FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2116780321> ?p ?o ?g. }

• W2116780321 endingPage "27435" @default.
• W2116780321 startingPage "27426" @default.
• W2116780321 abstract "CITED1 is the founding member of the CITED family of cofactors that are involved in regulating a wide variety of CBP/p300-dependent transcriptional responses. In the present study, we show that the phosphorylation status of CITED1 changes during the cell cycle and affects its transcriptional cofactor activity. Tryptic mapping and mutagenesis studies identified five phosphorylated serine residues in CITED1. Phosphorylation of these residues did not affect CRM1-dependent nuclear export, but did decrease CITED1 binding to p300 and inhibited CITED1-dependent transactivation of Smad4 and p300. These results suggest that CITED1 functions as a cell cycle-dependent transcriptional cofactor whose activity is regulated by phosphorylation. CITED1 is the founding member of the CITED family of cofactors that are involved in regulating a wide variety of CBP/p300-dependent transcriptional responses. In the present study, we show that the phosphorylation status of CITED1 changes during the cell cycle and affects its transcriptional cofactor activity. Tryptic mapping and mutagenesis studies identified five phosphorylated serine residues in CITED1. Phosphorylation of these residues did not affect CRM1-dependent nuclear export, but did decrease CITED1 binding to p300 and inhibited CITED1-dependent transactivation of Smad4 and p300. These results suggest that CITED1 functions as a cell cycle-dependent transcriptional cofactor whose activity is regulated by phosphorylation. The CITED family of transcriptional cofactors consists of four members (CITED1-4, CITED1, -2, and -4 in mammals) that regulate diverse CBP/p300-dependent transcriptional responses (1Ng P.K. Wu R.S. Zhang Z.P. Mok H.O. Randall D.J. Kong R.Y. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2003; 136: 163-172Crossref PubMed Scopus (7) Google Scholar, 2Andrews J.E. O'Neill M.J. Binder M. Shioda T. Sinclair A.H. Mech. Dev. 2000; 95: 305-308Crossref PubMed Scopus (15) Google Scholar, 3Gawantka V. Pollet N. Delius H. Vingron M. Pfister R. Nitsch R. Blumenstock C. Niehrs C. Mech. Dev. 1998; 77: 95-141Crossref PubMed Scopus (167) Google Scholar, 4Bhattacharya S. Michels C.L. Leung M.K. Arany Z.P. Kung A.L. Livingston D.M. Genes Dev. 1999; 13: 64-75Crossref PubMed Scopus (316) Google Scholar, 5Braganca J. Eloranta J.J. Bamforth S.D. Ibbitt J.C. Hurst H.C. Bhattacharya S. J. Biol. Chem. 2003; 278: 16021-16029Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar, 6Braganca J. Swingler T. Marques F.I. Jones T. Eloranta J.J. Hurst H.C. Shioda T. Bhattacharya S. J. Biol. Chem. 2002; 277: 8559-8565Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar, 7Yahata T. Takedatsu H. Dunwoodie S.L. Braganca J. Swingler T. Withington S.L. Hur J. Coser K.R. Isselbacher K.J. Bhattacharya S. Shioda T. Genomics. 2002; 80: 601-613Crossref PubMed Scopus (34) Google Scholar, 8Tien E.S. Davis J.W. Vanden Heuvel J.P. J. Biol. Chem. 2004; 279: 24053-24063Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar, 9Fox S.B. Braganca J. Turley H. Campo L. Han C. Gatter K.C. Bhattacharya S. Harris A.L. Cancer Res. 2004; 64: 6075-6081Crossref PubMed Scopus (52) Google Scholar, 10Glenn D.J. Maurer R.A. J. Biol. Chem. 1999; 274: 36159-36167Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar, 11Shioda T. Fenner M.H. Isselbacher K.J. Gene (Amst.). 1997; 204: 235-241Crossref PubMed Scopus (50) Google Scholar, 12Yahata T. de Caestecker M.P. Lechleider R.J. Andriole S. Roberts A.B. Isselbacher K.J. Shioda T. J. Biol. Chem. 2000; 275: 8825-8834Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar, 13Yahata T. Shao W. Endoh H. Hur J. Coser K.R. Sun H. Ueda Y. Kato S. Isselbacher K.J. Brown M. Shioda T. Genes Dev. 2001; 15: 2598-2612Crossref PubMed Scopus (93) Google Scholar, 14Shioda T. Fenner M.H. Isselbacher K.J. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 12298-12303Crossref PubMed Scopus (80) Google Scholar). CITED1 is expressed in a variety of embryonic tissues including the heart, limb buds, hepatic primordia, and developing kidney (15Plisov S. Tsang M. Shi G. Boyle S. Yoshino K. Dunwoodie S.L. Dawid I.B. Shioda T. Perantoni A.O. de Caestecker M.P. J. Am. Soc. Nephrol. 2005; 16: 1632-1644Crossref PubMed Scopus (53) Google Scholar, 16Dunwoodie S.L. Rodriguez T.A. Beddington R.S. Mech. Dev. 1998; 72: 27-40Crossref PubMed Scopus (141) Google Scholar). In the adult, CITED1 is expressed at high levels in papillary carcinoma of the thyroid gland (17Prasad M.L. Pellegata N.S. Kloos R.T. Barbacioru C. Huang Y. de la Chapelle A. Thyroid. 2004; 14: 169-175Crossref PubMed Scopus (45) Google Scholar, 18Prasad M.L. Pellegata N.S. Huang Y. Nagaraja H.N. de la Chapelle A. Kloos R.T. Mod. Pathol. 2005; 18: 48-57Crossref PubMed Scopus (235) Google Scholar), malignant melanoma (19Li H. Ahmed N.U. Fenner M.H. Ueda M. Isselbacher K.J. Shioda T. Exp. Cell Res. 1998; 242: 478-486Crossref PubMed Scopus (25) Google Scholar, 20Sedghizadeh P.P. Williams J.D. Allen C.M. Prasad M.L. Med. Sci. Monit. 2005; 11: BR189-BR194PubMed Google Scholar), and Wilms tumor (21Lovvorn H. N. B.S. Shi G. Shyr Y. Perantoni A. de Caestecker M.P. J. Pediatric Surg. 2006; Google Scholar), suggesting that it may play a role in the pathogenesis of certain tumors. Studies using CITED1 knock-out mice indicate that its expression in the extra-embryonic trophectoderm plays an essential role in regulating normal placental development (22Rodriguez T.A. Sparrow D.B. Scott A.N. Withington S.L. Preis J.I. Michalicek J. Clements M. Tsang T.E. Shioda T. Beddington R.S. Dunwoodie S.L. Mol. Cell. Biol. 2004; 24: 228-244Crossref PubMed Scopus (67) Google Scholar), whereas expression in the mammary gland is required for growth and branching of mammary epithelium at puberty (23Howlin J. McBryan J. Napoletano S. Lambe T. McArdle E. Shioda T. Martin F. Oncogene. 2006; 25: 1532-1542Crossref PubMed Scopus (37) Google Scholar). Biochemical studies indicate that CITED1 selectively enhances transcriptional responses involving TGF-β 4The abbreviations used are: TGF-β, transforming growth factor β; FBS, fetal bovine serum; NES, nuclear export signal; HEK, human embryonic kidney; DMEM, Dulbecco's modified Eagle's medium; GFP, green fluorescent protein; CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid; BisTris, 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol.4The abbreviations used are: TGF-β, transforming growth factor β; FBS, fetal bovine serum; NES, nuclear export signal; HEK, human embryonic kidney; DMEM, Dulbecco's modified Eagle's medium; GFP, green fluorescent protein; CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid; BisTris, 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol./Smad4 and estrogen receptor-α, whereas it inhibits Wnt/β-catenin-dependent responses (12Yahata T. de Caestecker M.P. Lechleider R.J. Andriole S. Roberts A.B. Isselbacher K.J. Shioda T. J. Biol. Chem. 2000; 275: 8825-8834Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar, 13Yahata T. Shao W. Endoh H. Hur J. Coser K.R. Sun H. Ueda Y. Kato S. Isselbacher K.J. Brown M. Shioda T. Genes Dev. 2001; 15: 2598-2612Crossref PubMed Scopus (93) Google Scholar, 15Plisov S. Tsang M. Shi G. Boyle S. Yoshino K. Dunwoodie S.L. Dawid I.B. Shioda T. Perantoni A.O. de Caestecker M.P. J. Am. Soc. Nephrol. 2005; 16: 1632-1644Crossref PubMed Scopus (53) Google Scholar). These effects are dependent on interactions between CITED1 and CBP/p300, but the molecular mechanisms regulating CITED1-dependent transactivation have not been elucidated. In these studies we show that CITED1 exists in both an unphosphorylated and at least two phosphorylated forms, and that levels of both phosphoproteins are independently regulated over the course of the cell cycle. Mapping and functional evaluation of the dominant phosphorylated form of CITED1 found in interphase cells indicates that phosphorylation reduces CITED1-dependent transactivation of Smad4 and p300. This occurs without affecting the normal process of CRM1-dependent nuclear export, but is associated with decreased binding of CITED1 to p300. These findings indicate that the transcriptional activity of CITED1 is regulated by phosphorylation in a cell cycle-dependent manner. Cell Lines and Cell Cycle Synchronization—Human embryonic kidney (HEK) 293, human breast cancer MCF7, and the HepG2 hepatocellular carcinoma cells were obtained from the American Type Culture Collection, and B16-F1 murine melanoma cells were obtained from Isaiah Fidler (24Fidler I.J. Nat. New Biol. 1973; 242: 148-149Crossref PubMed Scopus (1265) Google Scholar). NPA187 human papillary thyroid carcinoma cells were obtained from Guy Juillard, UCLA (25Younes M.N. Kim S. Yigitbasi O.G. Mandal M. Jasser S.A. Dakak Yazici Y. Schiff B.A. El-Naggar A. Bekele B.N. Mills G.B. Myers J.N. Mol. Cancer Ther. 2005; 4: 1146-1156Crossref PubMed Scopus (73) Google Scholar). All cell lines were cultured at 37 °C and 5% CO2 in DMEM supplemented with 10% fetal bovine serum (FBS). HEK-293 cells were grown on plasticware coated with type 1 collagen (Rat tail, BD Biosciences) to increase adherence. Stable overexpression of FLAG-tagged CITED1 and the CITED1 S5A and S5E mutants in pcDNA3 (Invitrogen) or pEGFP-CITED1 (Clontech) was produced by transfection of the respective expression plasmids into HEK-293 and selection with 400 μg/ml G418. These are referred to as HEK-CITED1 or HEK-GFP CITED1 cells, respectively. For cell cycle studies, cells were synchronized in G0 by culturing for 48 h in serumfree medium (DMEM with 0.1% bovine serum albumin) (>70% G0/G1) and S-phase by double thymidine block (>70% cells in S). After release from thymidine, block cells were blocked in M-phase by treatment with 100 nm nocodazole (Sigma) overnight (>90% G2/M-phase), as described (26Harper J.V. Methods Mol. Biol. 2005; 296: 157-166PubMed Google Scholar). Efficiency of cell cycle block was evaluated in preliminary studies by flow cytometry using propidium iodide staining, as described (27Robinson J.P. Current Protocols in Cytometry. John Wiley & Sons, New York1997: 7.5.1Google Scholar). For M-phase release, loosely adherent mitotic cells were collected after gently tapping the plate, washed three times in phosphate-buffered saline and released from M-phase in DMEM with 10% FBS for various times, as indicated. The protein phosphatase inhibitor, okadaic acid (Calbiochem), was added to the cells at 10 nm concentration for the last 2 h after overnight treatment with nocodazole. Expression Plasmids and Transcriptional Response Assays—Amino-terminal FLAG-tagged human CITED1 in pcDNA3 and the Gal4 DNA binding Smad4-(266-552) fusion protein in pSG424 were generated in our laboratory (15Plisov S. Tsang M. Shi G. Boyle S. Yoshino K. Dunwoodie S.L. Dawid I.B. Shioda T. Perantoni A.O. de Caestecker M.P. J. Am. Soc. Nephrol. 2005; 16: 1632-1644Crossref PubMed Scopus (53) Google Scholar, 28de Caestecker M.P. Yahata T. Wang D. Parks W.T. Huang S. Hill C.S. Shioda T. Roberts A.B. Lechleider R.J. J. Biol. Chem. 2000; 275: 2115-2122Abstract Full Text Full Text PDF PubMed Scopus (143) Google Scholar); the p5E1B-Luc Gal4 reporter construct was provided by Jeff Wrana (29Hayashi H. Abdollah S. Qiu Y. Cai J. Xu Y.Y. Grinnell B.W. Richardson M.A. Topper J.N. Gimbrone M.A. Wrana J.L. Falb D. Cell. 1997; 89: 1165-1173Abstract Full Text Full Text PDF PubMed Scopus (1145) Google Scholar), and the full-length Gal4-p300 fusion protein construct obtained from Neil Perkins (30Snowden A.W. Anderson L.A. Webster G.A. Perkins N.D. Mol. Cell. Biol. 2000; 20: 2676-2686Crossref PubMed Scopus (112) Google Scholar). Serine to alanine (Ser → Ala) or glutamic acid (Ser → Glu) mutations at residues 16, 63, 67, 71, and 137 were generated sequentially using a PCR-based site-directed mutagenesis kit (Stratagene) on the FLAG-tagged human CITED1 expression plasmid, using primer sets shown in Table 1. Sequence changes were confirmed by dideoxynucleotide sequencing. Transient transfection assays were performed on HEK-293 cells using Lipofectamine (Invitrogen), with transfection efficiency evaluated by cotransfecting with constitutively expressed pSVβ-galactosidase vector and subsequent enzyme activity assay. Transcriptional response assays were performed by cotransfecting the p5E1B-Luc Gal4 reporter construct with the Gal4 Smad4 or p300 fusion proteins, along with the FLAG-tagged CITED1 expression constructs, as previously described (15Plisov S. Tsang M. Shi G. Boyle S. Yoshino K. Dunwoodie S.L. Dawid I.B. Shioda T. Perantoni A.O. de Caestecker M.P. J. Am. Soc. Nephrol. 2005; 16: 1632-1644Crossref PubMed Scopus (53) Google Scholar, 28de Caestecker M.P. Yahata T. Wang D. Parks W.T. Huang S. Hill C.S. Shioda T. Roberts A.B. Lechleider R.J. J. Biol. Chem. 2000; 275: 2115-2122Abstract Full Text Full Text PDF PubMed Scopus (143) Google Scholar). Cells were washed after 4 - 6 h, allowed to recover for 24 h in growth medium, serum-starved, and treated for 18 h with or without 10 ng/ml TGF-β1 (R&D Systems). Luciferase and β-galactosidase activities in the cell lysates were determined, and luciferase activities were normalized for β-galactosidase expression to correct for transfection efficiency, as described (31de Caestecker M.P. Hemmati P. Larisch-Bloch S. Ajmera R. Roberts A.B. Lechleider R.J. J. Biol. Chem. 1997; 272: 13690-13696Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar). All assays were performed in triplicate and values represented as mean ± S.E. of three independent transfections. Experiments were repeated twice with similar results. Expression of FLAG-tagged CITED1 mutants in the same cell lysates was determined by Western blot using M2 anti-FLAG monoclonal antibody (Sigma).TABLE 1Primers used for site-directed mutagenesis of CITED1CITED1 mutationForwardReverseS16AGTCAAGGGTGGCACCGCACCTGCGAAGGAGCTCCTTCGCAGGTGCGGTGCCACCCTTGACS16ECAAGGGTGGCACCGAACCTGCGAAGCTTCGCAGGTTCGGTGCCACCCTTGS63AGTGGGGCTCCCACTGCTTCCTCGGGATCTAGATCCCGAGGAAGCAGTGGGAGCCCCACS63EGTGGGGCTCCCACTGAATCCTCGGGATCTAGATCCCGAGGATTCAGTGGGAGCCCCACS67ACTAGTTCCTCGGGAGCTCCAATAGGCTCTCGAGAGCCTATTGGAGCTCCCGAGGAACTAGS67EGTTCCTCGGGAGAACCAATAGGCTCTCGAGAGCCTATTGGTTCTCCCGAGGAACS71ACCAATAGGCTCTCCTACAACCACCGGTGGTTGTAGGAGAGCCTATTGGS71ECCAATAGGCGAACCTACAACCGGTTGTAGGTTCGCCTATTGGS137AGCAGAATCACTCGCTCCTTCTGCTGGTGCACCAGCAGAAGGAGCGAGTGATTCTGCS137EGCAGAATCACTCGAACCTTCTGCTGGTCACCAGCAGAAGGTTCGAGTGATTCTG Open table in a new tab Western Blot and Two-dimensional Gel Electrophoresis—Western blots were performed after separating lysates and/or immunoprecipitated proteins by SDS-PAGE and transfer to polyvinylidene difluoride membranes using anti-CITED1 mouse monoclonal antibody clone 2H6 (15Plisov S. Tsang M. Shi G. Boyle S. Yoshino K. Dunwoodie S.L. Dawid I.B. Shioda T. Perantoni A.O. de Caestecker M.P. J. Am. Soc. Nephrol. 2005; 16: 1632-1644Crossref PubMed Scopus (53) Google Scholar), mouse anti-p300 (Upstate, clone RW128), or mouse anti-β-actin (Sigma, clone AC74), as indicated. For two-dimensional gel electrophoresis, HEK-CITED1 immunoprecipitates were treated with or without alkaline phosphatase (as outlined below), and resuspended in 8 m urea buffer (8 m urea, 1% CHAPS, 20 mm dithiothreitol) with 0.5% ampholytes (Bio-Rad, Ready Strip buffer pH 3.9 - 5.1). These were separated in the first dimension by isoelectric focusing using a non-linear, immobilized pH gradient strip gel, pH range 3.0-5.6 (Amersham Biosciences), using the Invitrogen ZOOM immobilized pH gradient runner system at 100 V for 30 min. For the second dimension, focused immobilized pH gradient strips were equilibrated in NuPAGE lithium dodecyl sulfate sample buffer (Invitrogen Corp.) in the presence of NuPAGE sample reducing agent (Invitrogen Corp.) for 15 min, and further incubated in lithium dodecyl sulfate sample buffer in the presence of 125 mm iodoacetamide for 15 min. The strips were placed on 12% BisTris gels and embedded in 0.5% agarose, and after separation transferred to polyvinylidene difluoride membranes for Western blot. Subcellular Fractionation—Subcellular fractionation was performed by differential centrifugation of asynchronous MCF7 and HEK-CITED1 cells following homogenization in hypotonic media, as previously described (32Graham J.M. Scientific World J. 2002; 2: 1638-1642Crossref Scopus (33) Google Scholar). Nuclear fractions were separated after centrifugation at 1,000 × g for 10 min, whereas membrane and free cytosolic fractions were separated after centrifugation at 100,000 × g for 45 min. Fractions were separated by SDS-PAGE and CITED1 detected by Western blot using mouse anti-CITED1 monoclonal antibody (2H6). Equal protein loading of each fraction was estimated by Bradford assay. Metabolic Labeling—For metabolic labeling studies, MCF7 and HEK-CITED1 cells were incubated in phosphate-free DMEM with 10% dialyzed FBS for 30 min before labeling with 0.5 mCi/ml [32P]orthophosphate for 4 h. After extensive washing, cells were lysed in Trion X-100 lysis buffer (1% Triton X-100, 150 mm NaCl, 25 mm HEPES, 5 mm EDTA, and 10% glycerol) along with 50 mg/ml of the protease inhibitor 4-(2-aminoethyl)benzenesulfonyl fluoride (Sigma), and the phosphatase inhibitors 50 mm sodium fluoride and 1 μm sodium orthovanadate. Lysates were then clarified and pre-cleared with protein A/G-agarose beads (Santa Cruz Biotechnology). Immunoprecipitation was performed for 4 h on ice using an affinity purified rabbit anti-CITED1 antibody raised against a unique COOH-terminal peptide sequence (J) (15Plisov S. Tsang M. Shi G. Boyle S. Yoshino K. Dunwoodie S.L. Dawid I.B. Shioda T. Perantoni A.O. de Caestecker M.P. J. Am. Soc. Nephrol. 2005; 16: 1632-1644Crossref PubMed Scopus (53) Google Scholar). After addition of protein A/G-agarose beads, the immunoprecipitates were extensively washed in ice-cold Triton X-100 lysis buffer, separated by SDS-PAGE, and transferred to polyvinylidene difluoride membranes for autoradiography. Phosphoamino Acid Analysis—Phosphoamino acid analysis of the HEK-FLAG CITED1 immunoprecipitates was performed on the 32P-labeled M-phase CITED1 bands detected by autoradiography, as previously described (33Boyle W.J. van der Geer P. Hunter T. Methods Enzymol. 1991; 201: 110-149Crossref PubMed Scopus (1272) Google Scholar). For phosphoamino acid analysis, the cut polyvinylidene difluoride membrane was incubated with 6 m HCl at 110 °C for 1 h, the supernatant removed, vacuum dried, and resuspended in pH 1.9 buffer (2.2% formic acid with 7.8% glacial acetic acid) along with phosphoserine, phosphothreonine, and phosphotyrosine standards (Sigma) at 1 mg/ml. After spotting on to TLC plates, amino acids were separated using a Hunter thin layer electrophoresis system in pH 1.9 buffer in the first dimension, followed by pH 3.5 buffer (10% glacial acetic acid, 1% pyridine, and 1 mm EDTA) in the second dimension. The phosphoamino acid standards were visualized by spraying with 0.25% ninhydrin in acetone, and 32P-labeled amino acids were visualized by autoradiography of the TLC plate. Tryptic Mapping—Tryptic mapping was performed on the excised 32P-labeled S-phase and M-phase CITED1 bands detected by autoradiography, as previously described (33Boyle W.J. van der Geer P. Hunter T. Methods Enzymol. 1991; 201: 110-149Crossref PubMed Scopus (1272) Google Scholar). These were incubated with methanol, and then blocked with 50 mm NH4HCO3 containing 0.1% Tween 20 for 30 min at room temperature. Phosphoproteins were digested twice with 10 μl of 1 mg/ml l-1-tosylamido-2-phenylethyl chloromethyl ketone trypsin (Promega) in 100 μl of NH4HCO3 at 37 °C overnight, and oxidized with performic acid. Released peptides were first separated by electrophoresis on TLC plates at pH 1.9, using the Hunter thin-layer electrophoresis system (model HTLE-7000), at 1000 V for 45 min. Separation in the second dimension was performed by ascending chromatography in n-butyl alcohol (37.5%), pyridine (25%), and acetic acid (7.5%). Resolved phosphopeptides were visualized by autoradiography using Bio-Max MS high speed film (Eastman Kodak Co.). Immunofluorescence Studies—E15.5 mouse kidneys were fixed for 4 h in 4% paraformaldehyde, embedded, and sectioned. After blocking in 10% goat serum, sections were incubated overnight at 4 °C with mouse monoclonal anti-E-cadherin (BD Biosciences, clone 32) and rabbit polyclonal anti-CITED1 (Neomarkers). These were detected using fluorescein-conjugated horse antimouse (Vector Labs) and rhodamine-conjugated goat anti-rabbit antibodies (Jackson ImmunoResearch), and visualized using a Nikon Eclipse epifluorescence microscope. For immunofluorescence staining of cultured cells, HEK-293 and HEK-CITED1 cells were plated onto glass chamber slides coated with type I collagen (Rat Tail, BD Biosciences), fixed in 3% paraformaldehyde in phosphate-buffered saline with 2% sucrose, and permeabilized with 0.2% Triton X, as described (34Eid J.E. Kung A.L. Scully R. Livingston D.M. Cell. 2000; 102: 839-848Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar). After blocking, chambers were incubated overnight at 4 °C with rabbit anti-CITED1 (Neomarkers) or FLAG M2 monoclonal antibodies (Sigma), and detected using fluorescein isothiocyanate-conjugated anti-rabbit or mouse antibodies (Jackson ImmunoResearch), respectively. Nuclear structures were visualized using the far red nuclear stain TO-PRO-3 (Molecular Probes). For subcellular localization studies in live cells, GFP-tagged CITED1 constructs were either transiently transfected into C2C12 cells or stably transfected into HEK-293 cells, and live cells were visualized using an inverted confocal microscope using the appropriate filter sets. Images were acquired before and 30 min after treatment with 1 ng/ml leptomycin B (Sigma), to inhibit CRM-dependent nuclear export. CITED1 Is Phosphorylated in a Cell Cycle-dependent Manner—We evaluated endogenous CITED1 expression in three cell lines. CITED1 appears as a doublet in B16 melanoma and MCF7 breast carcinoma cells synchronized in S-phase. There was a further shift in mobility in these cells and in NPA187 papillary thyroid carcinoma cells synchronized in M-phase (Fig. 1A, lanes 1 and 2). This mobility shift was further enhanced by incubating M-phase cells with okadaic acid (Fig. 1A, lane 3). This suggests that M-phase phosphorylation of CITED1 is regulated either directly or indirectly by an okadaic acid-sensitive protein phosphatase. To determine whether these changes in mobility resulted from protein phosphorylation, M-phase CITED1 immunoprecipitates were dephosphorylated by incubation with alkaline phosphatase. This treatment completely reversed the M-phase mobility shift, resulting in a single CITED1 band (Fig. 1A, lane 4). We compared changes in CITED1 mobility in S-phase and M-phase synchronized HEK-293 cells (which express low levels of endogenous CITED1 (15Plisov S. Tsang M. Shi G. Boyle S. Yoshino K. Dunwoodie S.L. Dawid I.B. Shioda T. Perantoni A.O. de Caestecker M.P. J. Am. Soc. Nephrol. 2005; 16: 1632-1644Crossref PubMed Scopus (53) Google Scholar)) stably overexpressing FLAG-tagged CITED1 (HEK-CITED1 cells). In these cells, CITED1 clearly migrated as a doublet in S-phase synchronized cells, and underwent a further shift in mobility in M-phase cells (Fig. 1B). This effect was further accentuated by incubating the cells with okadaic acid prior to lysis. An identical pattern of CITED1 mobility was seen in cells arrested in M-phase using Taxol (data not shown). As in the previous studies, incubation of the immunoprecipitates with alkaline phosphatase reversed the M-phase mobility shift, resulting in a single CITED1 band (Fig. 1B). The S-phase doublet also disappeared with λ-phosphatase treatment (see Fig. 4C). Separation of CITED1 by two-dimensional gel electrophoresis (isoelectric focusing and SDS-PAGE) confirmed the presence of two CITED1 phosphoproteins in S-phase- and M-phase-synchronized cells that were sensitive to alkaline phosphatase treatment (Fig. 1C). Throughout the rest of the article we will refer to the intermediate mobility phosphorylated form of CITED1 as “pCITED1,” and the upper, hyperphosphorylated band seen in mitotic cells as “ppCITED1” (Fig. 1, B and C, arrows). To evaluate the regulation of these CITED1 phosphoproteins during progression of the cell cycle, HEK-CITED1 cells were synchronized in S-phase (>70% S-phase), G0 (>70% G0/G1), or M-phase (>90% G2/M), and released in medium containing 10% serum for various time periods. Whereas the level of pCITED1 was only slightly increased after release from thymidine block, the relative level of pCITED1 was reduced after prolonged serum starvation and strongly up-regulated after release in 10% serum for 8 h (Fig. 2A). In contrast, cells released from M-phase showed no change in the relative level of pCITED1, but there was a rapid reduction in levels of ppCITED1 following release (Fig. 2B). Taken together, these findings indicate that CITED1 exists in both unphosphorylated and at least two phosphorylated forms, and that levels of these phosphoproteins are dynamically regulated over the course of the cell cycle. Mapping CITED1 Phosphorylation Sites—Having established that CITED1 phosphorylation is regulated in a cell cycle-dependent manner, we sought to map the phosphorylation sites. [32P]Orthophosphate labeling of MCF7 and HEK-CITED1 cells confirmed that CITED1 was phosphorylated both in S- and M-phase-arrested cells (Fig. 3A). Phosphoamino acid analysis of the CITED1 band from mitotic HEK-CITED1 cells only detected phosphoserine residues (Fig. 3B). To characterize these phosphorylation sites further, we performed tryptic mapping of the [32P]orthophosphate-labeled CITED1 bands from S-phase- and M-phase-synchronized HEK-CITED1 cells. Separation of the tryptic peptides by electrophoresis and chromatography identified three dominant 32P-labeled CITED1 peptides in S-phase cells (Fig. 3C, spots 1-3). The same peptides appeared in M-phase cell preparations (confirmed when S-phase and M-phase digests were mixed), although one of the spots (spot 2) showed increased mobility along the x axis in M-phase (migrating toward the positive electrode). In addition, a single negatively charged, hydrophobic phosphopeptide appeared in mitotic cells, which was not seen in S-phase preparations (spot 4). These data confirm that CITED1 exists in two phosphorylated forms: a phosphorylated form found in S- and M-phase cells containing three phosphorylated tryptic peptides, and a hyperphosphorylated form that is only found in M-phase cells containing an additional phosphorylated tryptic peptide. CITED1 contains a number of potential serine phosphorylation sites. Six of these residues are conserved in human, mouse, and rat CITED1 sequences (Ser-16, Ser-63, Ser-67, Ser-71, Ser-137, and Ser-139), and five of these have predicted phosphorylation site scores of greater than 90% (Ser-16, Ser-63, Ser-67, Ser-71, and Ser-137) (NetPhos 2.0). We therefore explored the effects of individual and combinatorial mutations of these five serine residues on CITED1 mobility by Western blot. Whereas most of these mutations either individually or in combination gave rise to two M-phase bands (as opposed to the three seen with wild type CITED1), only the combination of mutations at residues Ser-16, Ser-63, Ser-67, Ser-71, and Ser-137 showed no change in mobility with mitosis (Fig. 4A shows a representative selection of combinatorial mutations that were studied). We will refer to this combined mutant construct as CITED1 S5A for the remainder of the text. Introduction of glutamic acid residues at these sites to generate the phosphomimetic mutant, CITED1 S5E, gave rise to a single, low mobility band (Fig. 4B). λ-Phosphatase treatment of anti-FLAG immunoprecipitates from these cells had no significant effect on mobility of the dominant CITED1 S5A and S5E bands in S- or M-phase synchronized cells when compared with wild type CITED1 (Fig. 4C). There was, however, a low mobility band seen with both of the CITED1 mutations in M-phase cells that was lost following λ-phosphatase treatment (Fig. 4C, arrow). Whereas this was only seen in concentrated immunoprecipitates from M-phase-synchronized cells (compare lysates in Fig. 4, A and B), it indicates that there is a minor M-phase CITED1 phosphorylation site that is not blocked by the CITED1 S5A and S5E mutations. To define the precise effects of mutating these five serine residues on S- and M-phase phosphorylation, we evaluated phosphotryptic maps of [32P]orthophosphate-labeled CITED1 bands from HEK-293 cells overexpressing CITED1 S5A. These studies showed that the S5A mutation prevented phosphorylation of the three dominant 32P-labeled CITED1 peptides seen in S- and M-phase cells (Fig. 5A, spots 1-3). This is consistent with the predicted tryptic fragment map of CITED1 indicating that the five phosphorylated serine residues are dispersed across three separate predicted tryptic fragments (Fig. 5B, red dotted lines and arrows). However, these studies also demonstrated that there were two additional M-phase tryptic phosphopeptides in the CITED1 S5A preparations (Fig. 5A, spots A and B). Mixing M-phase digests from wild type CITED1 and the S5A mutation suggests that one of the peptides (spot A) corresponds to the negatively charged M-phase phosphopeptide identified in the previous CITED1 tryptic map (Fig. 3C, spot 4). The additional phosphopeptide (spot B) did not overlay with any of the wild type CITED1 phosphopeptides, and is likely to represent an artificial M-phase phosphorylation site that only occurs when the five serine residues are mutated. These findings indicate that CITED1 S5A blocks the common S- and M-phase phosphorylation sites in CITED1, but does not prevent the additional M-phase phosphorylation event. Subcellular Localization of C" @default.
• W2116780321 created "2016-06-24" @default.
• W2116780321 creator A5002131310 @default.
• W2116780321 creator A5024781173 @default.
• W2116780321 creator A5025865224 @default.
• W2116780321 creator A5026539011 @default.
• W2116780321 creator A5027047231 @default.
• W2116780321 creator A5042027919 @default.
• W2116780321 date "2006-09-01" @default.
• W2116780321 modified "2023-10-11" @default.
• W2116780321 title "The Transcriptional Activity of CITED1 Is Regulated by Phosphorylation in a Cell Cycle-dependent Manner" @default.
• W2116780321 cites W1528493806 @default.
• W2116780321 cites W1967251768 @default.
• W2116780321 cites W1970207103 @default.
• W2116780321 cites W1979285366 @default.
• W2116780321 cites W1979569340 @default.
• W2116780321 cites W1980085106 @default.
• W2116780321 cites W1986744382 @default.
• W2116780321 cites W1990823488 @default.
• W2116780321 cites W1996313023 @default.
• W2116780321 cites W2019381489 @default.
• W2116780321 cites W2025609408 @default.
• W2116780321 cites W2026506662 @default.
• W2116780321 cites W2028550299 @default.
• W2116780321 cites W2030762831 @default.
• W2116780321 cites W2039542136 @default.
• W2116780321 cites W2041970562 @default.
• W2116780321 cites W2049524386 @default.
• W2116780321 cites W2076246431 @default.
• W2116780321 cites W2086822737 @default.
• W2116780321 cites W2092552038 @default.
• W2116780321 cites W2094579915 @default.
• W2116780321 cites W2096354011 @default.
• W2116780321 cites W2099056657 @default.
• W2116780321 cites W2111891435 @default.
• W2116780321 cites W2118067986 @default.
• W2116780321 cites W2119483030 @default.
• W2116780321 cites W2124516418 @default.
• W2116780321 cites W2125887885 @default.
• W2116780321 cites W2142657883 @default.
• W2116780321 cites W2143259551 @default.
• W2116780321 cites W2148664347 @default.
• W2116780321 cites W2164218605 @default.
• W2116780321 doi "https://doi.org/10.1074/jbc.m602631200" @default.
• W2116780321 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16864582" @default.
• W2116780321 hasPublicationYear "2006" @default.
• W2116780321 type Work @default.
• W2116780321 sameAs 2116780321 @default.
• W2116780321 citedByCount "24" @default.
• W2116780321 countsByYear W21167803212012 @default.
• W2116780321 countsByYear W21167803212013 @default.
• W2116780321 countsByYear W21167803212014 @default.
• W2116780321 countsByYear W21167803212019 @default.
• W2116780321 countsByYear W21167803212020 @default.
• W2116780321 countsByYear W21167803212022 @default.
• W2116780321 crossrefType "journal-article" @default.
• W2116780321 hasAuthorship W2116780321A5002131310 @default.
• W2116780321 hasAuthorship W2116780321A5024781173 @default.
• W2116780321 hasAuthorship W2116780321A5025865224 @default.
• W2116780321 hasAuthorship W2116780321A5026539011 @default.
• W2116780321 hasAuthorship W2116780321A5027047231 @default.
• W2116780321 hasAuthorship W2116780321A5042027919 @default.
• W2116780321 hasBestOaLocation W21167803211 @default.
• W2116780321 hasConcept C11960822 @default.
• W2116780321 hasConcept C1491633281 @default.
• W2116780321 hasConcept C185592680 @default.
• W2116780321 hasConcept C29537977 @default.
• W2116780321 hasConcept C2994037739 @default.
• W2116780321 hasConcept C55493867 @default.
• W2116780321 hasConcept C86803240 @default.
• W2116780321 hasConcept C95444343 @default.
• W2116780321 hasConceptScore W2116780321C11960822 @default.
• W2116780321 hasConceptScore W2116780321C1491633281 @default.
• W2116780321 hasConceptScore W2116780321C185592680 @default.
• W2116780321 hasConceptScore W2116780321C29537977 @default.
• W2116780321 hasConceptScore W2116780321C2994037739 @default.
• W2116780321 hasConceptScore W2116780321C55493867 @default.
• W2116780321 hasConceptScore W2116780321C86803240 @default.
• W2116780321 hasConceptScore W2116780321C95444343 @default.
• W2116780321 hasIssue "37" @default.
• W2116780321 hasLocation W21167803211 @default.
• W2116780321 hasOpenAccess W2116780321 @default.
• W2116780321 hasPrimaryLocation W21167803211 @default.
• W2116780321 hasRelatedWork W1508807123 @default.
• W2116780321 hasRelatedWork W1969408338 @default.
• W2116780321 hasRelatedWork W1985106942 @default.
• W2116780321 hasRelatedWork W2066275626 @default.
• W2116780321 hasRelatedWork W2162355751 @default.
• W2116780321 hasRelatedWork W2391474661 @default.
• W2116780321 hasRelatedWork W2435705077 @default.
• W2116780321 hasRelatedWork W2551077638 @default.
• W2116780321 hasRelatedWork W2810121841 @default.
• W2116780321 hasRelatedWork W4200284630 @default.
• W2116780321 hasVolume "281" @default.
• W2116780321 isParatext "false" @default.
• W2116780321 isRetracted "false" @default.
• W2116780321 magId "2116780321" @default.
• W2116780321 workType "article" @default.