FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2114491796> ?p ?o ?g. }

• W2114491796 endingPage "31646" @default.
• W2114491796 startingPage "31640" @default.
• W2114491796 abstract "Detoxification of hydroperoxides in trypanosomes is mediated by a series of linked redox pathways that are dependent on the parasite-specific thiol trypanothione for reducing equivalents. These pathways are characterized by differences in subcellular location, electron transport molecules, and substrate specificity. To determine the functional significance of the enzymes involved, we have used a tetracycline-inducible RNA interference system to down-regulate expression of each of the corresponding transcripts in bloodstream form Trypanosoma brucei. We have identified two peroxidases, a cytosolic peroxiredoxin (TbCPX) and a member of the non-selenium glutathione-dependent peroxidase family (TbGPXI), that appear to be essential for the viability of this clinically relevant stage of the parasite life cycle. The addition of tetracycline to the cultures resulted in a major reduction in mRNA levels and enzyme activity, a dramatic fall in growth rate, and significant cell death. Furthermore, within 20 h of adding tetracycline, cells in which the cytosolic peroxiredoxin transcript was targeted were found to be 16-fold more susceptible to killing by exogenous hydrogen peroxide. We also observed that knockdown of the tryparedoxin TbT-PNI, a thioredoxin-like protein that facilitates electron transport to both TbCPX and TbGPXI, resulted in a reduction in growth rate. These experiments therefore identify redox pathways that are essential for oxidative defense in T. brucei and validate the corresponding peroxidases as targets for drug design. Detoxification of hydroperoxides in trypanosomes is mediated by a series of linked redox pathways that are dependent on the parasite-specific thiol trypanothione for reducing equivalents. These pathways are characterized by differences in subcellular location, electron transport molecules, and substrate specificity. To determine the functional significance of the enzymes involved, we have used a tetracycline-inducible RNA interference system to down-regulate expression of each of the corresponding transcripts in bloodstream form Trypanosoma brucei. We have identified two peroxidases, a cytosolic peroxiredoxin (TbCPX) and a member of the non-selenium glutathione-dependent peroxidase family (TbGPXI), that appear to be essential for the viability of this clinically relevant stage of the parasite life cycle. The addition of tetracycline to the cultures resulted in a major reduction in mRNA levels and enzyme activity, a dramatic fall in growth rate, and significant cell death. Furthermore, within 20 h of adding tetracycline, cells in which the cytosolic peroxiredoxin transcript was targeted were found to be 16-fold more susceptible to killing by exogenous hydrogen peroxide. We also observed that knockdown of the tryparedoxin TbT-PNI, a thioredoxin-like protein that facilitates electron transport to both TbCPX and TbGPXI, resulted in a reduction in growth rate. These experiments therefore identify redox pathways that are essential for oxidative defense in T. brucei and validate the corresponding peroxidases as targets for drug design. Over 30 million people are infected with the parasites belonging to the family Trypanosomatidae, with a further 510 million at risk (see, on the World Wide Web, www.who.int). The parasites cause a variety of diseases including African sleeping sickness (Trypanosoma brucei), Chagas' disease (Trypanosoma cruzi), and cutaneous/visceral leishamaniasis (Leishmania spp.). These diseases are prevalent in parts of the world least able to afford the economic burden. With no immediate prospect of a vaccine and problems associated with current drug regimes, the requirement for new cost-effective treatments is a priority. A number of genetic and biochemical parasite-specific traits have been identified and are currently being evaluated in this context. One area that has attracted particular interest is the unusual thiol biochemistry of these parasites (1Fairlamb A.H. Cerami A. Annu. Rev. Microbiol. 1992; 46: 695-729Crossref PubMed Scopus (675) Google Scholar, 2Hunter W.N. Parasitology. 1997; 114: S17-S29Crossref PubMed Google Scholar, 3Flohe L. Hecht H.J. Steinert P. Free Radic. Biol. Med. 1999; 27: 966-984Crossref PubMed Scopus (181) Google Scholar, 4Krauth-Siegel R.L. Coombs G.H. Parasitol. Today. 1999; 15: 404-409Abstract Full Text Full Text PDF PubMed Scopus (118) Google Scholar). Although trypanosomatids contain significant levels of glutathione (5Hunter K.J. Le Quesne S.A. Fairlamb A.H. Eur. J. Biochem. 1994; 226: 1019-1027Crossref PubMed Scopus (72) Google Scholar, 6Kelly J.M. Taylor M.C. Smith K. Hunter K.J. Fairlamb A.H. Eur. J. Biochem. 1993; 218: 29-37Crossref PubMed Scopus (74) Google Scholar, 7Ariyanayagam M.R. Fairlamb A.H. Mol. Biochem. Parasitol. 2001; 115: 189-198Crossref PubMed Scopus (166) Google Scholar), their predominant low molecular weight thiol is a glutathione-spermidine conjugate called trypanothione (N 1,N 8-bis-glutathionylspermidine) (8Fairlamb A.H. Blackburn P. Ulrich P. Chait B.T. Cerami A. Science. 1985; 227: 1485-1487Crossref PubMed Scopus (584) Google Scholar). In conjunction with trypanothione reductase, an NADPH-dependent flavoprotein that maintains the thiol in its reduced form (9Shames S.L. Fairlamb A.H. Cerami A. Walsh C.T. Biochemistry. 1986; 25: 3519-3526Crossref PubMed Scopus (239) Google Scholar) (Fig. 1), trypanothione participates in a number of cellular processes that are carried out by glutathione in other organisms. Of these, its role in protecting the parasite from oxidative damage is perhaps the most important. Several trypanothione-dependent hydroperoxide-metabolizing pathways have now been characterized in trypanosomatids (10Nogoceke E. Gommel D.U. Kiess M. Kalisz H.M. Flohe L. Biol. Chem. 1997; 378: 827-836Crossref PubMed Scopus (257) Google Scholar, 11Tetaud E. Fairlamb A.H. Mol. Biochem. Parasitol. 1998; 96: 111-123Crossref PubMed Scopus (47) Google Scholar, 12Levick M.P. Tetaud E. Fairlamb A.H. Blackwell J.M. Mol. Biochem. Parasitol. 1998; 96: 125-137Crossref PubMed Scopus (97) Google Scholar, 13Wilkinson S.R. Meyer D.J. Kelly J.M. Biochem. J. 2000; 352: 755-761Crossref PubMed Scopus (66) Google Scholar, 14Wilkinson S.R. Temperton N.J. Mondragon A. Kelly J.M. J. Biol. Chem. 2000; 275: 8220-8225Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar, 15Tetaud E. Giroud C. Prescott A.R. Parkin D.W. Baltz D. Biteau N. Baltz T. Fairlamb A.H. Mol. Biochem. Parasitol. 2001; 116: 171-183Crossref PubMed Scopus (72) Google Scholar, 16Wilkinson S.R. Meyer D.J. Taylor M.C. Bromley E.V. Miles M.A. Kelly J.M. J. Biol. Chem. 2002; 277: 17062-17071Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar, 17Wilkinson S.R. Obado S.O. Mauricio I.L. Kelly J.M. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 13453-13458Crossref PubMed Scopus (125) Google Scholar, 18Wilkinson S.R. Taylor M.C. Touitha S. Mauricio I.L. Meyer D.J. Kelly J.M. Biochem. J. 2002; 364: 787-794Crossref PubMed Scopus (72) Google Scholar, 19Castro H. Budde H. Flohe L. Hofmann B. Lunsdorf H. Wissing J. Tomas A.M. Free Radic. Biol. Med. 2002; 33: 1563-1574Crossref PubMed Scopus (52) Google Scholar, 20Castro H. Sousa C. Santos M. Cordeiro-da-Silva A. Flohe L. Tomas A.M. Free Radic. Biol. Med. 2002; 33: 1552-1562Crossref PubMed Scopus (86) Google Scholar, 21Hillebrand H. Schmidt A. Krauth-Siegel R.L. J. Biol. Chem. 2003; 278: 6809-6815Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar) (Fig. 1). In all cases, transfer of reducing equivalents from trypanothione to the hydroperoxide occurs by a two-step redox cascade. Initially, electrons are transferred from trypanothione to an intermediary molecule such as tryparedoxin (a thioredoxin-like protein), glutathione, or ascorbate. These then facilitate the redox flux to the appropriate peroxidase. Five distinct trypanosomal peroxidases have been reported, each exhibiting differences in their subcellular location, substrate specificity, and electron donor. Two members of the peroxiredoxin family of antioxidant enzymes have been identified in each of the trypanosomatids that cause disease in humans (14Wilkinson S.R. Temperton N.J. Mondragon A. Kelly J.M. J. Biol. Chem. 2000; 275: 8220-8225Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar, 15Tetaud E. Giroud C. Prescott A.R. Parkin D.W. Baltz D. Biteau N. Baltz T. Fairlamb A.H. Mol. Biochem. Parasitol. 2001; 116: 171-183Crossref PubMed Scopus (72) Google Scholar, 20Castro H. Sousa C. Santos M. Cordeiro-da-Silva A. Flohe L. Tomas A.M. Free Radic. Biol. Med. 2002; 33: 1552-1562Crossref PubMed Scopus (86) Google Scholar). They are located in either the cytosol or mitochondrion, use tryparedoxin as an electron donor, and can reduce substrates including H2O2 and small chain organic hydroperoxides (Fig. 1, A and B). A second type of protein, related to heme peroxidases found in plants has been identified in the endoplasmic reticulum of T. cruzi (17Wilkinson S.R. Obado S.O. Mauricio I.L. Kelly J.M. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 13453-13458Crossref PubMed Scopus (125) Google Scholar). This enzyme has a substrate specificity restricted to H2O2 and uses ascorbate as source of reducing equivalents (Fig. 1D). The remaining two proteins share extensive similarity to the non-selenium glutathione-dependent peroxidase family. One (GPXI) has been found in both the cytosol and glycosomes of T. cruzi (16Wilkinson S.R. Meyer D.J. Taylor M.C. Bromley E.V. Miles M.A. Kelly J.M. J. Biol. Chem. 2002; 277: 17062-17071Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar) and additionally in the mitochondrion of T. brucei (21Hillebrand H. Schmidt A. Krauth-Siegel R.L. J. Biol. Chem. 2003; 278: 6809-6815Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar). Glycosomes are parasite-specific organelles that contain enzymes involved in a number of biochemical pathways including glycolysis and fatty acid biosynthesis (22Opperdoes F.R. Annu. Rev. Microbiol. 1987; 41: 127-151Crossref PubMed Scopus (423) Google Scholar, 23Opperdoes F.R. Michels P.A. Biochimie. 1994; 75: 231-234Crossref Scopus (41) Google Scholar, 24Michels P.A. Hannaert V. Bringaud F. Parasitol. Today. 2000; 16: 482-489Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar, 25Parsons M. Furuya T. Pal S. Kessler P. Mol. Biochem. Parasitol. 2001; 115: 9-28Crossref Scopus (83) Google Scholar). The second (GPXII), is present in the endoplasmic reticulum of T. cruzi (18Wilkinson S.R. Taylor M.C. Touitha S. Mauricio I.L. Meyer D.J. Kelly J.M. Biochem. J. 2002; 364: 787-794Crossref PubMed Scopus (72) Google Scholar). These enzymes can use glutathione as an electron donor (Fig. 1C), albeit with a low efficiency, although tryparedoxin can also act as an alternative source of electrons for GPXI from both T. cruzi and T. brucei (16Wilkinson S.R. Meyer D.J. Taylor M.C. Bromley E.V. Miles M.A. Kelly J.M. J. Biol. Chem. 2002; 277: 17062-17071Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar, 21Hillebrand H. Schmidt A. Krauth-Siegel R.L. J. Biol. Chem. 2003; 278: 6809-6815Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar) (Fig. 1A). This ability to scavenge reducing equivalents from different sources may reflect the absence of one intermediary (either glutathione or tryparedoxin) from one of the subcellular locations where GPXI is found. The two T. cruzi glutathione-dependent peroxidases have a narrow substrate range, preferentially detoxifying hydroperoxides found in fatty acids and phospholipids, and have no activity toward H2O2. In contrast, the T. brucei GPXI can metabolize H2O2 (21Hillebrand H. Schmidt A. Krauth-Siegel R.L. J. Biol. Chem. 2003; 278: 6809-6815Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar). Phylogenetic analysis suggests that trypanosomal GPXIs are of plant origin and may have been acquired following an endosymbiotic event early in the evolution of the trypanosomatid lineage (18Wilkinson S.R. Taylor M.C. Touitha S. Mauricio I.L. Meyer D.J. Kelly J.M. Biochem. J. 2002; 364: 787-794Crossref PubMed Scopus (72) Google Scholar). Together, these trypanothione-dependent hydroperoxide-metabolizing pathways (Fig. 1) allow the parasite to mount an effective response to a number of oxidative insults that may arise within different subcellular compartments of the cell. Overexpression studies in T. cruzi have shown that the various peroxidases play an important role in protecting the parasite from hydroperoxide-mediated damage (14Wilkinson S.R. Temperton N.J. Mondragon A. Kelly J.M. J. Biol. Chem. 2000; 275: 8220-8225Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar, 16Wilkinson S.R. Meyer D.J. Taylor M.C. Bromley E.V. Miles M.A. Kelly J.M. J. Biol. Chem. 2002; 277: 17062-17071Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar, 17Wilkinson S.R. Obado S.O. Mauricio I.L. Kelly J.M. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 13453-13458Crossref PubMed Scopus (125) Google Scholar). In most cases, elevated levels of the peroxidase correlate with an increase in resistance toward exogenous hydroperoxides. To examine the reciprocal situation, we have employed an inducible RNA interference (RNAi) 1The abbreviations used are: RNAi, RNA interference; TPNI and TPNII, tryparedoxin I and II, respectively; CPX, cytosolic peroxiredoxin; MPX, mitochondrial peroxiredoxin; GPXI, glutathione-dependent peroxidase I.1The abbreviations used are: RNAi, RNA interference; TPNI and TPNII, tryparedoxin I and II, respectively; CPX, cytosolic peroxiredoxin; MPX, mitochondrial peroxiredoxin; GPXI, glutathione-dependent peroxidase I. system to generate a series of T. brucei cell lines where many of the genes implicated in the above pathways can be down-regulated. These experiments have identified two peroxidases that appear to be essential for the viability of the bloodstream form of the parasite. Parasites—T. brucei single marker cell line (SMB) bloodstream forms that constitutively express T7 polymerase and the tetracycline repressor protein (26Wirtz E. Leal S. Ochatt C. Cross G.A. Mol. Biochem. Parasitol. 1999; 99: 89-101Crossref PubMed Scopus (1098) Google Scholar) were grown at 37 °C under a 5% CO2 atmosphere in modified Iscove's medium (27Hirumi H. Hirumi K. J. Parasitol. 1989; 75: 985-989Crossref PubMed Scopus (752) Google Scholar) containing 2 μgml–1 G418. Tetracycline-free fetal calf serum (Autogen Bioclear) was used in the growth medium. DNA and total RNA were extracted from parasites using the DNeasy® Tissue and RNeasy® mini kits (Qiagen), respectively. Genes—Five T. brucei genes were targeted in this study. These have been designated TbCPX (accession numbers AF283104 and AF326293) (15Tetaud E. Giroud C. Prescott A.R. Parkin D.W. Baltz D. Biteau N. Baltz T. Fairlamb A.H. Mol. Biochem. Parasitol. 2001; 116: 171-183Crossref PubMed Scopus (72) Google Scholar), TbMPX (AAG28496) (15Tetaud E. Giroud C. Prescott A.R. Parkin D.W. Baltz D. Biteau N. Baltz T. Fairlamb A.H. Mol. Biochem. Parasitol. 2001; 116: 171-183Crossref PubMed Scopus (72) Google Scholar), TbGPXI (AJ298281) (21Hillebrand H. Schmidt A. Krauth-Siegel R.L. J. Biol. Chem. 2003; 278: 6809-6815Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar), TbTPNI (AF196570 and AJ006403) (15Tetaud E. Giroud C. Prescott A.R. Parkin D.W. Baltz D. Biteau N. Baltz T. Fairlamb A.H. Mol. Biochem. Parasitol. 2001; 116: 171-183Crossref PubMed Scopus (72) Google Scholar, 28Ludemann H. Dormeyer M. Sticherling C. Stallmann D. Follmann H. Krauth-Siegel R.L. FEBS Lett. 1998; 431: 381-385Crossref PubMed Scopus (92) Google Scholar), and TbTPNII (AC093543) and were identified from either the T. brucei genome project (available on the World Wide Web at www.sanger.ac.uk/Projects/T_brucei/) or EMBL/GenBank™ data bases. The properties of the corresponding enzymes are outlined in the Introduction. RNAi Constructs—Fragments (between 237 and 423 bp) corresponding to the 5′-coding sequence of each gene were amplified from genomic DNA (see Table I for details) and ligated into XcmI-digested p2T7TA, 2D. Horn, unpublished results. a TA cloning vector based on the construct p2T7Ti that confers hygromycin resistance (29LaCount D.J. Bruse S. Hill K.L. Donelson J.E. Mol. Biochem. Parasitol. 2000; 111: 67-76Crossref PubMed Scopus (156) Google Scholar). In these vectors, the inserted DNA is flanked by two opposing T7 promoters with each promoter under the control of a tetracycline operator. The amplified products were sequenced using a dye terminator cycle sequencing kit (Applied Biosystems) and fractionated using an ABI Prism 377 DNA sequencer. Constructs were linearized with NotI and electroporated into bloodstream form parasites, which were cloned as described (30Ingram A.K. Cross G.A. Horn D. Mol. Biochem. Parasitol. 2000; 111: 309-317Crossref PubMed Scopus (49) Google Scholar). Transformed parasites were selected in modified Iscove's medium containing 2 μg ml–1 G418 and 2.5 μg ml–1 hygromycin B. RNAi induction was initiated by adding 1 μg ml–1 tetracycline to the culture. Three isoforms of TbGPXI have recently been described, each with differing amino and carboxyl termini (21Hillebrand H. Schmidt A. Krauth-Siegel R.L. J. Biol. Chem. 2003; 278: 6809-6815Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar). The RNAi construct generated here was designed to target the transcripts expressed by all three genes.Table IOligonucleotides used in this studyTargeted genePrimerSequence (5′ to 3′)Fragment sizebpTbCPXTbCPX-1ATGTCCTGCGGTGATGCGAAA306TbCPX-2AATGTTCATCGTCCCCAATCCTbMPXTbMPX-1CCGTTTCTCCATGTTGCCATT423TbMPX-2CCCGAGATATCTCCTTTGGTGTbGPXITbGPXI-1ATGCTGCGTTCATCTCGGAAA268TbGPXI-2TTCCTCCTCGGTTCCGGGTTCTbTPNITbTPNI-1AAGTATCTTCCTGGCGCAACC237TbTPNI-2GCATCTTGCCGTAGTAATCATTbTPNIITbTPNII-1ATGCCCTCCGCTGAAACACTA321TbTPNII-2CCCATGAGAACATTCGCCACC Open table in a new tab Detection of the Growth Inhibition Phenotype—Bloodstream form trypanosomes, transformed with each of the RNAi constructs, were seeded at 1 × 105 cells ml–1 and incubated at 37 °C in the presence of tetracycline. Every 24 h, parasite growth was monitored microscopically, and the culture was diluted back to 1 × 105 cells ml–1. Control cultures incubated in the absence of tetracycline were grown in parallel. Under these conditions, untreated cell lines grew with a doubling time of ∼7–8 h. Peroxide Sensitivity Experiments—Bloodstream form parasites grown in either the absence or presence of tetracycline were seeded at 2.5 × 106 ml–1 in a 96-well plate in 200 μl of growth medium containing 18 different concentrations of H2O2 over the range 1.25–1000 μm. After incubation at 37 °C for 90 min, 20 μl of the vital stain Alamar blue (BIOSOURCE UK Ltd.) was added to each well and the plates incubated for a further 6 h. The fluorescence of each culture was determined using a Gemini Fluorescent Plate reader (Molecular Devices) at an excitation wavelength of 530 nm, an emission wavelength of 585 nm, and a filter cut-off at 550 nm. The color change resulting from the reduction of Alamar blue is proportional to the number of live cells, which was established following production of a standard curve. Enzyme Assays—Fractionation studies were carried out on tetracycline-induced and -uninduced T. brucei cultures as described (31Opperdoes F.R. Markos A. Steiger R.F. Mol. Biochem. Parasitol. 1981; 4: 291-309Crossref PubMed Scopus (73) Google Scholar). 1-Liter cultures of bloodstream form parasites were pelleted; washed once in 25 mm Tris·Cl, pH 7.6, 1 mm EDTA, 0.32 m sucrose (buffer A); and then resuspended in buffer A (5 × 108 cells ml–1) containing protease inhibitors (Roche Applied Science). Silicon carbide was added to the cell paste, and the cells were lysed in a Dounce homogenizer. Differential centrifugation was performed to remove abrasive (100 × g; 3 min) and nuclei/cell debris (1000 × g; 10 min). A final centrifugation (14,500 × g; 10 min) produced a “large granule” pellet. Linear density gradients from 0.4 to 2 m sucrose in 25 mm Tris·Cl, pH 7.6, 1 mm EDTA were layered upon a 2.5 m sucrose cushion. The large granule fraction was resuspended in buffer A and applied to the top of the gradient. Isopycnic centrifugation was then carried out using a SW40 rotor in a Beckman L8–80 ultracentrifuge at 200,000 × g for 150 min at 4 °C. 1.0-ml fractions were collected and assayed for hexokinase activity (32Easterby J.S. Qadri S.S. Methods Enzymol. 1982; 90: 11-15Crossref PubMed Scopus (36) Google Scholar). Glutathione-dependent and trypanothione-dependent peroxidase activities were measured by monitoring NADPH oxidation (13Wilkinson S.R. Meyer D.J. Kelly J.M. Biochem. J. 2000; 352: 755-761Crossref PubMed Scopus (66) Google Scholar, 16Wilkinson S.R. Meyer D.J. Taylor M.C. Bromley E.V. Miles M.A. Kelly J.M. J. Biol. Chem. 2002; 277: 17062-17071Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar). Fractions were extensively dialyzed against 25 mm Tris·Cl, pH 7.6, 1 mm EDTA prior to analysis. For glutathione-dependent peroxidase (TbGPXI) activity, a standard reaction mixture (1 ml) containing 100 mm Tris·Cl, pH 7.6, 5 mm EDTA, 0.2 mm β-NADPH, 1 mm NaN3, 10 mm GSH, 0.1% (v/v) Triton X-100, 1.4 units of glutathione reductase, and the dialyzed fraction was incubated at 30 °C for 5 min. The background rate of NADPH oxidation was determined, and the reaction was initiated by the addition of cumene hydroperoxide (Sigma). For trypanothione-dependent peroxidase (TbCPX) activity, a standard reaction mixture (1 ml) containing 50 mm HEPES, pH 7.6, 0.5 mm EDTA, 200 μm NADPH, 0.5 μm trypanothione reductase, 50 μm trypanothione, 1 μm recombinant tryparedoxin (16Wilkinson S.R. Meyer D.J. Taylor M.C. Bromley E.V. Miles M.A. Kelly J.M. J. Biol. Chem. 2002; 277: 17062-17071Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar), and the dialyzed fraction was incubated at 30 °C for 5 min. The background rate of NADPH oxidation was determined, and the reaction was initiated by the addition of H2O2 (Sigma). In both cases, enzyme activity was calculated using an ϵ value of 6220 m–1 cm–1. Protein concentrations were determined by the BCA protein assay system (Pierce). Generation of the T. brucei RNAi Cell Lines—Several enzymes involved in hydroperoxide metabolism in T. brucei have now been identified and characterized at the biochemical level. Using an inducible RNAi system we set out to determine their importance for parasite viability. The full-length nucleotide sequences of four of the corresponding genes were identified from the EMBL/GenBank™ data base. These were the cytosolic (TbCPX) and mitochondrial (TbMPX) peroxiredoxins (15Tetaud E. Giroud C. Prescott A.R. Parkin D.W. Baltz D. Biteau N. Baltz T. Fairlamb A.H. Mol. Biochem. Parasitol. 2001; 116: 171-183Crossref PubMed Scopus (72) Google Scholar), a non-selenium glutathione-dependent peroxidase (TbGPXI) (21Hillebrand H. Schmidt A. Krauth-Siegel R.L. J. Biol. Chem. 2003; 278: 6809-6815Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar), and a tryparedoxin (TbTPNI) (28Ludemann H. Dormeyer M. Sticherling C. Stallmann D. Follmann H. Krauth-Siegel R.L. FEBS Lett. 1998; 431: 381-385Crossref PubMed Scopus (92) Google Scholar). In addition to the above, we also identified a previously uncharacterized tryparedoxin in the T. brucei genome project data base (available on the World Wide Web www.sanger.ac.uk/Projects/T_brucei/) after BLAST analysis with the T. cruzi TcTPNII sequence (16Wilkinson S.R. Meyer D.J. Taylor M.C. Bromley E.V. Miles M.A. Kelly J.M. J. Biol. Chem. 2002; 277: 17062-17071Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar) (accession number AAF04973). The deduced T. brucei protein possesses two distinctive signatures that identify it as a member of the tryparedoxin family of oxidoreductase proteins (33Gommel D.U. Nogoceke E. Morr M. Kiess M. Kalisz H.M. Flohe L. Eur. J. Biochem. 1997; 248: 913-918Crossref PubMed Scopus (99) Google Scholar, 34Alphey M.S. Leonard G.A. Gourley D.G. Tetaud E. Fairlamb A.H. Hunter W.N. J. Biol. Chem. 1999; 274: 25613-25622Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar, 35Hofmann B. Budde H. Bruns K. Guerrero S.A. Kalisz H.M. Menge U. Montemartini M. Nogoceke E. Steinert P. Wissing J.B. Flohe L. Hecht H.J. Biol. Chem. 2001; 382: 459-471Crossref PubMed Scopus (53) Google Scholar) (Fig. 2). First, it contains a WCPPC motif that in other tryparedoxins functions as the redox active center of the molecule, and second, it has several conserved amino acids that are proposed to be involved in binding trypanothione (Fig. 2). TbT-PNII differs from most other tryparedoxins in that it possesses an insertion sequence and a hydrophobic carboxyl-terminal extension (Fig. 2). Both of these features are also present in the T. cruzi counterpart. The precise roles of both of these proteins and the redox pathways in which they participate have yet to be elucidated. The presence of a heme-containing ascorbate-dependent peroxidase homologous to that reported in T. cruzi (17Wilkinson S.R. Obado S.O. Mauricio I.L. Kelly J.M. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 13453-13458Crossref PubMed Scopus (125) Google Scholar) (Fig. 1D) has yet to be confirmed in T. brucei. DNA fragments from each of the above genes were cloned into the trypanosomal RNAi vector p2T7TA (see “Experimental Procedures”). Constructs were transformed into bloodstream form T. brucei SMB (26Wirtz E. Leal S. Ochatt C. Cross G.A. Mol. Biochem. Parasitol. 1999; 99: 89-101Crossref PubMed Scopus (1098) Google Scholar), and integration into the genome was confirmed by Southern hybridization (data not shown). Knockdown of TbCPX and TbGPXI Severely Curtails Cell Growth—To examine whether RNAi-mediated down-regulation of any of the targeted genes affected the growth rate of bloodstream form T. brucei, the cumulative cell density of tetracycline-treated parasites was followed and compared against untreated cultures (Fig. 3). In the absence of tetracycline, all five recombinant cell lines were found to grow at approximately the same rate as the parental cells. When tetracycline was added, there was no major alteration in the growth rate of the parasites that had been transformed with the TbMPX and TbTPNII constructs (Fig. 3A). In contrast, induction of double-stranded RNA corresponding to TbCPX had a dramatic effect (Fig. 3B). Within 24 h, a significant reduction in the growth rate of these cells could be observed. In the next 24 h, most of the cells in the population died, and those that remained alive exhibited greatly decreased motility. The experiment was repeated with a second clone. There was a similar rapid decline in growth rate, such that 2 days after exposure to tetracycline, the cumulative cell density of treated parasites was less than 1% that of the noninduced cultures. Interestingly, in the third and subsequent days after induction, we observed an outgrowth of viable parasites in the case of this clone (Fig. 3B). This type of reversion has been observed previously following induction of RNAi against essential genes in T. brucei (36Drozdz M. Palazzo S.S. Salavati R. O'Rear J. Clayton C. Stuart K. EMBO J. 2002; 21: 1791-1799Crossref PubMed Scopus (68) Google Scholar, 37Furuya T. Kessler P. Jardim A. Schnaufer A. Crudder C. Parsons M. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 14177-14182Crossref PubMed Scopus (104) Google Scholar). In cells where TbGPXI was down-regulated, there was also a major effect on growth rate. Induction of RNAi resulted in a >99% reduction in the cumulative cell density obtained over a period of 3–6 days, depending on the clone examined (Fig. 3C). Three isoforms of TbGPXI have been identified (21Hillebrand H. Schmidt A. Krauth-Siegel R.L. J. Biol. Chem. 2003; 278: 6809-6815Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar). The 268-bp fragment inserted into the RNAi vector is 95% identical across the three genes, including a stretch of 134 nucleotides where the sequence is completely conserved. It can be inferred that each of the corresponding transcripts should be equally susceptible to RNAi-mediated knockdown (see Fig. 4). The cell line in which the transcript encoding the tryparedoxin TbTPNI had been targeted also displayed a significant reduction in growth rate following tetracycline treatment (Fig. 3D). However, the decline in the cumulative cell density was less than that exhibited by the TbCPX and TbGPXI cell lines. In addition, we did not observe any obvious signs of cell death or see an effect on motility. To confirm that the effects induced by tetracycline were associated with down-regulation of the target transcript, RNA from each of the cell lines was examined by Northern blotting. RNA was isolated from cells that had been maintained in the presence of tetracycline for 4 days. In the case of the TbCPX cell line, RNA had to be isolated after only 20 h of treatment due to the induction of cell death at later time points. For all of the genes examined, there was a significant reduction in the level of the targeted transcript (Fig. 4). In two cases, TbMPX and TbGPXI, in addition to the disappearance of the endogenous transcript, we observed the appearance of a smaller band on the autoradigraphs (Fig. 4). Previous T. brucei RNAi studies have also noted the appearance of smaller hybridizing RNAs in tetracycline-treated cultures (37Furuya T. Kessler P. Jardim A. Schnaufer A. Crudder C. Parsons M. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 14177-14182Crossref PubMed Scopus (104) Google Scholar, 38Morris J.C. Wang Z. Drew M.E. Englund P.T. EMBO J. 2002; 21: 4429-4438Crossref PubMed Scopus (127) Google Scholar). These molecules have been reported to correspond either to the RNAi transcript itself or to fragments produced by the degradat" @default.
• W2114491796 created "2016-06-24" @default.
• W2114491796 creator A5006899799 @default.
• W2114491796 creator A5047464745 @default.
• W2114491796 creator A5048851339 @default.
• W2114491796 creator A5069753335 @default.
• W2114491796 date "2003-08-01" @default.
• W2114491796 modified "2023-10-16" @default.
• W2114491796 title "RNA Interference Identifies Two Hydroperoxide Metabolizing Enzymes That Are Essential to the Bloodstream Form of the African Trypanosome" @default.
• W2114491796 cites W1507630962 @default.
• W2114491796 cites W1525996538 @default.
• W2114491796 cites W156089625 @default.
• W2114491796 cites W1574734617 @default.
• W2114491796 cites W1600537577 @default.
• W2114491796 cites W1964828026 @default.
• W2114491796 cites W1964944304 @default.
• W2114491796 cites W1968354620 @default.
• W2114491796 cites W1970732978 @default.
• W2114491796 cites W1971780336 @default.
• W2114491796 cites W1975504090 @default.
• W2114491796 cites W1979213367 @default.
• W2114491796 cites W1982823287 @default.
• W2114491796 cites W1983846212 @default.
• W2114491796 cites W1988565813 @default.
• W2114491796 cites W1999748325 @default.
• W2114491796 cites W2002860741 @default.
• W2114491796 cites W2006723796 @default.
• W2114491796 cites W2014565441 @default.
• W2114491796 cites W2017500476 @default.
• W2114491796 cites W2020308781 @default.
• W2114491796 cites W2023356380 @default.
• W2114491796 cites W2029374828 @default.
• W2114491796 cites W2029376735 @default.
• W2114491796 cites W2033063558 @default.
• W2114491796 cites W2035523275 @default.
• W2114491796 cites W2043585539 @default.
• W2114491796 cites W2045834254 @default.
• W2114491796 cites W2048079961 @default.
• W2114491796 cites W2049013030 @default.
• W2114491796 cites W2056229554 @default.
• W2114491796 cites W2059596834 @default.
• W2114491796 cites W2059596852 @default.
• W2114491796 cites W2060040352 @default.
• W2114491796 cites W2063077244 @default.
• W2114491796 cites W2065917181 @default.
• W2114491796 cites W2068617414 @default.
• W2114491796 cites W2074929773 @default.
• W2114491796 cites W2074955861 @default.
• W2114491796 cites W2084505046 @default.
• W2114491796 cites W2087344117 @default.
• W2114491796 cites W2089851507 @default.
• W2114491796 cites W2091883134 @default.
• W2114491796 cites W2095254779 @default.
• W2114491796 cites W2098582212 @default.
• W2114491796 cites W2098923459 @default.
• W2114491796 cites W2102934052 @default.
• W2114491796 cites W2104482284 @default.
• W2114491796 cites W2115815568 @default.
• W2114491796 cites W2116251790 @default.
• W2114491796 cites W2116350092 @default.
• W2114491796 cites W2117937845 @default.
• W2114491796 cites W2134469837 @default.
• W2114491796 cites W2142172677 @default.
• W2114491796 cites W2142722961 @default.
• W2114491796 cites W2147533928 @default.
• W2114491796 cites W2148686101 @default.
• W2114491796 cites W2154261496 @default.
• W2114491796 cites W2157236463 @default.
• W2114491796 cites W2162946468 @default.
• W2114491796 cites W2167047804 @default.
• W2114491796 cites W2168623385 @default.
• W2114491796 cites W2403381246 @default.
• W2114491796 cites W2417017081 @default.
• W2114491796 cites W2467000957 @default.
• W2114491796 cites W4301775461 @default.
• W2114491796 cites W957035614 @default.
• W2114491796 doi "https://doi.org/10.1074/jbc.m303035200" @default.
• W2114491796 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12791697" @default.
• W2114491796 hasPublicationYear "2003" @default.
• W2114491796 type Work @default.
• W2114491796 sameAs 2114491796 @default.
• W2114491796 citedByCount "107" @default.
• W2114491796 countsByYear W21144917962012 @default.
• W2114491796 countsByYear W21144917962013 @default.
• W2114491796 countsByYear W21144917962014 @default.
• W2114491796 countsByYear W21144917962015 @default.
• W2114491796 countsByYear W21144917962016 @default.
• W2114491796 countsByYear W21144917962017 @default.
• W2114491796 countsByYear W21144917962018 @default.
• W2114491796 countsByYear W21144917962019 @default.
• W2114491796 countsByYear W21144917962020 @default.
• W2114491796 countsByYear W21144917962021 @default.
• W2114491796 countsByYear W21144917962022 @default.
• W2114491796 countsByYear W21144917962023 @default.
• W2114491796 crossrefType "journal-article" @default.
• W2114491796 hasAuthorship W2114491796A5006899799 @default.
• W2114491796 hasAuthorship W2114491796A5047464745 @default.
• W2114491796 hasAuthorship W2114491796A5048851339 @default.

• next