FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2123392242> ?p ?o ?g. }

• W2123392242 endingPage "5256" @default.
• W2123392242 startingPage "5249" @default.
• W2123392242 abstract "Trichomonas is an amitochondriate parasitic protozoon specialized for an anaerobic lifestyle. Nevertheless, it is exposed to oxygen and is able to cope with the resultant oxidative stress. In the absence of glutathione, cysteine has been thought to be the major antioxidant. We now report that the parasite contains thioredoxin reductase, which functions together with thioredoxin and thioredoxin peroxidase to detoxify potentially damaging oxidants. Thioredoxin reductase and thioredoxin also reduce cystine and so may play a role in maintaining the cellular cysteine levels. The importance of the thioredoxin system as one of the major antioxidant defense mechanisms in Trichomonas was confirmed by showing that the parasite responds to environmental changes resulting in increased oxidative stress by up-regulating thioredoxin and thioredoxin peroxidases levels. Sequence data indicate that the thioredoxin reductase of Trichomonas differs fundamentally in structure from that of its human host and thus may represent a useful drug target. The protein is generally similar to thioredoxin reductases present in other lower eukaryotes, all of which probably originated through horizontal gene transfer from a prokaryote. The phylogenetic signal in thioredoxin peroxidase is weak, but evidence from trees suggests that this gene has been subject to repeated horizontal gene transfers from different prokaryotes to different eukaryotes. The data are thus consistent with the complexity hypothesis that predicts that the evolution of simple pathways such as the thioredoxin cascade are likely to be affected by horizontal gene transfer between species. Trichomonas is an amitochondriate parasitic protozoon specialized for an anaerobic lifestyle. Nevertheless, it is exposed to oxygen and is able to cope with the resultant oxidative stress. In the absence of glutathione, cysteine has been thought to be the major antioxidant. We now report that the parasite contains thioredoxin reductase, which functions together with thioredoxin and thioredoxin peroxidase to detoxify potentially damaging oxidants. Thioredoxin reductase and thioredoxin also reduce cystine and so may play a role in maintaining the cellular cysteine levels. The importance of the thioredoxin system as one of the major antioxidant defense mechanisms in Trichomonas was confirmed by showing that the parasite responds to environmental changes resulting in increased oxidative stress by up-regulating thioredoxin and thioredoxin peroxidases levels. Sequence data indicate that the thioredoxin reductase of Trichomonas differs fundamentally in structure from that of its human host and thus may represent a useful drug target. The protein is generally similar to thioredoxin reductases present in other lower eukaryotes, all of which probably originated through horizontal gene transfer from a prokaryote. The phylogenetic signal in thioredoxin peroxidase is weak, but evidence from trees suggests that this gene has been subject to repeated horizontal gene transfers from different prokaryotes to different eukaryotes. The data are thus consistent with the complexity hypothesis that predicts that the evolution of simple pathways such as the thioredoxin cascade are likely to be affected by horizontal gene transfer between species. Trichomonas vaginalis is the protozoan parasite responsible for trichomoniasis in humans (1Petrin D. Delgaty K. Bhatt R. Garber G. Clin. Microbiol. Rev. 1998; 11: 300-317Crossref PubMed Google Scholar). This is the most common non-viral sexually transmitted infection, with an estimated >170 million cases occurring each year (2World Health Organization Global Prevalence and Incidence of Selected Curable Sexually Transmitted Diseases: Overview and Estimates. 2001; (WHO/CDS/CSR/EDC/2001.10)Google Scholar), and has been implicated as a major risk factor in predisposition to human immunodeficiency virus/AIDS (3Sorvillo F. Smith L. Kerndt P. Ash L Emerg. Infect. Dis. 2001; 7: 927-932Crossref PubMed Scopus (202) Google Scholar). Indeed it has been suggested that successful treatment of trichomoniasis may be the most cost-effective means by which to reduce human immunodeficiency virus incidence (3Sorvillo F. Smith L. Kerndt P. Ash L Emerg. Infect. Dis. 2001; 7: 927-932Crossref PubMed Scopus (202) Google Scholar). Current chemotherapy relies upon a single group of drugs, the 5-nitroimidazoles, and there are worrying signs that drug resistance may be emerging as a significant problem (4Upcroft P. Upcroft J.A. Clin. Microbiol. Rev. 2001; 14: 150-164Crossref PubMed Scopus (433) Google Scholar). Thus there is a need for new chemotherapeutic tools. The parasite itself is an unusual eukaryote and has been considered to be one of the earliest branching organisms (5Sogin M.L. Curr. Opin. Genet. Dev. 1997; 7: 792-799Crossref PubMed Scopus (73) Google Scholar), although current evidence for this view is not compelling (6Baldauf S.L. Roger A.J. Wenk-Siefert I. Doolittle W.F. Science. 2000; 290: 972-977Crossref PubMed Scopus (975) Google Scholar, 7Embley T.M. Hirt R.P. Curr. Opin. Genet. Dev. 1998; 8: 624-629Crossref PubMed Scopus (231) Google Scholar, 8Roger A.J. Am. Nat. 1999; 154: S146-S163Crossref PubMed Google Scholar). It lacks conventional mitochondria but possesses organelles termed hydrogenosomes that share common ancestry with mitochondria (9Dyall S.D. Johnson P.J. Curr. Opin. Microbiol. 2000; 3: 404-411Crossref PubMed Scopus (109) Google Scholar, 10van der Giezen M. Slotboom D.J. Horner D.S. Dyal P.L. Harding M. Xue G.P. Embley T.M. Kunji E.R. EMBO J. 2002; 21: 572-579Crossref PubMed Scopus (80) Google Scholar) and appear to be adaptations for the parasite's existence in an environment containing only low oxygen concentrations. Trichomonads are fundamentally fermentative organisms, with oxygen apparently not making a significant contribution to energy metabolism (11Martin W. Muller M. Nature. 1998; 392: 37-41Crossref PubMed Scopus (905) Google Scholar). Nevertheless, the cells are exposed to oxygen in the natural environment. This was most elegantly demonstrated by the finding that T. vaginalis isolated from patients unresponsive to the standard chemotherapy treatment with metronidazole is drug-resistant in in vitro tests, but only if oxygen is present (4Upcroft P. Upcroft J.A. Clin. Microbiol. Rev. 2001; 14: 150-164Crossref PubMed Scopus (433) Google Scholar, 12Rasoloson D. Tomkova E. Cammack R. Kulda J. Tachezy J. Parasitology. 2001; 123: 45-56Crossref PubMed Scopus (48) Google Scholar, 13Rasoloson D. Vanacova S. Tomkova E. Razga J. Hrdy I. Tachezy J. Kulda J. Microbiology. 2002; 148: 2467-2477Crossref PubMed Scopus (69) Google Scholar, 14Land K.M. Johnson P.J. Drug Res. Updates. 1999; 2: 289-294Crossref PubMed Scopus (65) Google Scholar). The implications for T. vaginalis of exposure to oxygen have been pondered over many years. Despite a report of the beneficial effect of low oxygen concentrations (growth being significantly enhanced (15Paget T.A. Lloyd D. Mol. Biochem. Parasitol. 1990; 41: 65-72Crossref PubMed Scopus (49) Google Scholar)), it is generally considered that oxygen provides problems rather than benefits. Some of the parasite's enzymes are inactivated by oxygen itself, notably key proteins of the hydrogenosomes, and various metabolites likely to arise from the metabolism of oxygen (such as hydrogen peroxide and hydroxyl free radical) are generally harmful to cells and so need to be countered. Most eukaryotes have glutathione as a key redox buffer and antioxidant, but trichomonads lack this and similar thiols (16Ellis J.E. Yarlett N. Cole D. Humphreys M.J. Lloyd D. Microbiology. 1994; 140: 2489-2494Crossref PubMed Scopus (68) Google Scholar). Thus cysteine has been considered the major cellular reducing agent and antioxidant, although T. vaginalis is able to generate thiols (propanethiol, methanethiol, and hydrogen sulfide, from the action of the unusual bacterial-like enzyme methionine-γ-lyase (17McKie A.E. Edlind T. Walker J. Mottram J.C. Coombs G.H. J. Biol. Chem. 1998; 273: 5549-5556Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar)), which have been postulated to have antioxidant roles (16Ellis J.E. Yarlett N. Cole D. Humphreys M.J. Lloyd D. Microbiology. 1994; 140: 2489-2494Crossref PubMed Scopus (68) Google Scholar). Nevertheless, it was believed that the organism relies heavily upon cytosolic NADH oxidase (reducing oxygen to water) and NADPH oxidase (reducing oxygen to hydrogen peroxide) to prevent permeation of oxygen to the hydrogenosomes (18Linstead D.J. Bradley S. Mol. Biochem. Parasitol. 1988; 27: 125-133Crossref PubMed Scopus (45) Google Scholar). However, the generation of hydrogen peroxide by NADPH oxidase, and superoxide dismutase, poses the question as to how this and other reactive oxygen species (ROS) 1The abbreviations used are: ROSreactive oxygen speciesTRXRgene encoding thioredoxin reductaseTrxRprotein encoded by TRXRrTrxRrecombinant TrxR (equivalent nomenclature is used for thioredoxin (Trx) and thioredoxin peroxidase (TrxP) TrxP is also known as peroxiredoxin)DTNB5,5′-dithiobis(2-nitrobenzoic acid)E-64N-trans-epoxysuccinyl-l-leucine-4-guanidinobutylamideHGThorizontal gene transferESTexpressed sequence tagRACErapid amplification of cDNA endMLmaximum likelihood. are removed as T. vaginalis lacks catalase and glutathione-dependent peroxidase activities. An ascorbate peroxidase has been reported (19Page-Sharp M. Behm C.A. Smith G.D. Microbiology. 1996; 142: 207-211Crossref PubMed Scopus (21) Google Scholar), but it seemed likely that another system must also exist. reactive oxygen species gene encoding thioredoxin reductase protein encoded by TRXR recombinant TrxR (equivalent nomenclature is used for thioredoxin (Trx) and thioredoxin peroxidase (TrxP) TrxP is also known as peroxiredoxin) 5,5′-dithiobis(2-nitrobenzoic acid) N-trans-epoxysuccinyl-l-leucine-4-guanidinobutylamide horizontal gene transfer expressed sequence tag rapid amplification of cDNA end maximum likelihood. A family of peroxidases has been discovered in recent years that do not use glutathione as the reductant but instead are dependent on reduction by a small protein known as thioredoxin (Trx), which is itself reduced by thioredoxin reductase (TrxR) (20Chae H.Z. Chung S.J. Rhee S.G. J. Biol. Chem. 1994; 269: 27670-27678Abstract Full Text PDF PubMed Google Scholar, 21Netto L.E.S. Chae H.Z. Kang S.W. Rhee S.G. Stadtman E.R. J. Biol. Chem. 1996; 271: 15315-15321Abstract Full Text Full Text PDF PubMed Scopus (204) Google Scholar, 22Rhee S.G. Kang S.W. Netto L.E. Seo M.S. Stadtman E.R. Biofactors. 1999; 10: 207-209Crossref PubMed Scopus (157) Google Scholar). These Trx-dependent peroxidases, now commonly known as peroxiredoxins (designated TrxP), are seemingly ubiquitous in eukaryotes with there being a number of isoforms localized in different cellular compartments (22Rhee S.G. Kang S.W. Netto L.E. Seo M.S. Stadtman E.R. Biofactors. 1999; 10: 207-209Crossref PubMed Scopus (157) Google Scholar, 23Chae H.Z. Kang S.W. Rhee S.G. Methods Enzymol. 1999; 300: 219-226Crossref PubMed Scopus (202) Google Scholar, 24Park S.G. Cha M.K. Jeong W. Kim I.H. J. Biol. Chem. 2000; 275: 5723-5732Abstract Full Text Full Text PDF PubMed Scopus (202) Google Scholar, 25Mouaheb N. Thomas D. Verdoucq L. Monfort P. Meyer Y. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 3312-3317Crossref PubMed Scopus (108) Google Scholar, 26Hoffmann B. Hecht H.J. Flohe L. Biol. Chem. 2002; 383: 347-364PubMed Google Scholar). It has been shown that peroxiredoxins reduce hydrogen peroxide and alkyl hydroperoxides and therefore constitute a major cellular protection system against the devastating consequences of oxidative damage (20Chae H.Z. Chung S.J. Rhee S.G. J. Biol. Chem. 1994; 269: 27670-27678Abstract Full Text PDF PubMed Google Scholar, 26Hoffmann B. Hecht H.J. Flohe L. Biol. Chem. 2002; 383: 347-364PubMed Google Scholar). Peroxiredoxin-linked detoxification may occur in all eukaryotes but has been perceived to be of special relevance to some parasites, including helminths, trypanosomatids, and the malaria parasite Plasmodium falciparum, as a crucial means of detoxifying peroxides in the apparent absence of enzymes such as catalase and glutathione peroxidases (26Hoffmann B. Hecht H.J. Flohe L. Biol. Chem. 2002; 383: 347-364PubMed Google Scholar, 27Selkirk M.E. Smith V.P. Thomas G.R. Gounaris K. Int. J. Parasitol. 1998; 28: 1315-1332Crossref PubMed Scopus (107) Google Scholar, 28Krauth-Siegel R.L. Coombs G.H. Parasitol. Today. 1999; 15: 404-409Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar, 29Hirt R.P. Müller S. Embley T.M. Coombs G.H. Trends Parasitol. 2002; 18: 302-308Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar, 30Müller S. Liebau E. Walter R.D. Krauth-Siegel R.L. Trends Parasitol. 2003; 19: 320-328Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar). Such metabolism may be of particular importance to amitochondriate eukaryotes, such as the protozoa Entamoeba and Giardia as well as Trichomonas, because they all lack glutathione (30Müller S. Liebau E. Walter R.D. Krauth-Siegel R.L. Trends Parasitol. 2003; 19: 320-328Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar, 31Flohe L. Hecht H.J. Steinert P. Free Radic. Biol. Med. 1999; 27: 966-984Crossref PubMed Scopus (184) Google Scholar). Interestingly, Entamoeba histolytica possesses a peroxiredoxin-linked detoxification system that is functionally similar to the bacterial AhpF/AhpC system in that it does not involve thioredoxin as an intermediate electron acceptor (32Bruchhaus I. Richter S. Tannich E. Biochem. J. 1997; 326: 785-789Crossref PubMed Scopus (88) Google Scholar, 33Bruchhaus I. Richter S. Tannich E. Biochem. J. 1998; 330: 1217-1221Crossref PubMed Scopus (61) Google Scholar). Giardia lamblia has also been reported to contain TrxR (34Brown D.M. Upcroft J.A. Upcroft P. Mol. Biochem. Parasitol. 1995; 72: 47-56Crossref PubMed Scopus (58) Google Scholar), but the way in which the enzyme functions has not yet been addressed. This study was undertaken both to elucidate whether a peroxiredoxin cascade involving TrxR and Trx is a fundamental antioxidant mechanism of T. vaginalis and to investigate whether the biochemical characteristics of the components of the cascade provide optimism that it may be a drug target. Because the complexity hypothesis (35Jain R. Rivera M.C. Lake J.A. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 3801-3806Crossref PubMed Scopus (886) Google Scholar) predicts that horizontal gene transfer (HGT) between species should particularly affect simple systems like peroxiredoxin cascades, we also investigated the evolutionary origins of the Trichomonas genes. Growth and Harvesting of Parasites—A clonal cell line (G3) of T. vaginalis was routinely grown axenically in modified Diamond's medium and harvested as previously described (17McKie A.E. Edlind T. Walker J. Mottram J.C. Coombs G.H. J. Biol. Chem. 1998; 273: 5549-5556Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar). Parasites were either stored as cell pellets at –70 °C for the Western blot analyses and genomic DNA isolation or suspended in TRIzol reagent (Invitrogen) for the RNA preparations and analyses. Cloning of TRXR, TRX, and TRXP of T. vaginalis—Genes apparently corresponding to TRXR, TRX, and TRXP were identified in an EST data base of T. vaginalis G3. 2R. P. Hirt and T. M. Embley, unpublished data. Total RNA was prepared from T. vaginalis G3 using the SV Total RNA Isolation System (Promega). The 5′ RACE system (Invitrogen) was used to clone the 5′-ends of the TRX, TRXR, and TRXP mRNAs. Nested gene-specific primers were designed based on EST sequences. Those used for first strand cDNA synthesis and amplification of cDNA, respectively, were NT3 and NT4 (for TRXR), NT5 and NT6 (for TRX), and NT7 and NT15 (for TRXP) as detailed in Table I. PCR was performed using Pfu DNA polymerase (Promega) and the following conditions: 94 °C for 5 min; 30 cycles of 94 °C for 30 s, 66 °C for 30 s, and 72 °C for 3 min; then 72 °C for 7 min. PCR products were cloned into vector pGEM-T (Promega) and sequenced. The sequence of the 5′-end of each mRNA, including the translation initiation codon, was determined by analyzing the sequence of at least two PCR products from each of two independent 5′ RACE experiments.Table IOligonucleotides usedNT1CGTCAGCATATGTCTGCTCAAGCATTCGNT2TATAGCGGCCGCGTCACTGAGATATCTNT3GGCTGTAGCACCTGTAGCGNT4GCCCATATCGGTCTCGAGGCGNT5GCGAGAAACATCAGCACCNT6CAGCACCAACAAACTGATCTAATGTCNT7GTGGCGGATGATGCCCTCTNT10CAGTGACATATGTCCGATCCAATTGTTCACTTCAATGGCACTCACGAAGCTNT11GACACTCGAGTTTGAACTTTTCAATATCAGCTTTGATGCNT12CAGTGACATATGCTTGTTGGCAAACCAGCTCCAGCATTCAAGGNT15CCGAGATCGCCGATAAGTGGGTANT28GACACTCGAGGTTGTTAGCCTTTCCGAAG Open table in a new tab The full-length TRX coding region was amplified from EST 144 using primers NT10 and NT11 and the PCR conditions detailed above for the 5′ RACE. The primers contain restriction sites to facilitate cloning of the PCR product into the expression vector pET21a+. The PCR product was digested with NdeI and XhoI and ligated to NdeI- and XhoI-digested pET21a+ to generate pBP1. In the same way and using the same PCR conditions, the full-length TRXP coding region was amplified from EST450 using primers NT12 and NT28 and cloned into pET21a+ to give pBP24. The TRXR coding region was amplified from total RNA by reverse transcriptase-PCR. First strand cDNA was synthesized using Superscript II reverse transcriptase (Invitrogen) and oligo(d(T)15) as a primer, according to the manufacturer's instructions. The TRXR was amplified using primers NT1 and NT2 and the Expand High Fidelity PCR system (Roche Applied Science) (94 °C for 2 min, 25 cycles of 94 °C for 15 s, 55 °C for 30 s, and 72 °C for 2 min, 72 °C for 7 min) and cloned into pGEM-T. The 0.92-kb NdeI and NotI fragment containing the full-length TRXR sequence was ligated into pET21a+ previously digested with the same enzymes to give pBP3. The sequence of each construct was confirmed on both strands by the University of Glasgow MBSU Sequencing Facility. Sequence analysis was carried out using Vector NTI software (Informax). Plasmids were introduced into Escherichia coli strain BL21/DE3 for protein expression. Recombinant proteins have a C-terminal 6× histidine tag to facilitate purification using Ni2+-nitrilotriacetic acid-agarose. Phylogenetic Analyses of TrxR, Trx, and TrxP—The T. vaginalis Trx (112 residues)-, TrxR (304 residues)-, and TrxP (196 residues)-translated proteins were aligned to reference proteins extracted from the NCBI databases, using ClustalW (36Thompson J.D. Higgins D.G. Gibson T.J. Nucleic Acids Res. 1994; 22: 4673-4680Crossref PubMed Scopus (56002) Google Scholar). Protein alignments were edited manually using GDE2.2 (37Maidak B.L. Olsen G.J. Larsen N. Overbeek R. McCaughey M.J. Woese C.R. Nucleic Acids Res. 1996; 24: 82-85Crossref PubMed Scopus (476) Google Scholar). Ambiguously aligned positions and sites where more than 25% of sequences contained an insertion/deletion (indels) were removed using the mask function prior to phylogenetic analyses. When ambiguous sites and indels were removed for the broadest taxonomic sampling for TrxR (74 taxa), a dataset of 268 sites was left for analysis. A second alignment of 284 selected sites was also used for a reduced taxa set (38 taxa). Phylogenetic analyses of these two datasets recovered essentially identical topologies for the shared taxa. The programs TREE-PUZZLE 5.0 (38Strimmer K. von Haeseler A. Mol. Biol. Evol. 1996; 13: 964-969Crossref Scopus (2276) Google Scholar) and MRBAYES (39Huelsenbeck J.P. Ronquist F. Bioinformatics. 2001; 17: 754-755Crossref PubMed Scopus (19396) Google Scholar) were used to perform protein maximum likelihood (ML) and Bayesian analyses. To assess support for relationships we used bootstrapping of protein maximum likelihood distances using the script PUZZLEBOOT (available from the author Andrew Roger at hades.biochem.dal.ca/Rogerlab/) in combination with SEQBOOT and NEIGHBOUR. 3J. Felsenstein (1993) PHYLIP (Phylogeny Inference Package) version 3.5c. Distributed by the author (Seattle, Dept. of Genetics, University of Washington). These analyses used the JTT substitution matrix with site-rate heterogeneity expressed by a gamma correction, including a fraction of potentially invariable sites. The parameters for the gamma correction were estimated using TREE-PUZZLE 5.0. The same analytical approaches were used to analyze the TrxP dataset comprising 47 taxa and 175 aligned positions. To investigate the support for alternative phylogenetic positions for the T. vaginalis TrxR and TrxP sequences, for example for their monophyly with the diplomonad parasites G. lamblia and Spironucleus barkhanus sequences, we performed constrained parsimony analyses in PAUP4.0b8. The MP trees for each hypothesis were then evaluated for their maximum likelihood values using the Shimodara Hasegawa test (41Shimodaira H. Hasegawa M. Mol. Biol. Evol. 1999; 16: 1114-1116Crossref Scopus (3480) Google Scholar) implemented in the p4 software (Peter Foster, The Natural History Museum, London). Northern Blot Analyses—Total RNA from 2 × 107T. vaginalis was fractionated by electrophoresis on 1.2% (w/v) agarose formaldehyde gels and transferred to Hybond-N membranes (Amersham Biosciences). [α-32P]dATP-labeled DNA probes were prepared from agarose gel-purified restriction endonuclease fragments using Prime-IT II random primer kit (Stratagene) and purified on Microspin S-200 HR columns (Amersham Biosciences). The probes used were: TRXR, a 0.8-kb XhoI fragment of EST 610; TRXP, a 0.5-kb EcoRI/XhoI fragment of EST 450; TRX, a 0.8-kb PruII fragment of EST 144; α-actin, a 1.2-kb EcoRI/XhoI fragment of EST 197. Hybridizations were performed at 42 °C overnight in 5× SSPE, 5× Denhardt's solution, 50% formamide, 0.5% SDS, and 100 μg/ml denatured salmon sperm DNA. Filters were washed twice for 10 min at room temperature in 2× SSC, 0.5% (w/v) SDS, and twice for 30 min at 55 °C in 0.1× SSC, 0.1% SDS. Storage phosphor screens were exposed to the labeled filters and scanned using a Typhoon 8600 Imager (Amersham Biosciences). Levels of mRNA were quantified using ImageQuaNT image analysis software (Amersham Biosciences). Filters were stripped with boiling 0.1% SDS, rinsed with 2× SSC, and reprobed. The T. vaginalis α-actin mRNA levels were used to normalize TRX, TRXR, and TRXP mRNA levels. Normalized mRNA levels in the treated cultures were expressed relative to the control culture, which was given an arbitrary value of 1.0 unit. Production of Recombinant TrxR, Trx, and TrxP—Single colonies of BL21/DE3 harboring pBP1, pBP3, and pBP24, respectively, were grown in Luria Bertani medium, the expression of the recombinant proteins was induced with 1 mm isopropyl thio-β-d-galactoside, and recombinant proteins purified using Ni2+-nickel-nitrilotriacetic acid-agarose (Qiagen) according to the manufacturer's recommendations using a BioCad fast protein liquid chromatography system. The eluted proteins (rTrxR, rTrx, and rTrxP) were stored at 4 °C with 0.02% azide. They remained highly active, as assessed by the enzymatic analysis, for more than 2 months. rTrxR concentration was assessed by using the molar extinction coefficient of 11,300 m–1 cm–1 at 453 nm (42Williams Jr., C.H. Zanetti G. Arscott L.D. McAllister J.K. J. Biol. Chem. 1967; 242: 5226-5231Abstract Full Text PDF PubMed Google Scholar). rTrx concentration was determined by using the molar extinction coefficient of 13,700 m–1 cm–1 at 280 nm (43Krnajski Z. Gilberger T.W. Walter R.D. Müller S. Mol. Biochem. Parasitol. 2001; 112: 219-228Crossref PubMed Scopus (43) Google Scholar). rTrxP concentration was determined using the BCA protein assay microtitre plate method (Pierce), with bovine serum albumin as standard. Western Blot Analyses—Polyclonal antisera were raised in rabbits against purified rTrx, rTrxR, and rTrxP by the Scottish Antibody Production Unit (Carluke, UK) using standard immunization protocols. T. vaginalis lysates were prepared by resuspending cells in ice-cold lysis buffer (0.25 m sucrose, 0.25% (v/v) Triton X-100, 10 μmN-trans-epoxysuccinyl-l-leucine-4-guanidinobutylamide (E-64), 2 mm 1,10-phenanthroline, 4 μm pepstatin A, and 1 mm phenylmethylsulfonyl fluoride) to the equivalent of 108 cells/ml and lysed by repeated aspiration via a 1-ml micropipette. Cell debris was removed by centrifugation at 12,000 × g for 10 min at 4 °C, and soluble protein in the supernatant was quantified using a BCA protein assay microtitre plate method (Pierce). Soluble proteins were fractionated on 12% (w/v) polyacrylamide SDS-PAGE and electroblotted onto ECL nitrocellulose membranes (Amersham Biosciences). Membranes were blocked for 2 h at room temperature in Tris-buffered saline (TBS) containing 5% (w/v) milk and 0.2% Tween 20 and subsequently incubated overnight at 4 °C with specific polyclonal antisera diluted 1:10,000 in TBS containing 1% (w/v) milk and 0.1% Tween 20. Bound antibodies were detected using peroxidase-linked anti-rabbit IgG (1:2000 dilution in 10× TBS containing 1% (w/v) milk powder) and ECL reagents (Pierce). Enzyme Assays—TrxR activity was measured by monitoring the oxidation of NADPH at 340 nm in a reaction mixture comprising 0.1 m potassium phosphate, pH 7.0, 5 mm EDTA, 0.2 mm NADPH, 200 μg/ml insulin (bovine pancreas, 28.1 USP units/mg, Sigma), 12.5 μm rTrx, and 44 pmol of rTrxR. The reaction was initiated by addition of the rTrx (44Holmgren A. J. Biol. Chem. 1979; 254: 9627-9632Abstract Full Text PDF PubMed Google Scholar, 45Luthman M. Holmgren A. Biochemistry. 1982; 21: 6628-6633Crossref PubMed Scopus (510) Google Scholar). The Km value for rTrx was estimated by varying the rTrx concentrations from 0.07 to 22 μm. rTrxP activity was measured by monitoring the oxidation of NADPH at 340 nm in a reaction mixture comprising 0.1 m potassium phosphate, pH 7.0, 5 mm EDTA, 0.2 mm NADPH, 12.5 μm rTrx, 74 pmol of rTrxR, 3 nmol of rTrxP, and 20 μm peroxide (hydrogen peroxide, tert-butylhydroperoxide or cumene hydroperoxide). The reaction was initiated by the addition of the peroxide. NADPH oxidase activity was determined by monitoring the oxidation of NADPH at 340 nm in reaction mixtures comprising 0.1 m potassium phosphate, pH 7.0 or 9.0, 5 mm EDTA, 0.2 mm NADPH, and 148 pmol of rTrxR. 5,5′-Dithiobis(2-nitrobenzoic acid) (DTNB) reductase activity was measured by monitoring the production of thionitrobenzoate at 412 nm in a reaction mixture comprising 0.1 m potassium phosphate, pH 7.0, 5 mm EDTA, 0.2 mm NADPH, 5 mm DTNB, and 44 pmol of rTrxR. Specific activity for the reaction was calculated according to Holmgren (46Holmgren A J. Biol. Chem. 1977; 252: 4600-4606Abstract Full Text PDF PubMed Google Scholar) using the molar extinction coefficient at 412 nm as 2 × 13,600 m–1 cm–1 as 1 mol of NADPH yields 2 mol of thionitrobenzoate. Cystine reductase activity of the TrxR/Trx couple was measured by monitoring the oxidation of NADPH at 340 nm in a reaction mixture comprising 0.1 m potassium phosphate, pH 7.0, 5 mm EDTA, 0.2 mm NADPH, 12.5 μm rTrx, 44 pmol of rTrxR and varying concentrations of l-cystine (5–50 μm). All assays were performed at 37 °C. Kinetic calculations were performed using the computer program Grafit (Erithacus Software). The Effects of Growth Conditions upon the Expression of TrxR, Trx, and TrxP in T. vaginalis—Parasites were grown in 25 ml of medium in tightly capped universal tubes with little gas phase, except for the “aerobic” cultures, which were grown in 500-ml tissue culture vessels with loose caps in a normally aspirated incubator. Under these aerobic conditions, growth over 18 h was reduced by 62% compared with control anaerobic cultures. The standard modified Diamond's medium was varied by removal of ascorbate (normally present at 5.7 mm) or addition of l-cysteine, l-serine, or l-methionine to 10 mm. None of these significantly affected growth over 18 h. Cultures were initiated at 105 parasites/ml, and incubation was for l8 h at 37 °C, whereupon the parasites were harvested, washed, and stored as pellets at –70 °C until analysis (17McKie A.E. Edlind T. Walker J. Mottram J.C. Coombs G.H. J. Biol. Chem. 1998; 273: 5549-5556Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar). Isolation and Characterization of TRXR of T. vaginalis—The identification of an EST from T. vaginalis with strong sequence similarity to TRXR simplified the isolation of the full-length cDNA. The initiation methionine was confirmed by using 5′ RACE on mRNA. TRXR of T. vaginalis (accession number AJ507831) is predicted to encode a protein (TrxR) of 304 amino acids, with a subunit molecular mass of 32.4 kDa. Thus the enzyme is similar in size to low molecular weight TrxRs (designated L-TrxR) characteristic of bacteria, plants, and many lower eukaryotes. These proteins differ fundamentally from the high molecular weight TrxRs (designated H-TrxR) of humans and some other eukaryotes, including P. falciparum (29Hirt R.P. Müller S. Embley T.M. Coombs G.H. Trends Parasitol. 2002; 18: 302-308Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar, 47Williams Jr., C.H. Arscott L.D. Müller S. Lennon B.W. Ludwig M.L. Wang P.F. Veine D.M. Becker K. Schirmer R.H. Eur. J. Biochem. 2000; 267: 6110-6117Crossref PubMed Scopus (285) Google Scholar). Analysis of the predicted amino acid sequences of the T. vaginalis TrxR confirmed that it indeed belongs to the L-TrxR group and is distinct from both the H-TrxR group and the AhpFs of bacteria. An alignment of the TrxR of T. vaginalis with other L-TrxRs shows that it possesses the key active site cysteine residues (boxed in Fig. 1). The level of identity with other L-TrxRs (G. lamblia, accession number AJ507833; E. histolytica, CAA56112; Saccharomy" @default.
• W2123392242 created "2016-06-24" @default.
• W2123392242 creator A5000896896 @default.
• W2123392242 creator A5024173243 @default.
• W2123392242 creator A5030104872 @default.
• W2123392242 creator A5051065452 @default.
• W2123392242 creator A5052527219 @default.
• W2123392242 creator A5075315348 @default.
• W2123392242 creator A5086891018 @default.
• W2123392242 creator A5087971903 @default.
• W2123392242 date "2004-02-01" @default.
• W2123392242 modified "2023-10-02" @default.
• W2123392242 title "The Amitochondriate Eukaryote Trichomonas vaginalis Contains a Divergent Thioredoxin-linked Peroxiredoxin Antioxidant System" @default.
• W2123392242 cites W1520425329 @default.
• W2123392242 cites W1583295309 @default.
• W2123392242 cites W1595716614 @default.
• W2123392242 cites W1598280952 @default.
• W2123392242 cites W1604304380 @default.
• W2123392242 cites W1630260213 @default.
• W2123392242 cites W1788190869 @default.
• W2123392242 cites W1812007492 @default.
• W2123392242 cites W1966369330 @default.
• W2123392242 cites W1968738598 @default.
• W2123392242 cites W1971780336 @default.
• W2123392242 cites W1974637818 @default.
• W2123392242 cites W1991877552 @default.
• W2123392242 cites W1992533564 @default.
• W2123392242 cites W1997001730 @default.
• W2123392242 cites W1999392732 @default.
• W2123392242 cites W2012948497 @default.
• W2123392242 cites W2016862957 @default.
• W2123392242 cites W2020011224 @default.
• W2123392242 cites W2020735633 @default.
• W2123392242 cites W2024072544 @default.
• W2123392242 cites W2029580335 @default.
• W2123392242 cites W2033223075 @default.
• W2123392242 cites W2036848170 @default.
• W2123392242 cites W2037555868 @default.
• W2123392242 cites W2040438092 @default.
• W2123392242 cites W2045951786 @default.
• W2123392242 cites W2050373710 @default.
• W2123392242 cites W2059596852 @default.
• W2123392242 cites W2063103318 @default.
• W2123392242 cites W2068356439 @default.
• W2123392242 cites W2074482029 @default.
• W2123392242 cites W2091487631 @default.
• W2123392242 cites W2096056489 @default.
• W2123392242 cites W2097006499 @default.
• W2123392242 cites W2103650142 @default.
• W2123392242 cites W2106882534 @default.
• W2123392242 cites W2112058028 @default.
• W2123392242 cites W2112956791 @default.
• W2123392242 cites W2114090275 @default.
• W2123392242 cites W2123845161 @default.
• W2123392242 cites W2135110724 @default.
• W2123392242 cites W2135805856 @default.
• W2123392242 cites W2136609181 @default.
• W2123392242 cites W2142477354 @default.
• W2123392242 cites W2142901242 @default.
• W2123392242 cites W2144160992 @default.
• W2123392242 cites W2148537294 @default.
• W2123392242 cites W2149352439 @default.
• W2123392242 cites W2155691733 @default.
• W2123392242 cites W2156478713 @default.
• W2123392242 cites W2157499153 @default.
• W2123392242 cites W2159806932 @default.
• W2123392242 cites W2161444534 @default.
• W2123392242 cites W2164997158 @default.
• W2123392242 cites W2170409189 @default.
• W2123392242 cites W2324809871 @default.
• W2123392242 cites W4247896860 @default.
• W2123392242 cites W42959172 @default.
• W2123392242 doi "https://doi.org/10.1074/jbc.m304359200" @default.
• W2123392242 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/14630923" @default.
• W2123392242 hasPublicationYear "2004" @default.
• W2123392242 type Work @default.
• W2123392242 sameAs 2123392242 @default.
• W2123392242 citedByCount "71" @default.
• W2123392242 countsByYear W21233922422012 @default.
• W2123392242 countsByYear W21233922422013 @default.
• W2123392242 countsByYear W21233922422014 @default.
• W2123392242 countsByYear W21233922422015 @default.
• W2123392242 countsByYear W21233922422016 @default.
• W2123392242 countsByYear W21233922422017 @default.
• W2123392242 countsByYear W21233922422018 @default.
• W2123392242 countsByYear W21233922422019 @default.
• W2123392242 countsByYear W21233922422020 @default.
• W2123392242 countsByYear W21233922422021 @default.
• W2123392242 countsByYear W21233922422022 @default.
• W2123392242 countsByYear W21233922422023 @default.
• W2123392242 crossrefType "journal-article" @default.
• W2123392242 hasAuthorship W2123392242A5000896896 @default.
• W2123392242 hasAuthorship W2123392242A5024173243 @default.
• W2123392242 hasAuthorship W2123392242A5030104872 @default.
• W2123392242 hasAuthorship W2123392242A5051065452 @default.
• W2123392242 hasAuthorship W2123392242A5052527219 @default.
• W2123392242 hasAuthorship W2123392242A5075315348 @default.
• W2123392242 hasAuthorship W2123392242A5086891018 @default.

• next