FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2118038862> ?p ?o ?g. }

• W2118038862 endingPage "20151" @default.
• W2118038862 startingPage "20146" @default.
• W2118038862 abstract "Archaeosine is a novel derivative of 7-deazaguanosine found in transfer RNAs of most organisms exclusively in the archaeal phylogenetic lineage and is present in the D-loop at position 15. We show that this modification is formed by a posttranscriptional base replacement reaction, catalyzed by a new tRNA-guanine transglycosylase (TGT), which has been isolated fromHaloferax volcanii and purified nearly to homogeneity. The molecular weight of the enzyme was estimated to be 78 kDa by SDS-gel electrophoresis. The enzyme can insert free 7-cyano-7-deazaguanine (preQ0 base) in vitro at position 15 of anH. volcanii tRNA T7 transcript, replacing the guanine originally located at that position without breakage of the phosphodiester backbone. Since archaeosine base and 7-aminomethyl-7-deazaguanine (preQ1 base) were not incorporated into tRNA by this enzyme, preQ0 base appears to be the actual substrate for the TGT of H. volcanii, a conclusion supported by characterization of preQ0 base in an acid-soluble extract of H. volcanii cells. Thus, this novel TGT in H. volcanii is a key enzyme for the biosynthetic pathway leading to archaeosine in archaeal tRNAs. Archaeosine is a novel derivative of 7-deazaguanosine found in transfer RNAs of most organisms exclusively in the archaeal phylogenetic lineage and is present in the D-loop at position 15. We show that this modification is formed by a posttranscriptional base replacement reaction, catalyzed by a new tRNA-guanine transglycosylase (TGT), which has been isolated fromHaloferax volcanii and purified nearly to homogeneity. The molecular weight of the enzyme was estimated to be 78 kDa by SDS-gel electrophoresis. The enzyme can insert free 7-cyano-7-deazaguanine (preQ0 base) in vitro at position 15 of anH. volcanii tRNA T7 transcript, replacing the guanine originally located at that position without breakage of the phosphodiester backbone. Since archaeosine base and 7-aminomethyl-7-deazaguanine (preQ1 base) were not incorporated into tRNA by this enzyme, preQ0 base appears to be the actual substrate for the TGT of H. volcanii, a conclusion supported by characterization of preQ0 base in an acid-soluble extract of H. volcanii cells. Thus, this novel TGT in H. volcanii is a key enzyme for the biosynthetic pathway leading to archaeosine in archaeal tRNAs. A variety of modified nucleosides has been found in tRNA (1Nishimura S. Schimmel P.R. Söll D. Abelson J.N. Transfer RNA: Structure, Properties and Recognition. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1979: 59-79Google Scholar, 2Limbach P.A. Crain P.F. McCloskey J.A. Nucleic Acids Res. 1994; 22: 2183-2196Crossref PubMed Scopus (476) Google Scholar), but their functions and, in particular, their biosynthetic pathways are still largely unknown (3Björk G.J. Ericson J.U. Gustafsson C.E.D. Hagervall T.G. Jönsson Y.H. Wikström P.M. Annu. Rev. Biochem. 1987; 56: 263-287Crossref PubMed Google Scholar). Many modified nucleosides are highly conserved with respect to their sequence locations in tRNA (4Grosjean H. Sprinzl M. Steinberg S. Biochimie. 1995; 77: 139-141Crossref PubMed Scopus (113) Google Scholar), and some are characteristic of the evolutionary origin (2Limbach P.A. Crain P.F. McCloskey J.A. Nucleic Acids Res. 1994; 22: 2183-2196Crossref PubMed Scopus (476) Google Scholar, 5Björk G.R. Chem. Scr. 1986; 26B: 91-95Google Scholar), namely, archaea, bacteria, or eukarya (6Woese C.R. Kandler O. Wheelis M.L. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 4576-4579Crossref PubMed Scopus (4535) Google Scholar). Perhaps the most phylogenetically specific nucleoside in tRNA is archaeosine, which occurs only in archaeal tRNA at position 15, a site that is not modified in tRNAs from the other two primary domains (7Sprinzl M. Steegborn C. Hübel F. Steinberg S. Nucleic Acids Res. 1996; 24: 68-72Crossref PubMed Scopus (160) Google Scholar). Archaeosine was first discovered by Kilpatrick and Walker (8Kilpatrick M.W. Walker R.T. Zentralbl. Bakteriol. Mikrobiol. Hyg. 1 Abt. Orig. 1982; C3: 79-89Google Scholar) during sequencing of tRNA fromThermoplasma acidophilum, and it was subsequently shown to be present in many archaeal species (9Edmonds C.G. Crain P.F. Gupta R. Hashizume T. Hocart C.H. Kowalak J.A. Pomerantz S.C. Stetter K.O. McCloskey J.A. J. Bacteriol. 1991; 173: 3138-3148Crossref PubMed Google Scholar); in the most extensively studied archaeal tRNA, from Haloferax volcanii, archaeosine occurs in tRNAs specifying more than 15 amino acids (10Gupta R. J. Biol. Chem. 1984; 259: 9461-9471Abstract Full Text PDF PubMed Google Scholar). Subsequently, the structure of archaeosine was determined to be the non-purine, non-pyrimidine nucleoside 7-formamidino-7-deazaguanosine (Fig.1 A) (11Gregson J.M. Crain P.F. Edmonds C.G. Gupta R. Hashizume T. Phillipson D.W. McCloskey J.A. J. Biol. Chem. 1993; 268: 10076-10086Abstract Full Text PDF PubMed Google Scholar). The only other known examples of tRNA nucleosides with 7-deazaguanosine structures are the members of the Q 1The abbreviations used are: Q or queuosine, 7-{[(4, 5-cis-dihydroxy-2-cyclopenten-1-yl)-amino]methyl}-7-deazaguanosine; oQ or epoxyqueuosine, 7-{[(2, 3-epoxy-4,5-cis-dihydroxycyclopent-1-yl)-amino]methyl}-7-deazaguanosine; preQ1, 7-aminomethyl-7-deazaguanosine; preQ0, 7-cyano-7-deazaguanosine; archaeosine, 2-amino-4,7-dihydro-4-oxo-7-β-d-ribofuranosyl-1H-pyrrolo[2,3-d]pyrimidine-5-carboximidamide, or 7-formamidino-7-deazaguanosine; TGT, tRNA-guanine transglycosylase. nucleoside (12Kasai H. Ohashi Z. Harada F. Nishimura S. Oppenheimer N.J. Crain P.F. Liehr J.G. von Minden D.L. McCloskey J.A. Biochemistry. 1975; 14: 4198-4208Crossref PubMed Scopus (197) Google Scholar) (Fig.1 E) family (13Nishimura S. Prog. Nucleic Acid Res. Mol. Biol. 1983; 28: 49-73Crossref PubMed Scopus (126) Google Scholar), which includes precursors in its biosynthesis, such as 7-cyano-7-deazaguanine (preQ0; Fig.1 D) (14Noguchi S. Yamaizumi Z. Ohgi T. Goto T. Nishimura Y. Hirota Y. Nishimura S. Nucleic Acids Res. 1978; 5: 4215-4223Crossref PubMed Scopus (34) Google Scholar), 7-aminomethyl-7-deazaguanine (preQ1; Fig. 1 C) (15Okada N. Noguchi S. Nishimura S. Ohgi T. Goto T. Crain P.F. McCloskey J.A. Nucleic Acids Res. 1978; 5: 2289-2296Crossref PubMed Scopus (53) Google Scholar), and oQ (16Phillipson D.W. Edmonds C.G. Crain P.F. Smith D.L. Davis D.R. McCloskey J.A. J. Biol. Chem. 1987; 262: 3462-3471Abstract Full Text PDF PubMed Google Scholar) from bacterial tRNAs, and mannosyl and galactosyl derivatives of Q (17Kasai H. Nakanishi K. Macfarlane R.D. Torgerson D.F. Ohashi Z. McCloskey J.A. Gross H.J. Nishimura S. J. Am. Chem. Soc. 1976; 98: 5044-5046Crossref PubMed Scopus (113) Google Scholar, 18Okada N. Nishimura S. Nucleic Acids Res. 1977; 4: 2931-2937Crossref PubMed Scopus (34) Google Scholar) from mammalian tRNAs. In contrast to archaeosine, members of the Q nucleoside family are located at the first position of the anticodon (position 34) in bacterial and eukaryotic tRNAs that are specific for only four amino acids (Tyr, His, Asp, and Asn) (19Harada F. Nishimura S. Biochemistry. 1972; 11: 301-308Crossref PubMed Scopus (201) Google Scholar). The key enzyme in the biosynthesis of the Q nucleoside in tRNA is tRNA-guanine transglycosylase (TGT; EC2.4.2.29), which catalyzes a base-exchange reaction by cleavage of the N–C glycosidic bond at position 34 (20Okada N. Nishimura S. J. Biol. Chem. 1979; 254: 3061-3066Abstract Full Text PDF PubMed Google Scholar). In bacteria, TGT catalyzes the exchange of guanine at position 34 in tRNA with either guanine base, preQ1 base, or preQ0 base (20Okada N. Nishimura S. J. Biol. Chem. 1979; 254: 3061-3066Abstract Full Text PDF PubMed Google Scholar, 21Okada N. Noguchi S. Kasai H. Shindo-Okada N. Ohgi T. Goto T. Nishimura S. J. Biol. Chem. 1979; 254: 3067-3073Abstract Full Text PDF PubMed Google Scholar). preQ1 base is presumed to be synthesized de novofrom GTP (1Nishimura S. Schimmel P.R. Söll D. Abelson J.N. Transfer RNA: Structure, Properties and Recognition. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1979: 59-79Google Scholar) and was identified as the physiological substrate ofEscherichia coli TGT (21Okada N. Noguchi S. Kasai H. Shindo-Okada N. Ohgi T. Goto T. Nishimura S. J. Biol. Chem. 1979; 254: 3067-3073Abstract Full Text PDF PubMed Google Scholar). After incorporation of preQ1 into tRNA, it is further modified to oQ by transfer of the ribosyl moiety from S-adenosylmethionine (22Slany R.K. Bösl M. Crain P.F. Kersten H. Biochemistry. 1993; 32: 7811-7817Crossref PubMed Scopus (72) Google Scholar), then finally to yield Q in the polynucleotide chain (23Frey B. McCloskey J.A. Kersten W. Kersten H. J. Bacteriol. 1988; 170: 2078-2082Crossref PubMed Google Scholar). In contrast, in eukarya, TGT can incorporate fully modified Q base into the first position of the anticodon by a base-replacement reaction (24Shindo-Okada N. Okada N. Ohgi T. Goto T. Nishimura S. Biochemistry. 1980; 19: 395-400Crossref PubMed Scopus (75) Google Scholar, 25Katze J.R. Gunduz U. Smith D.L. Cheng C.S. McCloskey J.A. Biochemistry. 1984; 23: 1171-1176Crossref PubMed Scopus (45) Google Scholar). Animals cannot synthesize Q-related compounds de novo and must obtain Q base as a nutrient from their diet or gut flora (26Farkas W.R. J. Biol. Chem. 1980; 255: 6832-6835Abstract Full Text PDF PubMed Google Scholar,27Katze J.R. Basile B. McCloskey J.A. Science. 1982; 216: 55-56Crossref PubMed Scopus (89) Google Scholar). Here we report the isolation of a new type of TGT from H. volcanii; it catalyzes the incorporation of preQ0 base into position 15 of tRNA, replacing guanine originally located at that site. Further, we have demonstrated that free preQ0 base is present in H. volcanii cells, implying that TGT utilizes preQ0 as a substrate leading to the biosynthesis of archaeosine in archaeal tRNAs. H. volcanii (ATCC 29605) was grown aerobically at 37 °C on a 500-liter scale in Gupta's medium (10Gupta R. J. Biol. Chem. 1984; 259: 9461-9471Abstract Full Text PDF PubMed Google Scholar), until the absorbance at 600 nm reached 0.8–1.0. About 1.0 kg of cells was collected. Exchange between guanine and various 7-deazaguanine analogues, catalyzed by TGT, was assayed as described previously (20Okada N. Nishimura S. J. Biol. Chem. 1979; 254: 3061-3066Abstract Full Text PDF PubMed Google Scholar) except that the final ionic condition of the reaction mixture was 1.5 m KCl and 1.5 m NaCl. The 7-deazaguanines were synthesized as described previously: preQ0 (28Kondo, T., Nakatsuka, S., and Goto, T. (1980) Chemistry Lett.559–562.Google Scholar), preQ1 (29Ohgi, T., Kondo, T., and Goto, T. (1979) Chemistry Lett.1283–1286.Google Scholar), and archaeosine base (30Hashizume T. McCloskey J.A. Nucleic Acids Res. Symp. Ser. 1994; 31: 137-138Google Scholar). Frozen H. volcanii cells (100 g) were suspended in 200 ml of buffer A (50 mm Hepes (pH 7.5), 10% glycerol, 1.0 mm dithiothreitol, and 0.5 mmphenylmethylsulfonyl fluoride) plus DNase I (2.5 μg/ml), and were broken by sonication. The S-100 fraction was obtained by centrifugation at 105,000 × g for 1 h, dialyzed against buffer A, and then adsorbed onto a DEAE-Sepharose FF column (2.5 × 20 cm) (Pharmacia Biotech Inc.), which was eluted by a linear gradient of NaCl from 0.02 to 0.5 m in buffer A. The eluate containing the active fraction was brought to 40% ammonium sulfate and then applied to a Butyl-Sepharose FF column (2.5 × 20 cm) (Pharmacia), which was eluted with a linear gradient of ammonium sulfate from 40 to 0% in buffer A. The active fraction was next applied to a Butyl-Sepharose 4B column (1.5 × 15 cm) (Pharmacia) and eluted as described above for the Butyl-Sepharose FF column. The active fraction was then applied to a Superdex 200 column (1.6 cm × 60 cm) (Pharmacia), and then eluted with buffer A containing 300 mm NaCl. Finally, the TGT fraction was applied to a Mono Q column (0.50 × 5 cm) (Pharmacia) and eluted with a linear gradient of NaCl from 300 mm to 1 m. This TGT fraction was stable for at least 1 month when stored at 4 °C. The activity of the enzyme was monitored by incorporation of [8-14C]guanine into unfractionated E. colitRNA (20Okada N. Nishimura S. J. Biol. Chem. 1979; 254: 3061-3066Abstract Full Text PDF PubMed Google Scholar). Amino acid sequences of peptide fragments generated by digestion with lysylpeptidase were determined as described previously (31Tsunasawa S. Masaki T. Hirose M. Soejima M. Sakiyama F. J. Biol. Chem. 1989; 264: 3832-3839Abstract Full Text PDF PubMed Google Scholar). Two synthetic DNA oligomers, namely Lys-FOR (5′- TAATACGACTCACTATAGGGCCGGTAGCTCAGTTAGGCAGAGCGTCTGACTCTT-3′) and Lys-REV (5′-TGGTGGGCCGGACGCGATTTGAACACGCGACCGTCTGATTAAGAGTCAGACGCTCTGCCTA-3′) were annealed via the complementary region, and both of the 3′ ends were extended by Tth DNA polymerase (Toyobo). After extension, two synthetic DNA primers, namely T7 (5′-TAATACGACTCACTATA-3′) and Halo-Lys3′ (5′-CCTGGTGGGCCGGACGCGATTT-3′) were added, and a polymerase chain reaction was performed to yield the gene for H. volcanii tRNALys(CUU) containing the promoter sequence for T7 RNA polymerase (Takara). We cloned the product of a polymerase chain reaction in pUC19; digestion of plasmid DNA with MvaI generated a CCA end for the tRNA gene, which was transcribed in vitro using T7 RNA polymerase (32Himeno H. Hasegawa T. Ueda T. Watanabe K. Miura K. Shimizu M. Nucleic Acids Res. 1989; 17: 7855-7863Crossref PubMed Scopus (154) Google Scholar). For preparation of the T7 transcript into which preQ0 base was incorporated, 200 μl of a reaction mixture containing 300 pmol of T7 transcript, 20 μl of TGT (15 units) (20Okada N. Nishimura S. J. Biol. Chem. 1979; 254: 3061-3066Abstract Full Text PDF PubMed Google Scholar), and 5 nmol of preQ0 base (under ionic conditions of the guanine exchange reaction; see above) were incubated at 37 °C for 1.5 h. The sequence of the RNA was determined as described elsewhere (33Stanley J. Vassilenko S. Nature. 1978; 274: 87-88Crossref PubMed Scopus (157) Google Scholar, 34Kuchino Y. Hanyu N. Nishimura S. Methods Enzymol. 1987; 155: 379-396Crossref PubMed Scopus (74) Google Scholar). A reaction mixture containing T7 transcript and TGT in the presence of preQ0 base or an aliquot of acid-soluble extract ofH. volcanii was incubated at 37 °C for 1.5 h. After digestion of the T7 transcript by RNase T2, the preQ0nucleotide was analyzed by post-labeling using T4 polynucleotide kinase and [γ-32P]ATP (21Okada N. Noguchi S. Kasai H. Shindo-Okada N. Ohgi T. Goto T. Nishimura S. J. Biol. Chem. 1979; 254: 3067-3073Abstract Full Text PDF PubMed Google Scholar, 35Silberklang M. Prochiantz A. Haenni A.-L. RajBhandary U.L. Eur. J. Biochem. 1977; 72: 465-478Crossref PubMed Scopus (141) Google Scholar). The enzymes used (RNase T2, T4 polynucleotide kinase, and yeast hexokinase) were inactivated by phenol extraction instead of boiling. After incubation with nuclease P1, the digestion product was applied to a cellulose thin layer plate (20 × 20 cm) and was subjected to two-dimensional chromatography (15Okada N. Noguchi S. Nishimura S. Ohgi T. Goto T. Crain P.F. McCloskey J.A. Nucleic Acids Res. 1978; 5: 2289-2296Crossref PubMed Scopus (53) Google Scholar). H. volcanii cells were suspended in a solution of 0.2 m formic acid and shaken for 2 h at 4 °C. After centrifugation, the supernatant was filtered through a Millipore filter. After neutralization with NaOH, soluble substances were extracted with tetrahydrofuran. The organic phase was evaporated, and the material was used for the identification of preQ0base. E. coli TGT can be assayed by its ability to incorporate [8-14C]guanine into Q-unmodified tRNAs (typically unfractionated yeast tRNA, which constitutively lacks Q, is used) by replacing the guanine base located at the first position of the anticodon (20Okada N. Nishimura S. J. Biol. Chem. 1979; 254: 3061-3066Abstract Full Text PDF PubMed Google Scholar). By analogy with E. coli TGT, we searched for such an enzymatic activity in a crude extract of H. volcaniiusing E. coli tRNA as a substrate (see below). H. volcanii TGT was purified to near homogeneity following successive column chromatographies. Table I shows the recovery and the purification factor at each step, and Fig.2 shows the pattern of SDS-polyacrylamide gel electrophoresis at each step. The molecular mass of the enzyme was deduced to be 78 kDa from a profile of the gel (Fig. 2, lane 6). Like E. coli and eukaryotic TGT, H. volcanii TGT does not require ATP for the base replacement reaction. High salt concentration (approximately 2.4 m) is necessary for maximum activity. Magnesium ion is required for activity with the T7 transcript as a substrate, but activity with unfractionatedE. coli tRNA does not require magnesium ion. These results suggest that magnesium ion may be responsible for conformational rigidity of the tRNA, but not for the enzymatic activity itself. Optimum activity occurs near pH 7.5. Purified TGT was digested with lysylpeptidase, and the sequences of several resultant peptide fragments were determined (see below).Table IPurification of tRNA-guanine transglycosylase from H. volcaniiFractionProteinSpecific activity1-a1 unit = 20 pmol/h.Purification factorRecoverymg×10 2 units/mg%S-10055002.41100DEAE-Sepharose FF110013.86118Butyl-Sepharose FF35036.916102Butyl-Sepharose 4B5034.81514Superdex 2007321.313918Mono Q0.4975.042231-a 1 unit = 20 pmol/h. Open table in a new tab To examine the specificity for tRNA substrate, we constructed a plasmid clone containing the sequence of H. volcanii tRNALys(CUU) and that of T7 promoter upstream of the gene. Its T7 transcript (Fig.3 A) was found to be a good substrate for the enzyme (Fig. 3 B). The labeled T7 transcript was isolated, and the site at which [8-14C]guanine had been incorporated was determined by RNA sequencing to be position 15, 2M. Watanabe, M. Matsuo, S. Tanaka, and N. Okada, unpublished observations. the exclusive location of archaeosine nucleotide in archaeal tRNA. This result suggested that the enzymatic activity is involved in the biosynthesis of archaeosine nucleotide in tRNA. Unfractionated tRNA from E. coli was also found to be a good TGT substrate, whereas unfractionated H. volcanii, yeast, and bovine tRNAs were not (Fig. 3 B), although we did not quantitatively measure the efficiency of unfractionated E. coli tRNA and of the T7Lystranscript as substrates. These results further suggest that position 15 of H. volcanii tRNAs is fully modified to archaeosine nucleotide. The ability of various bases to serve as substrates for incorporation into tRNA by H. volcanii TGT was examined using the procedure of Okada et al. (21Okada N. Noguchi S. Kasai H. Shindo-Okada N. Ohgi T. Goto T. Nishimura S. J. Biol. Chem. 1979; 254: 3067-3073Abstract Full Text PDF PubMed Google Scholar). First, the T7 transcript was labeled with [8-14C]guanine by incubation with TGT. To a reaction mixture that contained this 8-14C-labeled tRNA and the TGT enzyme, we added various 7-deazaguanine bases and monitored the decrease in acid-insoluble radioactivity of the tRNA due to release of [8-14C]guanine by replacement with the added base (Fig.4). Unexpectedly, neither archaeosine base itself (Fig. 1 B), nor preQ1 base (Fig.1 C), which is the physiological substrate for E. coli TGT (21Okada N. Noguchi S. Kasai H. Shindo-Okada N. Ohgi T. Goto T. Nishimura S. J. Biol. Chem. 1979; 254: 3067-3073Abstract Full Text PDF PubMed Google Scholar), were incorporated into the tRNA transcript. Among 7-deazaguanine derivatives, only preQ0 base (Fig.1 D) was efficiently incorporated. We attribute the small amount of apparent archaeosine base incorporation into tRNA to be due to preQ0 base, and not archaeosine base, since approximately 20% of archaeosine base is chemically converted to preQ0 base after incubation of the reaction mixture under the conditions used. Furthermore, the nucleotide at position 15 of the tRNA product after incubation with archaeosine base was found to be preQ0 nucleotide by RNA sequencing2 (see “Discussion”). To investigate whether preQ0 base is directly incorporated into tRNA, as well as whether incorporation occurs at position 15 in the D-loop, the sequence of the D-loop region in the T7 transcript after incubation with preQ0 base was determined by the post-labeling method (33Stanley J. Vassilenko S. Nature. 1978; 274: 87-88Crossref PubMed Scopus (157) Google Scholar, 34Kuchino Y. Hanyu N. Nishimura S. Methods Enzymol. 1987; 155: 379-396Crossref PubMed Scopus (74) Google Scholar). The RNA was subjected to partial digestion with alkali and the 5′ ends of resultant RNA fragments were labeled by using polynucleotide kinase and [γ-32P]ATP, followed by separation by electrophoresis in a polyacrylamide gel (Fig.5 A). RNA was extracted from each band in the gel and digested with nuclease P1. The resultant32P-labeled nucleotide 5′-monophosphate was analyzed by thin-layer chromatography. Fig. 5 B shows clearly that preQ0 base was incorporated at position 15 of the tRNA, and also shows that more than 90% of the nucleotide at position 15 is a preQ0 nucleotide, indicating that the base-replacement reaction by H. volcanii TGT was efficient under the present conditions. If preQ0 base is the physiological substrate for H. volcanii TGT, free preQ0 base could be present in H. volcanii cells. To test this hypothesis, we prepared an acid-soluble extract of H. volcanii and incubated an aliquot of the extract with the T7 transcript of H. volcanii tRNALys(CUU) andH. volcanii TGT under the same conditions described in Fig.4. After the reaction, we analyzed modified nucleotides in the treated tRNA using the post-labeling method (21Okada N. Noguchi S. Kasai H. Shindo-Okada N. Ohgi T. Goto T. Nishimura S. J. Biol. Chem. 1979; 254: 3067-3073Abstract Full Text PDF PubMed Google Scholar, 35Silberklang M. Prochiantz A. Haenni A.-L. RajBhandary U.L. Eur. J. Biochem. 1977; 72: 465-478Crossref PubMed Scopus (141) Google Scholar). As shown in Fig.6, preQ0 5′-monophosphate was detected in the tRNA transcript following incubation in the presence of the acid-soluble extract (Fig. 6 B), but it was not detected following incubation with the enzyme alone (Fig. 6 C). Further, similar acid treatment of isolated H. volcanii tRNA did not release preQ0 by the criterion of failure of the T7 transcript to incorporate preQ0 when incubated with the extract and TGT.2 Although archaeosine base is unstable under conditions of high temperature and high salt (see above), archaeosine appears stable when present as a nucleotide in intact tRNA (10Gupta R. J. Biol. Chem. 1984; 259: 9461-9471Abstract Full Text PDF PubMed Google Scholar). These results suggest that free preQ0 base is present in H. volcanii cells and that it may serve as the physiological substrate for H. volcanii TGT (see “Discussion” Fig.7 A).Figure 7Two biosynthetic pathways involving tRNA-guanine transglycosylases. TGT, AdoMet, QueA, and B12 represent tRNA-guanine transglycosylase,S-adenosylmethionine, tRNA ribosyltransferase-isomerase and adenosylcobalamine, respectively.View Large Image Figure ViewerDownload Hi-res image Download (PPT) The normal growth medium for H. volcanii (10Gupta R. J. Biol. Chem. 1984; 259: 9461-9471Abstract Full Text PDF PubMed Google Scholar) contains Tryptone, which, as a whole meat extract, is a source of Q nucleoside and, therefore, a potential source of preQ0. To rule out the possibility that H. volcanii may not synthesize archaeosine de novo, tRNA was isolated from cells grown in a chemically defined (Q-free) medium (36Kauri T. Wallace R. Kushner D.J. Syst. Appl. Microbiol. 1990; 13: 14-18Crossref Scopus (39) Google Scholar) and analyzed for archaeosine; archaeosine content in tRNA from cells grown in the normal growth medium and in chemically defined growth medium was identical.2 Recently, the complete genome sequence of the methanogenic archaeon, Methanococcus jannaschii, has been reported (37Bult C.J. White O. Olsen G.J. Zhou L. Fleischmann R.D. Sutton G.G. Blake J.A. FitzGerald L.M. Clayton R.A. Gocayne J.D. Kerlavage A.R. Dougherty B.A. Tomd J.-F. Adams M.D. Reich C.I. Overbeek R. Kirkness E.F. Weinstock K.G. Merrick J.M. Glodek A. Scott J.L. Geoghagen N.S.M. Weidman J.F. Fuhrmann J.L. Nguyen K. Utterback T.R. Kelly J.M. Peterson J.D. Sadow P.W. Hanna M.C. Cotton M.D. Roberts K.M. Hurst M.A. Kaine B.P. Borodovsky M. Klenk H.-P. Fraser C.M. Smith H.O. Woese C.R. Ventner J.C. Science. 1996; 273: 1058-1073Crossref PubMed Scopus (2291) Google Scholar). Among 1738 protein-coding genes predicted is a putative M. jannaschii TGT gene (MJ#0436) that exhibits 30% identity to E. coli TGT (38Reuter K. Slany R. Ullrich F. Kersten H. J. Bacteriol. 1991; 173: 2256-2264Crossref PubMed Google Scholar). We determined the amino acid sequences of three peptide fragments, generated from purified H. volcanii TGT by digestion with lysylpeptidase, and compared them with the sequence of the putative M. jannaschii TGT. As shown in Fig. 8, fragments 1and 2 from H. volcanii TGT appear to be closely related to the M. jannaschii sequence, with identities of 53.5 and 38.5%, respectively, although the C-terminal portion offragment 3 diverges from that in M. jannaschii. These results suggest that the H. volcanii tRNA-guanine transglycosylase characterized here is the counterpart of the putative TGT whose sequence is present in M. jannaschii (37Bult C.J. White O. Olsen G.J. Zhou L. Fleischmann R.D. Sutton G.G. Blake J.A. FitzGerald L.M. Clayton R.A. Gocayne J.D. Kerlavage A.R. Dougherty B.A. Tomd J.-F. Adams M.D. Reich C.I. Overbeek R. Kirkness E.F. Weinstock K.G. Merrick J.M. Glodek A. Scott J.L. Geoghagen N.S.M. Weidman J.F. Fuhrmann J.L. Nguyen K. Utterback T.R. Kelly J.M. Peterson J.D. Sadow P.W. Hanna M.C. Cotton M.D. Roberts K.M. Hurst M.A. Kaine B.P. Borodovsky M. Klenk H.-P. Fraser C.M. Smith H.O. Woese C.R. Ventner J.C. Science. 1996; 273: 1058-1073Crossref PubMed Scopus (2291) Google Scholar). It is well established that TGT is involved in biosynthesis of Q nucleotide inE. coli (Fig. 1 E) by exchange of guanine at position 34 by preQ1 base in tRNAs specific for Tyr, Asp, Asn, and His ((20, 21); see Introduction). The resultant preQ1 nucleotide in tRNA is then modified to the epoxide oQ by the S-adenosylmethionine-requiring enzyme QueA (22Slany R.K. Bösl M. Crain P.F. Kersten H. Biochemistry. 1993; 32: 7811-7817Crossref PubMed Scopus (72) Google Scholar), and finally, oQ is converted to Q by an unknown vitamin B12-dependent enzyme (23Frey B. McCloskey J.A. Kersten W. Kersten H. J. Bacteriol. 1988; 170: 2078-2082Crossref PubMed Google Scholar). These processes are schematically represented in Fig. 7 B. In the present study, we provide evidence that, in contrast with the primary substrate of bacterial TGT (preQ1), preQ0 base is the normal substrate for H. volcanii TGT. Presumably, the incorporated preQ0 base then is further converted to archaeosine by (net) addition of ammonia, at the polynucleotide level (Fig.7 A). Therefore, both E. coli and H. volcanii TGTs catalyze a very similar reaction, namely, the exchange of guanine base in a polynucleotide chain with a free 7-deazaguanine derivative; however, their actual substrates (in terms of base, tRNAs, and the site of replacement in tRNA) are different. Archaeosine is present at position 15 (D-loop) in most archaeal tRNAs (7Sprinzl M. Steegborn C. Hübel F. Steinberg S. Nucleic Acids Res. 1996; 24: 68-72Crossref PubMed Scopus (160) Google Scholar), whereas Q and its derivatives are present at position 34 (first position of the anticodon) of four specific tRNAs in bacteria and eukarya (19Harada F. Nishimura S. Biochemistry. 1972; 11: 301-308Crossref PubMed Scopus (201) Google Scholar) (see Introduction). Accordingly, these conserved differences in structure and sequence location suggest differences in function. Q has been proposed to be involved in codon recognition (39Bienz M. Kubli E. Nature. 1981; 294: 188-190Crossref PubMed Scopus (112) Google Scholar) and has been shown to prevent stop codon readthrough in tobacco mosaic virus RNA in a codon context-dependent manner (40Beier H. Barciszewska M. Krupp G. Mitnacht R. Gross H.J. EMBO J. 1984; 3: 351-356Crossref PubMed Google Scholar). A correlation between the presence of Q-undermodified tRNAs and frameshifts of some retroviruses including human immunodeficiency virus was proposed (41Hatfield D. Feng Y.-X. Lee B.J. Rein A. Levin J.G. Oroszlan S. Virology. 1989; 173: 736-742Crossref PubMed Scopus (73) Google Scholar). Other functional implications of Q, such as in virulence of Shigella (42Durand J.M. Okada N. Tobe T. Watarai M. Fukuda I. Suzuki T. Nakata N. Komatsu K. Yoshikawa M. Sasakawa C. J. Bacteriol. 1994; 176: 4627-4634Crossref PubMed Google Scholar), signal transduction (43Morris R.C. Brooks B.J. Eriotou P. Kelly D.F. Sagar S. Hart K.L. Elliott M.S. Nucleic Acids Res. 1995; 23: 2492-2498Crossref PubMed Scopus (18) Google Scholar), ubiquitin-dependent proteolytic pathway (44Deshpande K.L. Seubert P.H. Tillman D.M. Farkas W.R. Katze J. Arch. Biochem. Biophys. 1996; 326: 1-7Crossref PubMed Scopus (20) Google Scholar), and tumor differentiation (45Okada N. Shindo-Okada N. Sato S. Itoh Y.H. Oda K.-I. Nishimura S. Proc. Natl. Acad. Sci. U. S. A. 1978; 75: 4247-4251Crossref PubMed Scopus (92) Google Scholar, 46Shindo-Okada N. Terada M. Nishimura S. Eur. J. Biochem. 1981; 115: 423-428Crossref PubMed Scopus (49) Google Scholar, 47Elliott M.S. Katze J.R. J. Biol. Chem. 1986; 261: 13019-13025Abstract Full Text PDF PubMed Google Scholar, 48Kretz K.A. Katze J.R. Trewyn R.W. Mol. Cell. Biol. 1987; 7: 3613-3619Crossref PubMed Scopus (16) Google Scholar), have also been suggested. The functional role of archaeosine has not been established, but has been proposed to involve enhanced stabilization of tRNA tertiary structure as a consequence of the unique charged imidino side chain (11Gregson J.M. Crain P.F. Edmonds C.G. Gupta R. Hashizume T. Phillipson D.W. McCloskey J.A. J. Biol. Chem. 1993; 268: 10076-10086Abstract Full Text PDF PubMed Google Scholar). Earlier work has demonstrated that hydrogen bonding interactions between G-15 in the D-loop and C-48 in the T-loop, stabilized by stacking with purine-59, constitute a generally conserved mechanism for stabilization of the universal folded L-shape of tRNA (49Rich A. RajBhandary U.L. Annu. Rev. Biochem. 1976; 45: 805-860Crossref PubMed Scopus (462) Google Scholar, 50Dock-Bregeon A.C. Westhof E. Giegé R. Moras D. J. Mol. Biol. 1989; 206: 707-722Crossref PubMed Scopus (65) Google Scholar). These structural features (G-15, C-48, purine-59) are basically met by nearly all reported archaeosine-containing tRNA sequences (7Sprinzl M. Steegborn C. Hübel F. Steinberg S. Nucleic Acids Res. 1996; 24: 68-72Crossref PubMed Scopus (160) Google Scholar), to which would be added the strong potential for electrostatic interactions between phosphate and the “arginine fork” imidino side chain of archaeosine. Interestingly, precursor bases used as substrates for both bacterial and archaeal TGTs participate in analogous biosynthetic pathways. Free preQ1 base has been isolated from E. coli (21Okada N. Noguchi S. Kasai H. Shindo-Okada N. Ohgi T. Goto T. Nishimura S. J. Biol. Chem. 1979; 254: 3067-3073Abstract Full Text PDF PubMed Google Scholar), and here we provide evidence for the presence of free preQ0base in H. volcanii. We believe that this free preQ0 base is likely to be the precursor exchanged into tRNA in the normal biosynthetic pathway leading to archaeosine, although, at present, we cannot strictly exclude the possibility that free preQ0 base detected is instead derived from archaeosine in tRNA. In E. coli, preQ1 base is synthesized from GTP (13Nishimura S. Prog. Nucleic Acid Res. Mol. Biol. 1983; 28: 49-73Crossref PubMed Scopus (126) Google Scholar), possibly via preQ0 (51Björk G.R. Prog. Nucleic Acids Res. Mol. Biol. 1995; 50: 263-338Crossref PubMed Scopus (79) Google Scholar), although there is presently no direct evidence for any precursor-product relationship between these two 7-deazaguanine bases. Presumably a similar pathway is present in H. volcanii for biosynthesis of preQ0 base from GTP. The key substrates following base replacement at the tRNA level, then, are preQ1 nucleotide (leading to queuosine in E. coli) and preQ0 nucleotide (leading to archaeosine inH. volcanii). It is noted that preQ0 nucleoside is present in tRNA of certain mutants of E. coli (51Björk G.R. Prog. Nucleic Acids Res. Mol. Biol. 1995; 50: 263-338Crossref PubMed Scopus (79) Google Scholar), the meaning of which has not yet been rationalized (14Noguchi S. Yamaizumi Z. Ohgi T. Goto T. Nishimura Y. Hirota Y. Nishimura S. Nucleic Acids Res. 1978; 5: 4215-4223Crossref PubMed Scopus (34) Google Scholar, 21Okada N. Noguchi S. Kasai H. Shindo-Okada N. Ohgi T. Goto T. Nishimura S. J. Biol. Chem. 1979; 254: 3067-3073Abstract Full Text PDF PubMed Google Scholar). The occurrence of these 7-deazaguanine precursor bases in both primary phylogenetic domains, archaea and bacteria, prompts us to speculate a more general role for them in cellular functions. In this respect, more detailed characterization of free preQ0 base (and possibly free preQ1 base) in H. volcanii cells is required. tRNA structural requirements for enzyme recognition remain to be identified. Preliminary experiments2 showed that an 18 nucleotide minihelix containing the D-loop and D-stem of H. volcaniitRNALys(CUU) does not serve as a substrate for H. volcanii TGT, implying the existence of higher order recognition elements for the archaeal TGT. By contrast, bacterial TGT recognizes the anticodon loop sequence U33-G34-U35, which is the minimum requirement for recognition by the enzyme, and minihelices containing this triplet sequence are good substrates for the enzyme (52Curnow A.W. Kung F.-L. Koch K.A. Garcia G.A. Biochemistry. 1993; 32: 5239-5246Crossref PubMed Scopus (71) Google Scholar, 53Nakanishi S. Ueda T. Hori H. Yamazaki N. Okada N. Watanabe K. J. Biol. Chem. 1994; 269: 32221-32225Abstract Full Text PDF PubMed Google Scholar). By x-ray crystallography, the tRNA-guanine transglycosylase fromZymomonas mobilis has been determined to be an irregular (α/β)8 barrel with a tightly attached C-terminal zinc-containing subdomain (54Romier C. Reuter K. Suck D. Ficner R. EMBO J. 1996; 15: 2850-2857Crossref PubMed Scopus (107) Google Scholar). Further, the structure of Z. mobilis TGT in complex with preQ1 suggests a binding mode for tRNA where the phosphate backbone interacts with the zinc subdomain and the U33-G34-U35sequence is recognized by the barrel. The zinc binding motif (CXCX 2CX 25H) is highly conserved in prokaryotic TGTs known so far (52Curnow A.W. Kung F.-L. Koch K.A. Garcia G.A. Biochemistry. 1993; 32: 5239-5246Crossref PubMed Scopus (71) Google Scholar), and the homologous region in M. jannaschii is (CXCX 2CX 22H). These results demonstrate a structural and functional conservation of the archaeal and bacterial/eukaryotic TGT binding mode with tRNA, despite archaeal modification of the D-loop and bacterial/eukaryotic modification of the anticodon loop. The utilization of 7-deazaguanine derivatives for tRNA processing by interrelated TGT enzymes suggests an evolutionarily fundamental role for 7-deazaguanine. In contrast to bacterial TGT (52Curnow A.W. Kung F.-L. Koch K.A. Garcia G.A. Biochemistry. 1993; 32: 5239-5246Crossref PubMed Scopus (71) Google Scholar, 55Curnow A.W. Garcia G.A. J. Biol. Chem. 1995; 270: 17264-17267Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar), productive recognition of tRNA by eukaryotic TGT requires not only the U33-G34-U35 sequence of the anticodon loop but also a correctly folded tRNA architecture (56Grosjean H. Edqvist J. Stråby K.B. Giegé R. J. Mol. Biol. 1996; 255: 67-85Crossref PubMed Scopus (107) Google Scholar). In addition, eukaryotic TGT is believed to be a heterodimer, although this is not conclusive at present (44Deshpande K.L. Seubert P.H. Tillman D.M. Farkas W.R. Katze J. Arch. Biochem. Biophys. 1996; 326: 1-7Crossref PubMed Scopus (20) Google Scholar, 57Slany R.K. Müller S.O. Eur. J. Biochem. 1995; 230: 221-228Crossref PubMed Scopus (18) Google Scholar). More detailed examination of the substrate recognition properties of TGTs from archaea, bacteria, and eukaryotes will elucidate the domain structures of these proteins for the tRNA binding site, as well as further define their evolutionary relationship. We thank Dr. Yoshihiro Fukumori and Takemoto Fujiwara of the Tokyo Institute of Technology for help with the culture of H. volcanii and Dr. Kunio Ihara of Nagoya University for useful discussions." @default.
• W2118038862 created "2016-06-24" @default.
• W2118038862 creator A5004277090 @default.
• W2118038862 creator A5008889701 @default.
• W2118038862 creator A5024516831 @default.
• W2118038862 creator A5051249159 @default.
• W2118038862 creator A5053311852 @default.
• W2118038862 creator A5066475635 @default.
• W2118038862 creator A5069150096 @default.
• W2118038862 creator A5070111509 @default.
• W2118038862 creator A5070279470 @default.
• W2118038862 creator A5073866709 @default.
• W2118038862 creator A5076002757 @default.
• W2118038862 date "1997-08-01" @default.
• W2118038862 modified "2023-09-30" @default.
• W2118038862 title "Biosynthesis of Archaeosine, a Novel Derivative of 7-Deazaguanosine Specific to Archaeal tRNA, Proceeds via a Pathway Involving Base Replacement on the tRNA Polynucleotide Chain" @default.
• W2118038862 cites W1480395323 @default.
• W2118038862 cites W1500112384 @default.
• W2118038862 cites W1521518169 @default.
• W2118038862 cites W1525483793 @default.
• W2118038862 cites W1536188911 @default.
• W2118038862 cites W1540521265 @default.
• W2118038862 cites W1553518074 @default.
• W2118038862 cites W1571751680 @default.
• W2118038862 cites W1587615515 @default.
• W2118038862 cites W1603916956 @default.
• W2118038862 cites W1728556152 @default.
• W2118038862 cites W1802135738 @default.
• W2118038862 cites W1847098232 @default.
• W2118038862 cites W1883822388 @default.
• W2118038862 cites W1940525454 @default.
• W2118038862 cites W1971360355 @default.
• W2118038862 cites W1971770535 @default.
• W2118038862 cites W1984854823 @default.
• W2118038862 cites W1986684758 @default.
• W2118038862 cites W1994496520 @default.
• W2118038862 cites W2003618100 @default.
• W2118038862 cites W2008450625 @default.
• W2118038862 cites W2036875309 @default.
• W2118038862 cites W2039097179 @default.
• W2118038862 cites W2041209593 @default.
• W2118038862 cites W2042132142 @default.
• W2118038862 cites W2050392440 @default.
• W2118038862 cites W2052933178 @default.
• W2118038862 cites W2054735031 @default.
• W2118038862 cites W2059081846 @default.
• W2118038862 cites W2061847800 @default.
• W2118038862 cites W2062120671 @default.
• W2118038862 cites W2077222517 @default.
• W2118038862 cites W2079920970 @default.
• W2118038862 cites W2086969519 @default.
• W2118038862 cites W2089339494 @default.
• W2118038862 cites W2091244719 @default.
• W2118038862 cites W2091540783 @default.
• W2118038862 cites W2094755717 @default.
• W2118038862 cites W2125336477 @default.
• W2118038862 cites W2142443813 @default.
• W2118038862 cites W2162906563 @default.
• W2118038862 cites W2165082607 @default.
• W2118038862 cites W2166865790 @default.
• W2118038862 cites W2178112091 @default.
• W2118038862 cites W2909705551 @default.
• W2118038862 cites W4211164196 @default.
• W2118038862 cites W4233212068 @default.
• W2118038862 cites W4238022135 @default.
• W2118038862 cites W4239833500 @default.
• W2118038862 cites W941293345 @default.
• W2118038862 cites W954872439 @default.
• W2118038862 doi "https://doi.org/10.1074/jbc.272.32.20146" @default.
• W2118038862 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9242689" @default.
• W2118038862 hasPublicationYear "1997" @default.
• W2118038862 type Work @default.
• W2118038862 sameAs 2118038862 @default.
• W2118038862 citedByCount "75" @default.
• W2118038862 countsByYear W21180388622012 @default.
• W2118038862 countsByYear W21180388622013 @default.
• W2118038862 countsByYear W21180388622014 @default.
• W2118038862 countsByYear W21180388622015 @default.
• W2118038862 countsByYear W21180388622016 @default.
• W2118038862 countsByYear W21180388622017 @default.
• W2118038862 countsByYear W21180388622018 @default.
• W2118038862 countsByYear W21180388622019 @default.
• W2118038862 countsByYear W21180388622020 @default.
• W2118038862 countsByYear W21180388622021 @default.
• W2118038862 countsByYear W21180388622023 @default.
• W2118038862 crossrefType "journal-article" @default.
• W2118038862 hasAuthorship W2118038862A5004277090 @default.
• W2118038862 hasAuthorship W2118038862A5008889701 @default.
• W2118038862 hasAuthorship W2118038862A5024516831 @default.
• W2118038862 hasAuthorship W2118038862A5051249159 @default.
• W2118038862 hasAuthorship W2118038862A5053311852 @default.
• W2118038862 hasAuthorship W2118038862A5066475635 @default.
• W2118038862 hasAuthorship W2118038862A5069150096 @default.
• W2118038862 hasAuthorship W2118038862A5070111509 @default.
• W2118038862 hasAuthorship W2118038862A5070279470 @default.
• W2118038862 hasAuthorship W2118038862A5073866709 @default.
• W2118038862 hasAuthorship W2118038862A5076002757 @default.
• W2118038862 hasBestOaLocation W21180388621 @default.

• next