FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2116335096> ?p ?o ?g. }

• W2116335096 endingPage "7481" @default.
• W2116335096 startingPage "7472" @default.
• W2116335096 abstract "Gene activation by the thyroid hormone (T3) receptor (TR) involves the recruitment of specific coactivator complexes to T3-responsive promoters. A large number of coactivators for TR have been isolated and characterized in vitro. However, their roles and functions in vivo during development have remained largely unknown. We have utilized metamorphosis in Xenopus laevis to study the role of these coactivators during post-embryonic development. Metamorphosis is totally dependent on the thyroid hormone, and TR mediates a vast majority, if not all, of the developmental effects of the hormone. We have previously shown that TR recruits the coactivator SRC3 (steroid receptor coactivator-3) and that coactivator recruitment is essential for metamorphosis. To determine whether SRCs are indeed required, we have analyzed the in vivo role of the histone acetyltransferase p300/CREB-binding protein (CBP), which was reported to be a component of the SRC·coactivator complexes. Chromatin immunoprecipitation revealed that p300 is recruited to T3-responsive promoters, implicating a role of p300 in TR function. Further, transgenic tadpoles overexpressing a dominant negative form of p300, F-dnp300, containing only the SRC-interacting domain, displayed arrested or delayed metamorphosis. Molecular analyses of the transgenic F-dnp300 animals showed that F-dnp300 was recruited by TR (displacing endogenous p300) and inhibited the expression of T3-responsive genes. Our results thus suggest that p300 and/or its related CBP is an essential component of the TR-signaling pathway in vivo and support the notion that p300/CBP and SRC proteins are part of the same coactivator complex in vivo during post-embryonic development. Gene activation by the thyroid hormone (T3) receptor (TR) involves the recruitment of specific coactivator complexes to T3-responsive promoters. A large number of coactivators for TR have been isolated and characterized in vitro. However, their roles and functions in vivo during development have remained largely unknown. We have utilized metamorphosis in Xenopus laevis to study the role of these coactivators during post-embryonic development. Metamorphosis is totally dependent on the thyroid hormone, and TR mediates a vast majority, if not all, of the developmental effects of the hormone. We have previously shown that TR recruits the coactivator SRC3 (steroid receptor coactivator-3) and that coactivator recruitment is essential for metamorphosis. To determine whether SRCs are indeed required, we have analyzed the in vivo role of the histone acetyltransferase p300/CREB-binding protein (CBP), which was reported to be a component of the SRC·coactivator complexes. Chromatin immunoprecipitation revealed that p300 is recruited to T3-responsive promoters, implicating a role of p300 in TR function. Further, transgenic tadpoles overexpressing a dominant negative form of p300, F-dnp300, containing only the SRC-interacting domain, displayed arrested or delayed metamorphosis. Molecular analyses of the transgenic F-dnp300 animals showed that F-dnp300 was recruited by TR (displacing endogenous p300) and inhibited the expression of T3-responsive genes. Our results thus suggest that p300 and/or its related CBP is an essential component of the TR-signaling pathway in vivo and support the notion that p300/CBP and SRC proteins are part of the same coactivator complex in vivo during post-embryonic development. T3 receptor (TR) 3The abbreviations used are: T3, thyroid hormone; TR, T3 receptor; CBP, CREB-binding protein; CREB, cAMP-response element-binding protein; RXR, 9-cis-retinoic acid receptor; SRC, steroid receptor coactivator; RT, reverse transcription; GFP, green fluorescent protein; SID, SRC-interacting domain. belongs to the superfamily of ligand-inducible nuclear hormone receptors (1Mangelsdorf D.J. Thummel C. Beato M. Herrlich P. Schutz G. Umesono K. Blumberg B. Kastner P. Mark M. Chambon P. Cell. 1995; 83: 835-839Abstract Full Text PDF PubMed Scopus (6085) Google Scholar, 2Laudet V. Gronemeyer H. The Nuclear Receptor Facts Book. Academic Press, San Diego, CA2002Google Scholar). TR regulates transcription by forming a heterodimer with 9-cis-retinoic acid receptor (RXR) and binding to T3 response elements (TREs) on T3-responsive promoters. In the absence of T3, the TR heterodimer represses transcription by recruiting corepressors, whereas in the presence of T3, TRs recruit coactivators to facilitate transcription (3Rachez C. Freedman L.P. Curr. Opin. Cell Biol. 2001; 13: 274-280Crossref PubMed Scopus (236) Google Scholar, 4Hu X. Lazar M.A. Trends Endocrinol. Metab. 2000; 11: 6-10Abstract Full Text Full Text PDF PubMed Scopus (236) Google Scholar, 5Ito M. Roeder R.G. Trends Endocrinol. Metab. 2001; 12: 127-134Abstract Full Text Full Text PDF PubMed Scopus (223) Google Scholar, 6Jones P.L. Shi Y.-B. Curr. Top. Microbiol. Immunol. 2003; 274: 237-268PubMed Google Scholar). These coactivators may either directly interact with TR or are recruited to the TR activation complex through protein-protein interactions. Coactivators for TR include the steroid receptor coactivator (SRC) or p160 family of proteins (7Hong H. Kohli K. Trivedi A. Johnson D.L. Stallcup M.R. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 4948-4952Crossref PubMed Scopus (614) Google Scholar, 8Voegel J.J. Heine M.J. Zechel C. Chambon P. Gronemeyer H. EMBO J. 1996; 15: 3667-3675Crossref PubMed Scopus (952) Google Scholar, 9Anzick S.L. Kononen J. Walker R.L. Azorsa D.O. Tanner M.M. Guan X.Y. Sauter G. Kallioniemi O.P. Trent J.M. Meltzer P.S. Science. 1997; 277: 965-968Crossref PubMed Scopus (1432) Google Scholar, 10Chen H. Lin R.J. Schiltz R.L. Chakravarti D. Nash A. Nagy L. Privalsky M.L. Nakatani Y. Evans R.M. Cell. 1997; 90: 569-580Abstract Full Text Full Text PDF PubMed Scopus (1268) Google Scholar, 11Li H. Gomes P.J. Chen J.D. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 8479-8484Crossref PubMed Scopus (504) Google Scholar, 12Takeshita A. Cardona G.R. Koibuchi N. Suen C.S. Chin W.W. J. Biol. Chem. 1997; 272: 27629-27634Abstract Full Text Full Text PDF PubMed Scopus (325) Google Scholar, 13Torchia J. Rose D.W. Inostroza J. Kamei Y. Westin S. Glass C.K. Rosenfeld M.G. Nature. 1997; 387: 677-684Crossref PubMed Scopus (1107) Google Scholar, 14Suen C.S. Berrodin T.J. Mastroeni R. Cheskis B.J. Lyttle C.R. Frail D.E. J. Biol. Chem. 1998; 273: 27645-27653Abstract Full Text Full Text PDF PubMed Scopus (212) Google Scholar, 15Onate S.A. Tsai S.Y. Tsai M.J. O'Malley B.W. Science. 1995; 270: 1354-1357Crossref PubMed Scopus (2058) Google Scholar), the mediator-like TRAP/DRIP (thyroid hormone receptor-associated protein/vitamin D receptor-interacting protein) complex (16Rachez C. Suldan Z. Ward J. Chang C.P. Burakov D. Erdjument-Bromage H. Tempst P. Freedman L.P. Genes Dev. 1998; 12: 1787-1800Crossref PubMed Scopus (328) Google Scholar, 17Yuan C.X. Ito M. Fondell J.D. Fu Z.Y. Roeder R.G. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 7939-7944Crossref PubMed Scopus (390) Google Scholar), the histone acetyltransferases, p300/CREB-binding protein (CBP) (18Chakravarti D. LaMorte V.J. Nelson M.C. Nakajima T. Schulman I.G. Juguilon H. Montminy M. Evans R.M. Nature. 1996; 383: 99-103Crossref PubMed Scopus (850) Google Scholar), and the histone methyltransferases PRMT1 and CARM1 (19Chen D. Ma H. Hong H. Koh S.S. Huang S.M. Schurter B.T. Aswad D.W. Stallcup M.R. Science. 1999; 284: 2174-2177Crossref PubMed Scopus (1003) Google Scholar, 20Koh S.S. Chen D.G. Lee Y.H. Stallcup M.R. J. Biol. Chem. 2001; 276: 1089-1098Abstract Full Text Full Text PDF PubMed Scopus (306) Google Scholar). It is becoming increasingly clear that most nuclear receptor coactivators reside in multiprotein complexes, and gene regulatory circuits can operate through combinatorial cofactor recruitment (21Glass C.K. Rosenfeld M.G. Genes Dev. 2000; 14: 121-141Crossref PubMed Google Scholar, 22McKenna N.J. Lanz R.B. O'Malley B.W. Endocr. Rev. 1999; 20: 321-344Crossref PubMed Scopus (1654) Google Scholar) (3Rachez C. Freedman L.P. Curr. Opin. Cell Biol. 2001; 13: 274-280Crossref PubMed Scopus (236) Google Scholar, 4Hu X. Lazar M.A. Trends Endocrinol. Metab. 2000; 11: 6-10Abstract Full Text Full Text PDF PubMed Scopus (236) Google Scholar, 5Ito M. Roeder R.G. Trends Endocrinol. Metab. 2001; 12: 127-134Abstract Full Text Full Text PDF PubMed Scopus (223) Google Scholar, 6Jones P.L. Shi Y.-B. Curr. Top. Microbiol. Immunol. 2003; 274: 237-268PubMed Google Scholar,23Jepsen K. Rosenfeld M.G. J. Cell Sci. 2002; 115: 689-698Crossref PubMed Google Scholar). Among the most studied coactivators are the steroid receptor coactivators (SRCs). The SRC family comprises three members, SRC1/NCoA-1, SRC2/TIF2/GRIP1, and SRC3/pCIP/ACTR/AIB-1/RAC-3/TRAM-1, which interact directly with the nuclear receptor ligand-binding domain via distinct receptor interaction domains containing LXXLL motifs (7Hong H. Kohli K. Trivedi A. Johnson D.L. Stallcup M.R. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 4948-4952Crossref PubMed Scopus (614) Google Scholar, 8Voegel J.J. Heine M.J. Zechel C. Chambon P. Gronemeyer H. EMBO J. 1996; 15: 3667-3675Crossref PubMed Scopus (952) Google Scholar, 9Anzick S.L. Kononen J. Walker R.L. Azorsa D.O. Tanner M.M. Guan X.Y. Sauter G. Kallioniemi O.P. Trent J.M. Meltzer P.S. Science. 1997; 277: 965-968Crossref PubMed Scopus (1432) Google Scholar, 10Chen H. Lin R.J. Schiltz R.L. Chakravarti D. Nash A. Nagy L. Privalsky M.L. Nakatani Y. Evans R.M. Cell. 1997; 90: 569-580Abstract Full Text Full Text PDF PubMed Scopus (1268) Google Scholar, 11Li H. Gomes P.J. Chen J.D. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 8479-8484Crossref PubMed Scopus (504) Google Scholar, 12Takeshita A. Cardona G.R. Koibuchi N. Suen C.S. Chin W.W. J. Biol. Chem. 1997; 272: 27629-27634Abstract Full Text Full Text PDF PubMed Scopus (325) Google Scholar, 13Torchia J. Rose D.W. Inostroza J. Kamei Y. Westin S. Glass C.K. Rosenfeld M.G. Nature. 1997; 387: 677-684Crossref PubMed Scopus (1107) Google Scholar, 14Suen C.S. Berrodin T.J. Mastroeni R. Cheskis B.J. Lyttle C.R. Frail D.E. J. Biol. Chem. 1998; 273: 27645-27653Abstract Full Text Full Text PDF PubMed Scopus (212) Google Scholar, 15Onate S.A. Tsai S.Y. Tsai M.J. O'Malley B.W. Science. 1995; 270: 1354-1357Crossref PubMed Scopus (2058) Google Scholar, 24Heery D.M. Kalkhoven E. Hoare S. Parker M.G. Nature. 1997; 387: 733-736Crossref PubMed Scopus (1772) Google Scholar, 25Ding X.F. Anderson C.M. Ma H. Hong H. Uht R.M. Kushner P.J. Stallcup M.R. Mol. Endocrinol. 1998; 12: 302-313Crossref PubMed Google Scholar, 26Voegel J.J. Heine M.J. Tini M. Vivat V. Chambon P. Gronemeyer H. EMBO J. 1998; 17: 507-519Crossref PubMed Scopus (432) Google Scholar). The SRC family can recruit other coactivators such as histone methyltransferases, PRMT1, and CARM1 (19Chen D. Ma H. Hong H. Koh S.S. Huang S.M. Schurter B.T. Aswad D.W. Stallcup M.R. Science. 1999; 284: 2174-2177Crossref PubMed Scopus (1003) Google Scholar, 20Koh S.S. Chen D.G. Lee Y.H. Stallcup M.R. J. Biol. Chem. 2001; 276: 1089-1098Abstract Full Text Full Text PDF PubMed Scopus (306) Google Scholar) or histone acetyltransferases such as p300/CBP (10Chen H. Lin R.J. Schiltz R.L. Chakravarti D. Nash A. Nagy L. Privalsky M.L. Nakatani Y. Evans R.M. Cell. 1997; 90: 569-580Abstract Full Text Full Text PDF PubMed Scopus (1268) Google Scholar, 26Voegel J.J. Heine M.J. Tini M. Vivat V. Chambon P. Gronemeyer H. EMBO J. 1998; 17: 507-519Crossref PubMed Scopus (432) Google Scholar, 27Demarest S.J. Martinez-Yamout M. Chung J. Chen H. Xu W. Dyson H.J. Evans R.M. Wright P.E. Nature. 2002; 415: 549-553Crossref PubMed Scopus (354) Google Scholar). A number of studies suggest that the SRC proteins and p300/CBP function in the same activation pathway where p300/CBP is recruited to liganded TR by the SRC proteins (28Li J. O'Malley B.W. Wong J. Mol. Cell. Biol. 2000; 20: 2031-2042Crossref PubMed Scopus (117) Google Scholar) (27Demarest S.J. Martinez-Yamout M. Chung J. Chen H. Xu W. Dyson H.J. Evans R.M. Wright P.E. Nature. 2002; 415: 549-553Crossref PubMed Scopus (354) Google Scholar, 29Sheppard H.M. Harries J.C. Hussain S. Bevan C. Heery D.M. Mol. Cell. Biol. 2001; 21: 39-50Crossref PubMed Scopus (94) Google Scholar). p300 and CBP are highly homologous proteins, often referred to as a single entity-p300/CBP. p300 and CBP possess histone acetyltransferase activity (30Ogryzko V.V. Schiltz R.L. Russanova V. Howard B.H. Nakatani Y. Cell. 1996; 87: 953-959Abstract Full Text Full Text PDF PubMed Scopus (2402) Google Scholar) and play central roles in diverse cellular processes such as cell cycle control, transformation, differentiation, and apoptosis (31Goodman R.H. Smolik S. Genes Dev. 2000; 14: 1553-1577PubMed Google Scholar, 32Giordano A. Avantaggiati M.L. J. Cell. Physiol. 1999; 181: 218-230Crossref PubMed Scopus (256) Google Scholar). Although numerous studies have addressed the roles of these coactivators in vitro, their utilization by TR and other nuclear receptors in different tissue and cell types in vivo is yet to be elucidated. Information on the functional interplay of different coactivators, especially with reference to particular genes in vivo during post-embryonic development, remains scarce. We have utilized metamorphosis in Xenopus laevis, the African clawed toad, as a model system to study the role of coactivators in TR function. Anuran metamorphosis exhibits remarkable similarity to post-embryonic development in mammals and is totally dependent on T3 (33Tata J.R. BioEssays. 1993; 15: 239-248Crossref PubMed Scopus (215) Google Scholar, 34Shi Y.-B. Amphibian Metamorphosis: From Morphology to Molecular Biology. John Wiley & Sons, Inc., New York1999Google Scholar, 35Buchholz D.R. Paul B.D. Fu L. Shi Y.B. Gen. Comp. Endocrinol. 2006; 145: 1-19Crossref PubMed Scopus (177) Google Scholar). The process involves integration of complex spatial and temporal gene regulatory networks that underlie de novo morphogenesis, remodeling, and complete regression of some organs, culminating in the transformation of an aquatic herbivorous tadpole to a terrestrial carnivorous frog. The metamorphic effects of T3 are essentially all mediated by TR (35Buchholz D.R. Paul B.D. Fu L. Shi Y.B. Gen. Comp. Endocrinol. 2006; 145: 1-19Crossref PubMed Scopus (177) Google Scholar, 36Buchholz D.R. Hsia V.S.-C. Fu L. Shi Y.-B. Mol. Cell. Biol. 2003; 23: 6750-6758Crossref PubMed Scopus (106) Google Scholar, 37Schreiber A.M. Das B. Huang H. Marsh-Armstrong N. Brown D.D. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 10739-10744Crossref PubMed Scopus (151) Google Scholar, 38Buchholz D.R. Tomita A. Fu L. Paul B.D. Shi Y.-B. Mol. Cell. Biol. 2004; 24: 9026-9037Crossref PubMed Scopus (115) Google Scholar). The system affords an added advantage in that the process can be induced by adding exogenous T3 to the tadpole-rearing water or blocked by using specific inhibitors of T3 synthesis (34Shi Y.-B. Amphibian Metamorphosis: From Morphology to Molecular Biology. John Wiley & Sons, Inc., New York1999Google Scholar, 39Dodd M.H.I. Dodd J.M. Lofts B. The Biology of Metamorphosis. Academic Press, New York1976: 467-599Google Scholar). Moreover, tadpoles are free-living and thus their development is not complicated by maternal influences. To correlate gene expression and function with metamorphic transformations, we have focused our studies by using intestinal remodeling as a model. The premetamorphic tadpole intestine is a very simple tubular organ made of mostly a single monolayer of larval epithelial cells surrounded by sparse connective tissue and muscles (40Shi Y.-B. Ishizuya-Oka A. Curr. Top. Dev. Biol. 1996; 32: 205-235Crossref PubMed Google Scholar). During metamorphosis, essentially all larval epithelial cells die and are eventually replaced by adult epithelial cells developed de novo. Concurrently, connective tissue and muscles also develop extensively. Thus, during the early stage of intestinal remodeling (the first few days of T3 treatment of premetamorphic tadpoles or natural metamorphosis), the entire organ behaves largely as a single cell type, the larval epithelial cells, making it possible to carry out molecular analysis of gene regulation mechanisms in vivo. Using this model system, we have shown earlier that the steroid receptor coactivator SRC3 is up-regulated during metamorphosis (41Paul B.D. Shi Y.-B. Cell Res. 2003; 13: 459-464Crossref PubMed Scopus (32) Google Scholar, 42Paul B.D. Fu L. Buchholz D.R. Shi Y.-B. Mol. Cell. Biol. 2005; 25: 5712-5724Crossref PubMed Scopus (59) Google Scholar) and is recruited to T3-responsive promoters in a geneand tissue-dependent manner (43Paul B.D. Buchholz D.R. Fu L. Shi Y.-B. J. Biol. Chem. 2005; 280: 27165-27172Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar). More importantly, transgenic expression of a dominant negative SRC3 containing only the TR-interacting domain inhibits T3-dependent gene expression and metamorphosis, demonstrating an essential role for coactivator recruitment in this post-embryonic process. Because the dominant negative SRC3 blocks all coactivator binding to liganded TR, it remains possible that coactivators other than SRC family members play the essential role in gene regulation by TR and metamorphosis. To determine whether and how SRCs participate in metamorphosis, we have investigated here the role of SRC-binding protein p300 during metamorphosis. We have shown here that Xenopus p300 is recruited to T3-responsive promoters in a T3-dependent manner. Furthermore, using a dominant negative form of p300 that contains only the SRC-binding domain, we have demonstrated an essential role of p300·SRC complex or related complexes in gene regulation by TR and metamorphosis. Constructs—A dominant negative form of p300, F-dnp300, comprising the SRC interaction domain of X. laevis p300 (amino acids 1995–2166) (44Fujii G. Tsuchiya R. Itoh Y. Tashiro K. Hirohashi S. Biochim. Biophys. Acta. 1998; 1443: 41-54Crossref PubMed Scopus (13) Google Scholar), was amplified by reverse transcription (RT)-PCR from total RNA isolated from stage 54 X. laevis tadpoles using primers designed to incorporate a FLAG tag and cloned into pCRT7NTTOPO vector (Invitrogen), which has the Xpress and His tags. The clone was verified by sequencing. Next, the p300 fragment was digested with NdeI (filled in with Klenow polymerase) and EcoRI and subcloned into the BglII (filled in with Klenow) and EcoRI sites of the vector pT7Ts under the control of the T7 promoter. This construct has the 5′- and 3′-UTR of the β globin gene and was used for generating mRNA for the oocyte microinjection experiments. For verifying the specificity of the anti-p300 antibody by using in vitro translation followed by Western blotting, a construct encoding a p300 fragment containing the peptide TLPQVAVQNLLRALRSP, which was used for immunization, was amplified using RT-PCR from total RNA using the forward and reverse primers 5′-ATGAACCCAATGCCGCCCATAGGA-3′ and 5′-CTAGGAAATAGGGGGCTGTTGTGG-3′, respectively, and cloned into pCRT7TOPO-NT vector (Invitrogen). For transgenesis, the F-dnp300 transgene was placed under the control of the constitutive cytomegalovirus promoter in the vector pCGCG (45Fu L. Buchholz D. Shi Y.-B. Mol. Reprod. Dev. 2002; 62: 470-476Crossref PubMed Scopus (60) Google Scholar), replacing the original green fluorescent protein (GFP) fragment at this location, resulting in the double promoter construct pCF-dnp300CG, which also has the gene for GFP driven by the eye lens-specific γ-crystallin promoter to facilitate the identification of transgenic animals. Antibodies—The anti-acetylated histone H4 antibody was purchased from Upstate Cell Signaling Solutions. The anti-FLAG M2 antibody was from Sigma. The anti-TR antibodies were described earlier (46Wong J. Shi Y.-B. J. Biol. Chem. 1995; 270: 18479-18483Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar, 47Buchholz D.R. Paul B.D. Shi Y.B. J. Biol. Chem. 2005; 280: 41222-41228Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar). The anti-p300 polyclonal antibodies were generated by coinjecting two peptides derived from X. laevis p300, TLPQVAVQNLLRALRSP (multiple antigenic peptide-conjugated) and QPSPHHVSPQTSSPHPGLVGP (keyhole limpet hemocyanin-conjugated) into rabbits (Invitrogen). For the chromatin immunoprecipitation (ChIP) assays performed to study the recruitment of wild type p300 in wild type and transgenic animals, we used affinity-purified polyclonal antibodies generated against the peptides KSEPVELEEKKEEVKTE (amino acids 1033–1049) and KPKRLQEWYKKMLDKSVSER (amino acids 1487–1506) (48Havis E. Sachs L.M. Demeneix B.A. EMBO Rep. 2003; 4: 883-888Crossref PubMed Scopus (55) Google Scholar, 49Huang Z.-Q. Li J. Sachs L.M. Cole P.A. Wong J. EMBO J. 2003; 22: 2146-2155Crossref PubMed Scopus (165) Google Scholar). Animals and Treatment—Wild type tadpoles of the African clawed toad X. laevis were obtained from Xenopus I, Inc. (Dexter, MI), and developmental stages were determined according to Nieuwkoop and Faber (50Nieuwkoop P.D. Faber J. Normal Table of Xenopus laevis.1st Ed. North Holland Publishing, Amsterdam1956Google Scholar). Adult female frogs used for oocyte preparation were obtained from NASCO (Fort Atkinson, WI). Stage 54 premetamorphic tadpoles at a density of 2 tadpoles/liter of dechlorinated water were treated with the indicated amount of T3 for 2–3 days. Histological Analysis of the Intestine—The intestines of the tadpoles were dissected out and fixed for 2 h at room temperature in 4% paraformaldehyde and 60% phosphate-buffered saline, cryoprotected in 0.5 m sucrose in 60% phosphate-buffered saline, and embedded in O.C.T. compound (TissueTek). The intestines were sectioned in a cryotome at 7.5 μm. Sections were visualized using methyl green pyronin Y (Muto, Tokyo, Japan) (51Ishizuya-Oka A. Li Q. Amano T. Damjanovski S. Ueda S. Shi Y.-B. J. Cell Biol. 2000; 150: 1177-1188Crossref PubMed Scopus (104) Google Scholar). Oocyte Injections and Luciferase Assays—pSP64-TR, pSP64-RXR (46Wong J. Shi Y.-B. J. Biol. Chem. 1995; 270: 18479-18483Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar), and T7Ts-FLAG-dnp300 were used to synthesize, in vitro, the corresponding mRNAs with the T7 or SP6 in vitro transcription kit (mMESSAGE mMACHINE, Ambion). The mRNA (5.75 ng/oocyte) was microinjected into the cytoplasm of 20 X. laevis stage-VI oocytes. The reporter plasmid DNA (0.33 ng/oocyte), which contained the T3-dependent TRβA promoter driving the expression of the firefly luciferase (52Amano T. Leu K. Yoshizato K. Shi Y.-B. Dev. Dyn. 2002; 223: 526-535Crossref PubMed Scopus (27) Google Scholar) was injected into the oocyte nucleus together with a control construct that contained the Herpes simplex tk promoter driving the expression of the Renilla luciferase (Promega, WI) (0.03 ng/oocyte). Following incubation overnight at 18 °C in the absence or presence of 100 nm T3, the oocytes were prepared for luciferase assay using the Dual-Luciferase reporter assay system (Promega, WI) according to the manufacturer's recommendations. RNA Isolation and RT-PCR—RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer's recommendations. RT-PCRs were carried out using the Superscript One-Step RT-PCR kit (Invitrogen). The expression of the ribosomal protein L8 (rpl8) was used as an internal control (53Shi Y.-B. Liang V.C.-T. Biochim. Biophys. Acta. 1994; 1217: 227-228Crossref PubMed Scopus (117) Google Scholar). The sequences of the primers used were (5′-3′): CGTGGTGCTCCTCTTGCCAAG and GACGACCAGTACGACGAGCAG for rpl8 (53Shi Y.-B. Liang V.C.-T. Biochim. Biophys. Acta. 1994; 1217: 227-228Crossref PubMed Scopus (117) Google Scholar), CACTTAGCAACAGGGATCAGC and CTTGTCCCAGTAGCAATCATC for T3/bZIP (54Furlow J.D. Brown D.D. Mol. Endocrinol. 1999; 13: 2076-2089Crossref PubMed Scopus (78) Google Scholar), and ATAGTTAATGCGCCCGAGGGTGGA and CTTTTCTATTCTCTCCACGCTAGC for TRβA (55Yaoita Y. Shi Y.B. Brown D.D. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 7090-7094Crossref PubMed Scopus (158) Google Scholar). PCR was also done on RNA samples without reverse transcription as a control for genomic DNA contamination (data not shown). 0.5 μg of total RNA was used in a 25-μl reaction and with the following reaction conditions: 42 °C for 30 min for the RT reaction followed by 21–25 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s. The resulting products were analyzed on an agarose gel stained with ethidium bromide. Preparation of Tadpole Tissues for Western Blot Analysis— Tadpoles were sacrificed by decapitation on ice. The dissected organs were sliced into small pieces and homogenized in buffer containing 50 mm Tris-HCl, pH 8.0, 1% SDS, 1 mm dithiothreitol and protease inhibitor mixture (Roche Diagnostics). The lysate was centrifuged at 11,000 × g for 5 min, and the protein in the supernatant was quantitated by Bradford assay (Bio-Rad). Equal amounts of protein were loaded on an 8–16% Tris-glycine gel (Invitrogen) and transferred onto a polyvinylidene difluoride membrane for Western blot analysis. Chromatin Immunoprecipitation Assays—ChIP assays using oocytes and tissues from tadpoles was performed as described previously (56Tomita A. Buchholz D.R. Shi Y.-B. Mol. Cell. Biol. 2004; 24: 3337-3346Crossref PubMed Scopus (96) Google Scholar). The following antibodies were used in the assay: anti-Xenopus TR (46Wong J. Shi Y.-B. J. Biol. Chem. 1995; 270: 18479-18483Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar), anti-acetylated histone H4 (Upstate Cell Signaling Solutions, Lake Placid, NY), and anti-Xenopus p300. After reverse cross-linking, DNA was purified using a PCR purification kit (Qiagen). Quantitative PCR was carried out with a ChIP DNA sample in duplicate on an ABI 7000 (Applied Biosystems) using promoter-specific primers and FAM (6-carboxyfluorescein)-labeled TaqMan probes (Applied Biosystems) (38Buchholz D.R. Tomita A. Fu L. Paul B.D. Shi Y.-B. Mol. Cell. Biol. 2004; 24: 9026-9037Crossref PubMed Scopus (115) Google Scholar). To ensure the validity of the PCR, for each assay, six 2-fold serial dilutions from a large batch of ChIP input DNA, prepared from intestines isolated especially for the purpose of serving as standards, were used for the quantification of the experimental samples. The calculated standard curves ranged in slope from -3.30 to -3.50, where theoretical amplification has a slope of -3.32. Also included was a no-template control where double-distilled water was added instead of sample DNA as a control for PCR product contamination. Results from the experimental samples were within the range of the standard curve (not shown). The primers used for the quantitative PCR were (5′-3′): CCCCTATCCTTGTTCGTCCTC and GCGCTGGGCTGTCCT, for the TRE region of the TRβA promoter and GGACGCACTAGGGTTAAGTAAGG and TCTCCCAACCCTACAGAGTTCAA for the TRE region of the T3/bZIP promoter. The FAM-labeled probes were (5′-3′) CCTAGGCAGGTCATTTC and ATGAGGCTGAGCATTCA for the TRβA and the T3/bZIP promoters, respectively. p300 Is Recruited to Target Promoters in the Tadpole Intestine upon T3 Treatment of Premetamorphic Tadpoles—We have previously shown that p300 is constitutively expressed in whole tadpoles as well as in the intestine and tail throughout metamorphosis (41Paul B.D. Shi Y.-B. Cell Res. 2003; 13: 459-464Crossref PubMed Scopus (32) Google Scholar). To investigate whether p300 is utilized by TR during intestinal remodeling, we generated a polyclonal antibody against two peptides of the X. laevis p300 (Fig. 1A) and used it for ChIP assay to determine the association of p300 with T3 target genes in vivo. For this purpose, we treated premetamorphic tadpoles at stage 54 with 10 nm T3 for 2 days at room temperature, a condition known to induce metamorphosis (34Shi Y.-B. Amphibian Metamorphosis: From Morphology to Molecular Biology. John Wiley & Sons, Inc., New York1999Google Scholar, 39Dodd M.H.I. Dodd J.M. Lofts B. The Biology of Metamorphosis. Academic Press, New York1976: 467-599Google Scholar). Intestinal nuclei were isolated and subjected to ChIP assays using antibodies against p300, TR, or acetylated histone H4. The binding of p300 to two T3-responsive promoters, TRβA and T3/bZIP, was analyzed. As shown in Fig. 1B, Xenopus p300 was found to be recruited in a ligand-dependent manner to both promoters in the intestine. As a positive control for the ChIP assay, we showed that the levels of histone H4 acetylation, a marker associated with gene activation, was enhanced in T3-treated animals at both promoters (Fig. 1B), as seen in our earlier reports (42Paul B.D. Fu L. Buchholz D.R. Shi Y.-B. Mol. Cell. Biol. 2005; 25: 5712-5724Crossref PubMed Scopus (59) Google Scholar, 43Paul B.D. Buchholz D.R. Fu L. Shi Y.-B. J. Biol. Chem. 2005; 280: 27165-27172Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar, 57Sachs L.M. Shi Y.-B. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 13138-13143Crossref PubMed Scopus (105) Google Scholar). Similarly, TR was bound to both promoters with its binding to the T3/bZIP promoter increased after T3 treatment, again in agreement with earlier findings (47Buchholz D.R. Paul B.D. Shi Y.B. J. Biol. Chem. 2005; 280: 41222-41228Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar, 57Sachs L.M. Shi Y.-B. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 13138-13143Crossref PubMed Scopus (105) Google Scholar). These results suggest that p300 plays a role in T3-signaling events during metamorphosis by participating in gene regulation by TR. Generation of a Dominant Negative Form of p300 to Inhibit T3-induced Transcription—To study the role of p300 in the TR-signaling cascade during development, we reasoned that a dominant negative form of p300 targeting gene regulation by TR should interfere with gene regulation by TR whe" @default.
• W2116335096 created "2016-06-24" @default.
• W2116335096 creator A5006367625 @default.
• W2116335096 creator A5019535811 @default.
• W2116335096 creator A5084386970 @default.
• W2116335096 creator A5084792810 @default.
• W2116335096 date "2007-03-01" @default.
• W2116335096 modified "2023-10-16" @default.
• W2116335096 title "SRC-p300 Coactivator Complex Is Required for Thyroid Hormone-induced Amphibian Metamorphosis" @default.
• W2116335096 cites W1493268813 @default.
• W2116335096 cites W1501286679 @default.
• W2116335096 cites W1598045648 @default.
• W2116335096 cites W1613446635 @default.
• W2116335096 cites W1884928119 @default.
• W2116335096 cites W1952721216 @default.
• W2116335096 cites W1967632442 @default.
• W2116335096 cites W1970569586 @default.
• W2116335096 cites W1971657931 @default.
• W2116335096 cites W1975664461 @default.
• W2116335096 cites W1975979895 @default.
• W2116335096 cites W1977605714 @default.
• W2116335096 cites W1977854547 @default.
• W2116335096 cites W1981022538 @default.
• W2116335096 cites W1981474173 @default.
• W2116335096 cites W1985063313 @default.
• W2116335096 cites W1989024959 @default.
• W2116335096 cites W1990939350 @default.
• W2116335096 cites W1996890755 @default.
• W2116335096 cites W2004988279 @default.
• W2116335096 cites W2010912571 @default.
• W2116335096 cites W2011119018 @default.
• W2116335096 cites W2017318922 @default.
• W2116335096 cites W2021768020 @default.
• W2116335096 cites W2022110250 @default.
• W2116335096 cites W2028725230 @default.
• W2116335096 cites W2029848568 @default.
• W2116335096 cites W2034312179 @default.
• W2116335096 cites W2039576757 @default.
• W2116335096 cites W2040748502 @default.
• W2116335096 cites W2043456039 @default.
• W2116335096 cites W2052267280 @default.
• W2116335096 cites W2056806829 @default.
• W2116335096 cites W2056978878 @default.
• W2116335096 cites W2060128629 @default.
• W2116335096 cites W2061619516 @default.
• W2116335096 cites W2062809474 @default.
• W2116335096 cites W2064956340 @default.
• W2116335096 cites W2064978270 @default.
• W2116335096 cites W2068113812 @default.
• W2116335096 cites W2071533492 @default.
• W2116335096 cites W2073133361 @default.
• W2116335096 cites W2078662624 @default.
• W2116335096 cites W2082608117 @default.
• W2116335096 cites W2089029040 @default.
• W2116335096 cites W2092722802 @default.
• W2116335096 cites W2095217266 @default.
• W2116335096 cites W2096594220 @default.
• W2116335096 cites W2100697656 @default.
• W2116335096 cites W2102893132 @default.
• W2116335096 cites W2108723275 @default.
• W2116335096 cites W2112977087 @default.
• W2116335096 cites W2116726266 @default.
• W2116335096 cites W2139222706 @default.
• W2116335096 cites W2139389480 @default.
• W2116335096 cites W2143241514 @default.
• W2116335096 cites W2144829665 @default.
• W2116335096 cites W2145343004 @default.
• W2116335096 cites W2148731017 @default.
• W2116335096 cites W2154005091 @default.
• W2116335096 cites W2156362611 @default.
• W2116335096 cites W2156575042 @default.
• W2116335096 cites W2158268923 @default.
• W2116335096 cites W2158766991 @default.
• W2116335096 cites W2163686317 @default.
• W2116335096 cites W2166439602 @default.
• W2116335096 cites W2170440703 @default.
• W2116335096 cites W2172032447 @default.
• W2116335096 cites W2172256092 @default.
• W2116335096 cites W2188737084 @default.
• W2116335096 cites W89196381 @default.
• W2116335096 doi "https://doi.org/10.1074/jbc.m607589200" @default.
• W2116335096 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17218308" @default.
• W2116335096 hasPublicationYear "2007" @default.
• W2116335096 type Work @default.
• W2116335096 sameAs 2116335096 @default.
• W2116335096 citedByCount "47" @default.
• W2116335096 countsByYear W21163350962012 @default.
• W2116335096 countsByYear W21163350962013 @default.
• W2116335096 countsByYear W21163350962014 @default.
• W2116335096 countsByYear W21163350962015 @default.
• W2116335096 countsByYear W21163350962016 @default.
• W2116335096 countsByYear W21163350962017 @default.
• W2116335096 countsByYear W21163350962018 @default.
• W2116335096 countsByYear W21163350962019 @default.
• W2116335096 countsByYear W21163350962020 @default.
• W2116335096 countsByYear W21163350962021 @default.
• W2116335096 countsByYear W21163350962022 @default.
• W2116335096 countsByYear W21163350962023 @default.

• next