Large scale production of the fusion protein was induced with growth of the transformed cells in the presence of isopropyl-1-thio-β-d-galactopyranoside. Bacterial lysates were incubated with glutathione-agarose beads, washed with PBS, and the fusion protein eluted with the addition of 5 mmglutathione. The fusion protein was injected into rabbits, and antisera were generated by CalTag Laboratory (Healdsburg, CA). Following production of a polyclonal antisera, affinity purification was performed by passing antisera first over a GST affinity column to bind selectively antibodies directed to the GST portion of the fusion protein, and then over a GST-AP2γ affinity column with subsequent elution of the affinity-purified antibody. Affinity columns were prepared using Affi-Gel 10 supports (Bio-Rad). Gel shift assays were performed as described previously (15DeConinck E.C. McPherson L.A. Weigel R.J. Mol. Cell. Biol. 1995; 15: 2191-2196Crossref PubMed Scopus (92) Google Scholar). In supershift assays, 2 μl of AP antisera was used. The rabbit polyclonal antibody to AP2, SC-184, was obtained from Santa Cruz Biotechnology, Santa Cruz, CA. In order to generate AP2γ and AP2α adenoviral constructs, the AP2γ and AP2α cDNAs were first cloned into a shuttle vector. By using a previously described AP2γ clone retrieved from a MCF7 expression library (27McPherson L.A. Baichwal V.R. Weigel R.J. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 4342-4347Crossref PubMed Scopus (129) Google Scholar) as template, AP2γ cDNA was PCR-amplified from the translation start site at +167 to the stop codon at +1519 using a 5′ primer (GACGCAGATCTCCATGTTGTGGAAAATAAC) containing a BglII site and a 3′ primer (TCGTTCTCGAGTTATTTCCTGTGTTTCTCC) containing an XhoI site. AP2α cDNA was PCR-amplified from the translational start site to the stop codon using an AP2α cDNA clone (26McPherson L.A. Weigel R.J. Nucleic Acids Res. 1999; 27: 4040-4049Crossref PubMed Scopus (95) Google Scholar) as template. PCR was performed using a 5′ primer AP2α5′ SalI (CGATCCGTCGACATGCTTTGGAAATTGACG) containing a SalI site and a 3′ primer AP2α3′ XbaI (GGGAGGTCTAGATCACTTTCTGTGCTTCTC) containing an XbaI site. The AP2γ and AP2α cDNA fragments were ligated into the pAdTrack-CMV shuttle vector (gift of Dr. Burt Vogelstein, The Johns Hopkins University) (29He T.C. Zhou S., DA Costa L.T., Yu, J. Kinzler K.W. Vogelstein B. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 2509-2514Crossref PubMed Scopus (3221) Google Scholar) after digestion with appropriate restriction enzymes to create AP2γ/pAdTrack-CMV and AP2α/pAdTrack-CMV. pAdTrack-CMV also encodes the GFP protein so that viral production can be monitored by fluorescence. To generate AdAP2γ, AdAP2α, and AdWT adenoviral recombinants, 1 μg of AP2γ/pAdTrack-CMV, AP2α/pAdTrack-CMV, or pAdTrack-CMV plasmid DNA was linearized overnight at 37 °C withPmeI, extracted two times with phenol/chloroform and once with chloroform, and followed by ethanol precipitation. Cotransformation of linearized DNA and 100 ng of pAdEasy-1 adenoviral backbone vector (gift of Dr. Vogelstein) (29He T.C. Zhou S., DA Costa L.T., Yu, J. Kinzler K.W. Vogelstein B. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 2509-2514Crossref PubMed Scopus (3221) Google Scholar) into electrocompetentE. coli BJ5183 cells was performed in 2.0-mm cuvettes at 2.5 kV, 200 ohms, and 25 microfarads using a Bio-Rad Gene Pulser electroporator (Bio-Rad). Recombinants were selected for kanamycin resistance, and recombination was confirmed by restriction digestion with PacI, BamHI, BstXI, andNdeI. True recombinants were retransformed into electrocompetent E. coli DH10B (Life Technologies, Inc.) as described above, and DNA was purified using the Plasmid Maxi Kit (Qiagen) according to the manufacturer's protocol. AdAP2γ, AdAP2α, and AdWT adenoviruses were produced as described previously (29He T.C. Zhou S., DA Costa L.T., Yu, J. Kinzler K.W. Vogelstein B. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 2509-2514Crossref PubMed Scopus (3221) Google Scholar) with several modifications. Briefly, 2 × 106 293 cells were plated in 25-cm2 flasks 24 h before transfection in MEM with 10% FCS so that cells had reached 70–80% confluence by 24 h. On the day of transfection, 4 μg each of AdAP2γ, AdAP2α, and AdWT DNA were linearized byPacI digestion. Each linearized DNA was mixed with 20 μl of LipofectAMINE (Life Technologies, Inc.) in 500 μl of Opti-MEM (Life Technologies, Inc.) and incubated at room temperature for 15–30 min according to the manufacturer's protocol. Meanwhile, the cells were washed once with 3 ml of Opti-MEM. After incubation, the lipid/DNA mixes were brought up to 2 ml with Opti-MEM and overlaid onto the 293 cells. After incubation at 37 °C, 5% CO2 for 4 h, the transfection mix was removed, replaced with 6 ml of MEM + 10% FCS, and returned to the incubator. Cells were monitored by fluorescence microscopy for GFP expression over 7–9 days at which time most of the cells were fluorescent and had detached from the flask. Cells were collected, pelleted, resuspended in 2 ml of 1× PBS buffer, and subjected to 4 cycles of freeze/thaw/vortex (dry ice/37 °C). AdAP2γ, AdAP2α, and AdWT adenoviruses were then plaque-purified by infecting 5 × 105 293 cells in 35-mm plates with 100 μl of serial dilutions of viral supernatants from 10−1 to 10−4 made in Opti-MEM. After a 1-h incubation at 37 °C, 5% CO2, cells were overlaid with 3 ml of 0.8% agarose in MEM + 10% FCS and returned to the incubator. Plates were monitored for plaque formation and GFP expression over 9 days at which time plaques were isolated as agarose plugs into 200 μl of MEM + 10% FCS and subjected to 3 freeze/thaw (dry ice/37 °C) cycles. Fifty μl of viral lysate was used to infect 2 × 106 293 cells in a 25-cm2 flask, and the cells were harvested as described above at 3–4 days when the cells were at least 50% detached. Virus was then titered by GFP expression, and 3 more rounds of infection were performed at an m.o.i. of 0.1 to generate higher titer viral stocks. A final round of infection was performed at an m.o.i. of 5 using 5 × 108 293 cells in six 175-cm2 flasks. Cells were harvested at 60 h post-infection and after 4 cycles of freeze/thaw in 8 ml of 1× PBS, the virus was purified by CsCl banding using a density of 1.35 g/ml CsCl in a SW41Ti rotor at 32,000 rpm, 10 °C, 18–24 h. Virus was collected in ∼1 ml with an 18-gauge needle and dialyzed against 1 liter of Storage Buffer (5 mmTris, pH 8.0, 50 mm sodium chloride, 0.05% bovine serum albumin, and 25% glycerol) at 4 °C for 6 h. Viruses were titered by GFP expression in both 293 cells, and HMECs generally resulted in titers of 1011 plaque-forming units/ml in 293 cells and 108 plaque-forming units/ml in HMECs. In order to confir" @default.
• W2114299563 created "2016-06-24" @default.
• W2114299563 creator A5002992439 @default.
• W2114299563 creator A5035011139 @default.
• W2114299563 creator A5067011553 @default.
• W2114299563 creator A5071790052 @default.
• W2114299563 date "2001-01-01" @default.
• W2114299563 modified "2023-09-30" @default.
• W2114299563 title "Genomic Structure of the Promoters of the Human Estrogen Receptor-α Gene Demonstrate Changes in Chromatin Structure Induced by AP2γ" @default.
• W2114299563 cites W1981306061 @default.
• W2114299563 cites W1991588527 @default.
• W2114299563 cites W2009125857 @default.
• W2114299563 cites W2009816222 @default.
• W2114299563 cites W2010344294 @default.
• W2114299563 cites W2013831911 @default.
• W2114299563 cites W2023090036 @default.
• W2114299563 cites W2033436442 @default.
• W2114299563 cites W2036243945 @default.
• W2114299563 cites W2042543706 @default.
• W2114299563 cites W2047207093 @default.
• W2114299563 cites W2065785294 @default.
• W2114299563 cites W2072499072 @default.
• W2114299563 cites W2080762901 @default.
• W2114299563 cites W2101566761 @default.
• W2114299563 cites W2113731198 @default.
• W2114299563 cites W2120065100 @default.
• W2114299563 cites W2123884504 @default.
• W2114299563 cites W2134043187 @default.
• W2114299563 cites W2154024738 @default.
• W2114299563 cites W2161623422 @default.
• W2114299563 cites W2341230536 @default.
• W2114299563 cites W4253422011 @default.
• W2114299563 cites W8541401 @default.
• W2114299563 doi "https://doi.org/10.1074/jbc.m009001200" @default.
• W2114299563 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11278455" @default.
• W2114299563 hasPublicationYear "2001" @default.
• W2114299563 type Work @default.
• W2114299563 sameAs 2114299563 @default.
• W2114299563 citedByCount "36" @default.
• W2114299563 countsByYear W21142995632014 @default.
• W2114299563 countsByYear W21142995632016 @default.
• W2114299563 countsByYear W21142995632018 @default.
• W2114299563 countsByYear W21142995632019 @default.
• W2114299563 crossrefType "journal-article" @default.
• W2114299563 hasAuthorship W2114299563A5002992439 @default.
• W2114299563 hasAuthorship W2114299563A5035011139 @default.
• W2114299563 hasAuthorship W2114299563A5067011553 @default.
• W2114299563 hasAuthorship W2114299563A5071790052 @default.
• W2114299563 hasBestOaLocation W21142995631 @default.
• W2114299563 hasConcept C101762097 @default.
• W2114299563 hasConcept C104317684 @default.
• W2114299563 hasConcept C121608353 @default.
• W2114299563 hasConcept C150194340 @default.
• W2114299563 hasConcept C530470458 @default.
• W2114299563 hasConcept C54355233 @default.
• W2114299563 hasConcept C70721500 @default.
• W2114299563 hasConcept C83640560 @default.
• W2114299563 hasConcept C84606932 @default.
• W2114299563 hasConcept C86803240 @default.
• W2114299563 hasConcept C95444343 @default.
• W2114299563 hasConceptScore W2114299563C101762097 @default.
• W2114299563 hasConceptScore W2114299563C104317684 @default.
• W2114299563 hasConceptScore W2114299563C121608353 @default.
• W2114299563 hasConceptScore W2114299563C150194340 @default.
• W2114299563 hasConceptScore W2114299563C530470458 @default.
• W2114299563 hasConceptScore W2114299563C54355233 @default.
• W2114299563 hasConceptScore W2114299563C70721500 @default.
• W2114299563 hasConceptScore W2114299563C83640560 @default.
• W2114299563 hasConceptScore W2114299563C84606932 @default.
• W2114299563 hasConceptScore W2114299563C86803240 @default.
• W2114299563 hasConceptScore W2114299563C95444343 @default.
• W2114299563 hasIssue "18" @default.
• W2114299563 hasLocation W21142995631 @default.
• W2114299563 hasOpenAccess W2114299563 @default.
• W2114299563 hasPrimaryLocation W21142995631 @default.
• W2114299563 hasRelatedWork W1975811142 @default.
• W2114299563 hasRelatedWork W1975816033 @default.
• W2114299563 hasRelatedWork W1991523530 @default.
• W2114299563 hasRelatedWork W2002128513 @default.
• W2114299563 hasRelatedWork W2013095276 @default.
• W2114299563 hasRelatedWork W2036519228 @default.
• W2114299563 hasRelatedWork W2148313581 @default.
• W2114299563 hasRelatedWork W2171277769 @default.
• W2114299563 hasRelatedWork W421311755 @default.
• W2114299563 hasRelatedWork W2092874662 @default.
• W2114299563 hasVolume "276" @default.
• W2114299563 isParatext "false" @default.
• W2114299563 isRetracted "false" @default.
• W2114299563 magId "2114299563" @default.
• W2114299563 workType "article" @default.