FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2124163811> ?p ?o ?g. }

• W2124163811 endingPage "9232" @default.
• W2124163811 startingPage "9226" @default.
• W2124163811 abstract "Human biliverdin reductase (hBVR) is a serine/threonine kinase that catalyzes reduction of the heme oxygenase (HO) activity product, biliverdin, to bilirubin. A domain of biliverdin reductase (BVR) has primary structural features that resemble leucine zipper proteins. A heptad repeat of five leucines (L1–L5), a basic domain, and a conserved alanine characterize the domain. In hBVR, a lysine replaces L3. The secondary structure model of hBVR predicts an α-helix-turn-β-sheet for this domain. hBVR translated by the rabbit reticulocyte lysate system appears on a nondenaturing gel as a single band with molecular mass of ∼69 kDa. The protein on a denaturing gel separates into two anti-hBVR immunoreactive proteins of ∼39.9 + 34.6 kDa. The dimeric form, but not purified hBVR, binds to a 100-mer DNA fragment corresponding to the mouse HO-1 (hsp32) promoter region encompassing two activator protein (AP-1) sites. The specificity of DNA binding is suggested by the following: (a) hBVR does not bind to the same DNA fragment with one or zero AP-1 sites; (b) a 56-bp random DNA with one AP-1 site does not form a complex with hBVR; (c) in vitro translated HO-1 does not interact with the 100-mer DNA fragment with two AP-1 sites; (d) mutation of Lys143, Leu150, or Leu157 blocks both the formation of the ∼69-kDa specimens and hBVR DNA complex formation; and (e) purified preparations of hBVR or hHO-1 do not bind to DNA with two AP-1 sites. The potential significance of the AP-1 binding is suggested by the finding that the response of HO-1, in COS cells stably transfected with antisense hBVR, with 66% reduced BVR activity, to superoxide anion ( O2⨪) formed by menadione is attenuated, whereas induction by heme is not affected. We propose a role for BVR in the signaling cascade for AP-1 complex activation necessary for HO-1 oxidative stress response. Human biliverdin reductase (hBVR) is a serine/threonine kinase that catalyzes reduction of the heme oxygenase (HO) activity product, biliverdin, to bilirubin. A domain of biliverdin reductase (BVR) has primary structural features that resemble leucine zipper proteins. A heptad repeat of five leucines (L1–L5), a basic domain, and a conserved alanine characterize the domain. In hBVR, a lysine replaces L3. The secondary structure model of hBVR predicts an α-helix-turn-β-sheet for this domain. hBVR translated by the rabbit reticulocyte lysate system appears on a nondenaturing gel as a single band with molecular mass of ∼69 kDa. The protein on a denaturing gel separates into two anti-hBVR immunoreactive proteins of ∼39.9 + 34.6 kDa. The dimeric form, but not purified hBVR, binds to a 100-mer DNA fragment corresponding to the mouse HO-1 (hsp32) promoter region encompassing two activator protein (AP-1) sites. The specificity of DNA binding is suggested by the following: (a) hBVR does not bind to the same DNA fragment with one or zero AP-1 sites; (b) a 56-bp random DNA with one AP-1 site does not form a complex with hBVR; (c) in vitro translated HO-1 does not interact with the 100-mer DNA fragment with two AP-1 sites; (d) mutation of Lys143, Leu150, or Leu157 blocks both the formation of the ∼69-kDa specimens and hBVR DNA complex formation; and (e) purified preparations of hBVR or hHO-1 do not bind to DNA with two AP-1 sites. The potential significance of the AP-1 binding is suggested by the finding that the response of HO-1, in COS cells stably transfected with antisense hBVR, with 66% reduced BVR activity, to superoxide anion ( O2⨪) formed by menadione is attenuated, whereas induction by heme is not affected. We propose a role for BVR in the signaling cascade for AP-1 complex activation necessary for HO-1 oxidative stress response. biliverdin reductase heme oxygenase human BVR activator protein menadione Biliverdin reductase (BVR)1 is a recently described serine/threonine kinase (1Salim M. Brown-Kipphut B.A. Maines M.D. J. Biol. Chem. 2001; 276: 10929-10934Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar) that catalyzes reduction of biliverdin IXα at the γ meso bridge to produce bilirubin. Biliverdin is the product of heme (Fe-protoporphyrin IX) oxidation by the heme oxygenase (HO) system. The reductase in response to extracellular stimuli (e.g. cGMP, lipopolysaccharides, and free radicals) translocates into the nucleus (2Maines M.D. Ewing J.F. Huang T.J. Panahian N. J. Pharmacol. Exp. Ther. 2001; 296: 1091-1097PubMed Google Scholar) and is activated by oxygen radicals (1Salim M. Brown-Kipphut B.A. Maines M.D. J. Biol. Chem. 2001; 276: 10929-10934Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar). The mammalian enzyme is highly conserved; the rat and human reductases share 84% amino acid identity (3Fakhrai H. Maines M.D. J. Biol. Chem. 1992; 267: 4023-4029Abstract Full Text PDF PubMed Google Scholar, 4Maines M.D. Polevoda B.V. Huang T.J. McCoubrey Jr., W.K. Eur. J. Biochem. 1996; 235: 372-381Crossref PubMed Scopus (50) Google Scholar). Certain features of the reductase are conserved phylogenetically from cyanobacteria to humans including its unique property among all enzymes characterized to date of having dual pH/cofactor requirement (5Kutty R.K. Maines M.D. J. Biol. Chem. 1981; 256: 3956-3962Abstract Full Text PDF PubMed Google Scholar, 6Schluchter W.M. Glazer A.N. J. Biol. Chem. 1997; 272: 13562-13569Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar). Human BVR (hBVR) is a 296-residue-long polypeptide that, based on its predicted amino acid sequence, has a region with certain key residues that are conserved in proteins that have a leucine zipper dimerization domain, such as human Shaker, human c-Myc, SaccharomycesGCN4, human c-Jun, human CREB, human c-Fos, andSaccharomyces YAP-1 (Fig. 1). This motif is also found in the rat enzyme (Fig. 1). As a rule, the leucine zipper motif consists of repeat of five leucines (L1–L5) separated by six amino acids (Fig. 1) (7Landschulz W.H. Johnson P.F. McKnight S.L. Science. 1988; 240: 1759-1764Crossref PubMed Scopus (2522) Google Scholar, 8Vinson C.R. Sigler P.B. McKnight S.L. Science. 1989; 246: 911-916Crossref PubMed Scopus (727) Google Scholar). Exceptions to this, however, are found, for instance in Saccharomyces YAP-1: L3is substituted with asparagine; in Saccharomyces GCN4 and human CREB, L5 is substituted by araginine and lysine, respectively; and, in human c-Myc, valine replaces L1. They all form functional homodimers or heterodimers. In hBVR and rat BVR, L3 is substituted with lysine at positions 143 and 142, respectively (Fig. 1). Other structural features of the dimerization domain include a secondary structure that in most cases fits the helix-turn-helix model (8Vinson C.R. Sigler P.B. McKnight S.L. Science. 1989; 246: 911-916Crossref PubMed Scopus (727) Google Scholar, 9O'Shea E. Rutkowski R. Kim P.S. Science. 1989; 243: 538-542Crossref PubMed Scopus (697) Google Scholar, 10Struhl K. Trends Biochem. Sci. 1989; 14: 137-140Abstract Full Text PDF PubMed Scopus (235) Google Scholar) and an invariant basic region that starts exactly seven residues N-terminal to L1 and is flanked by alanine residues (Fig. 1). The basic region is the DNA binding domain (7Landschulz W.H. Johnson P.F. McKnight S.L. Science. 1988; 240: 1759-1764Crossref PubMed Scopus (2522) Google Scholar, 8Vinson C.R. Sigler P.B. McKnight S.L. Science. 1989; 246: 911-916Crossref PubMed Scopus (727) Google Scholar, 11Ramirez-Carrozzi V.R. Kerppola T.K. J. Biol. Chem. 2001; 276: 21797-21808Abstract Full Text Full Text PDF PubMed Scopus (15) Google Scholar). An α/β secondary structure with leucine-rich repeats also forms a high affinity protein-protein interaction domain (12Kobe B. Diesenhofer J. Nature. 1993; 366: 751-756Crossref PubMed Scopus (541) Google Scholar, 13Kobe B. Diesenhofer J. Trends Biochem. Sci. 1994; 19: 415-421Abstract Full Text PDF PubMed Scopus (1036) Google Scholar). Although the leucine zipper dimerization motif has been identified in several nonnuclear proteins (Fig. 1), the greater numbers of proteins that have these conserved features are transacting factors and play a role in regulation of gene expression.The AP-1 site is one of the DNA recognition sequences for leucine zipper proteins. The heme oxygenase cognate, HO-1 or hsp32 (14Maines M.D. Trakshel G.M. Kutty R.K. J. Biol. Chem. 1986; 261: 411-419Abstract Full Text PDF PubMed Google Scholar) is activated by increased AP-1 DNA binding in response to certain oxidative stress stimuli (15Lee P.J. Camhi S.L. Chin B.Y. Alam J. Choi A.M.K. Am. J. Physiol. 2000; 279: L175-L182Crossref PubMed Google Scholar, 16He C.H. Gong P. Hu B. Stewart D. Choi M.E. Choi A.M.K. Alam J. J. Biol. Chem. 2001; 276: 20858-20865Abstract Full Text Full Text PDF PubMed Scopus (377) Google Scholar). Transcriptional activation involves binding of c-Jun and c-Fos homodimers or heterodimers to the AP-1 site (17Angel P. Karin M. Biochim. Biophys. Acta. 1991; 1072: 129-157Crossref PubMed Scopus (3249) Google Scholar, 18Han Z. Boyle D.L. Chang L. Bennett B. Karin M. Yang L. Manning A.M. Firestein G.S. J. Clin. Invest. 2001; 108: 73-81Crossref PubMed Scopus (719) Google Scholar). Increased AP-1 complex formation is not restricted to HO-1 or oxidative stress; rather, it is identified for activation of several oncogenes and kinases in response to cytokines, growth factors, transformation factors, UV radiation, and other assorted stimuli (19Devary Y. Gottlieb R.A. Lau L.F. Karin M. Mol. Cell. Biol. 1991; 11: 2804-2811Crossref PubMed Scopus (597) Google Scholar).Using the x-ray diffraction analysis of rat BVR (20Kikuchi A. Park S.Y. Miyatake H. Sun D. Sato M. Yoshida T. Shiro Y. Nat. Struct. Biol. 2001; 8: 221-225Crossref PubMed Scopus (65) Google Scholar) 2F. Whitby, J. Phillips, W. K. McCoubrey, C. Hills, and M. D. Maines, unpublished results. 2F. Whitby, J. Phillips, W. K. McCoubrey, C. Hills, and M. D. Maines, unpublished results. and alignment of the predicted amino acid sequence of hBVR (4Maines M.D. Polevoda B.V. Huang T.J. McCoubrey Jr., W.K. Eur. J. Biochem. 1996; 235: 372-381Crossref PubMed Scopus (50) Google Scholar), we have identified conserved features of leucine zipper DNA-binding proteins in the reductase. We have questioned whether hBVR recognizes specific sequences of DNA and, if so, whether this binding is of biological significance. We present data that show specific binding of native hBVR to DNA and suggest a role for BVR in regulation of HO-1 oxidative stress response.EXPERIMENTAL PROCEDURESMaterialsAll of the chemicals and biochemicals used in this study were of ultrapure quality purchased from Sigma, Aldrich, or Invitrogen. Enzymes used in this study (BamHI, BlpI,HindIII, SalI, SmaI, XhoI, T4 DNA ligase, DNA polymerase, and polynucleotide kinase) were purchased from New England Biolabs, Invitrogen, or Amersham Biosciences, Inc. [35S]methionine and [32P]ATP RedivueTM radioisotopes were purchased from Amersham Biosciences. We used RedivueTMl-[35S]methionine (catalog no. AG 1094), because this grade of [35S]methionine does not cause the background labeling of the rabbit reticulocyte lysate 42-kDa protein that can occur using other grades of labels (21Jackson R. Hunt T. Methods Enzymol. 1983; 96: 50-74Crossref PubMed Scopus (394) Google Scholar).MethodsIn Vitro Synthesis of Capped RNA TranscriptThe full-length BVR fragment was amplified from the plasmid 494 Gex3 (4Maines M.D. Polevoda B.V. Huang T.J. McCoubrey Jr., W.K. Eur. J. Biochem. 1996; 235: 372-381Crossref PubMed Scopus (50) Google Scholar) using oligonucleotides OL.507 and OL.508, while HO-1 (22Yoshida T. Biro P. Cohen T. Müller R.M. Shibahara S. Eur. J. Biochem. 1988; 71: 457-464Crossref Scopus (268) Google Scholar) was amplified using oligonucleotides OL.547 and OL.548 (Table I). They were inserted in the multiple cloning site of pCDNA3 (Invitrogen) betweenBamHI and XhoI. The resultant recombinant DNAs were named as p507 and p547. Methods used in the construction of plasmids, including restriction enzyme digestion, separation of plasmid DNA and restriction fragments on agarose gels, ligation of DNA fragments, and the isolation of plasmid DNA are described in Sambrook et al. (23Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). Escherichia coli transformations were performed with CaCl2 (24Cohen S.N. Chang A.C.Y. Hsu L. Proc. Natl. Acad. Sci. U. S. A. 1972; 69: 2110-2114Crossref PubMed Scopus (1831) Google Scholar). PCR was carried out as described by Saiki et al. (25Saiki R.K. Gelfand D.H. Stoffel S. Scharf S.J. Horn G.T. Mullis K.B. Erlicj H.A. Science. 1988; 239: 487-491Crossref PubMed Scopus (13400) Google Scholar). Both plasmid p507 and p547 were transformed in INV-competent cells. The plasmid purification was done with Qiagen Mini Prep plasmid purification kit and was linearized by digesting with SmaI. Linearized plasmid was then treated with phenol/chloroform/isoamyl alcohol (25:24:1) and ethanol-precipitated. Plasmids were dissolved and stored in RNase-free water. RNA was transcribed by using the RiboProbein vitro Transcription System from Promega. 5 μg of linearized template DNA was used in a 50-μl reaction volume using T7 RNA polymerase in the presence of the m7G cap analog so as to generate the capped transcript. 50 units of ribonuclease inhibitor were also added to the reaction along with required amounts of dithiothreitol and nucleotides. After a 1-h incubation at 37 °C, the reaction mixture was treated with RNase-free DNase (1 μl/μg of template DNA) and was extracted with phenol/chloroform/isoamyl alcohol, precipitated with ethanol and ammonium acetate, and resuspended in 20 μl of RNase-free water and kept at −70 °C.Table IList of oligonucleotidesOligonucleotide numberSequenceOL.507GGATCCATGAATGCAGAGCCCGAGAGOL.508CTCGAGAGCTACATCACCTCCTCCTCOL.547GGATCCATGGAGCGCCCACAGCTCGOL.548GCTCGAGTGGCGAAGGATCACCATCGCAGGAGCGGTGTOL.582GAAAAAAGAAGTGGTGGGGGCTGACCTGCTGAAAGGGTCGOL.583CGACCCTTTCAGCAGGTCAGCCCCCACCACTTCTTTTTTCOL.584GACCTGCTGAAAGGGTCGGCCCTCTTCACATCTGACCCGOL.585CGGGTCAGATGTGAAGAGGGCCGACCCTTTCAGCAGGTCOL.586CCTCTTCACATCTGACCCGGCTGAAGAAGACCGGTTTGGCTOL.587AGCCAAACCGGTCTTCTTCAGCCGGGTCAGATGTGAAGAGGOL.619TCCTCAGCTGCTTTTATGCTGTGTCATGGTTGGGAGGGGTGATTAGCAGACAAAGGGAAGACAGATTTTGCGATCCTCCC CTCTGTTCCCTCTGCCTCAGOL.620CTGAGGCAGAGGGAACAGAGGGGAGGATCGCAAAATCTGTCTTCCCTTTGTCTGCTAATCACCCCTCCCAACCATACACA GCATAAAAGCAGCTGAGGAOL.621CAGCCATGAGGACTACATCAGOL.622AGCCAGTTCCTTCTCAGAGAAOL.623TCCTCAGCTGCTTTTATGCTGTGTCATGGTTGGGAGGGGTGATTAGCAGACAAAGGGAAGACAGATTTTGCTGAGTCACC CTCTGTTCCCTCTGCCTCAGOL.624CTGAGGCAGAGGGAACAGAGGGTGACTCAGCAAAATCTGTCTTCCCTTTGTCTGCTAATCACCCCTCCCAACCATGACACA GCATAAAAGCAGCTGAGGAOL.625TCCTCAGCTGCTTTTATGCGATCCTCTGGTTGGGAGGGGTGATTAGCAGACAAAGGGAAGACAGATTTTGCGATCCTCCC CTCTGTTCCCTCTGCCTCAGOL.626CTGAGGCAGAGGGAACAGAGGGGAGGATCGCAAAATCTGTCTTCCCTTTGTCTGCTAATCACCCCTCCCAACCAGAGGAT CGCATAAAAGCAGCTGAGGAOL.627CACTGAGAGAAACTATTACACAAGCCACATTAGCATGACTCATTGTTTCTGATCAGOL.628CTGATCAGAAACAATGAGTCATGCTAATGTGGCTTGTGTAATAGTTTCTCTCAGTGOL.629CACTGAGAGAAACTATTACACAAGCCACATTAGCAGATCCTCTTGTTTCTGATCAGOL.630CTGATCAGAAACAAGAGGATCTGCTAATGTGGCTTGTGTAATAGTTTCTCTCAGTGThe substitutions K143A, L150A, and L157A in oligonucleotides OL.582–OL.587 are shown in boldface type and are underlined. The AP-1 sites are also shown in boldface type and are underlined, while the replacements of AP-1 sites by random sequences are shown in boldface only for the oligonucleotides OL.619, OL.620, and OL.623–OL.630. Open table in a new tab In Vitro TranslationA 5.4-kb pcDNA 3 with 1 kb coding hBVR was used as vector to generate in vitro transcribed mRNA with T7 RNA polymerase. The transcribed mRNA was translated in the presence of [35S]methionine using rabbit reticulocyte lysate. In vitro translation was performed using micrococcal nuclease-treated rabbit reticulocyte lysate (Promega). A 50-μl reaction mixture was prepared by using 35 μl of lysate, 1 μl of 0.1 m dithiothreitol, 2 μl of 1 mm amino acid mixture minus methionine, 1 μl of RNase inhibitor and 5 μl of translation grade [35S]methionine. 5 μl of transcribed mRNA was added to the above reaction mixture and immediately incubated at 30 °C for 90 min. The in vitro translated proteins were resolved on 12% SDS or native polyacrylamide gel along with rainbow or native high molecular weight markers, respectively (Amersham Pharmacia Biotech). The gels were fixed in 10% acetic acid and 30% methanol and then treated with autoradiography enhancer (Amplify; Amersham Biosciences) for 30 min and dried under vacuum at 80 °C for 2 h and autoradiographed at −70 °C.Preparation of 32P-labeled DNA FragmentsA 56- or 100-bp DNA fragment with and without AP-1 sites was used for the DNA binding assay; their sequences are shown in Table I (OL.619, OL.620; OL.623–OL.630). Complementary oligonucleotides were used to generate double-stranded DNA fragments. 150-ng aliquots of annealed oligonucleotides were radioactively labeled using [γ-32P]ATP and T4 polynucleotide kinase. The DNA probes were purified with the Qiagen Nucleic Acid Purification Kit.PCR-generated Site-directed MutagenesisA 1-kb hBVR fragment was cut out from plasmid p507 by SalI. This 1-kb fragment was used as the template DNA for site-directed mutagenesis. Oligonucleotides (OL.582–OL.587) used for mutagenesis of hBVR leucine zipper motif at positions Lys143, Leu150, and Leu157 are shown in Table I. PCR was carried out in two steps. In the first step, the substitutions were introduced by using OL.621 or OL.622 in combination with oligonucleotides OL.582 and OL.583, OL.584 and OL.585, or OL.586 and OL.587 to generate K143A, L150A, and L157A, respectively. In the second stage of the reaction, the PCR products from the first stage were used as template DNA and were joined together by using oligonucleotides OL.621 and OL.622 (Table I). Another difference in the two-step 30-cycle PCRs was the T m, which was 48 °C in the first reaction and 43 °C in the second. The PCR products, thus formed, were purified with PCR purification kit (Concert) and digested with BlpI and HindIII. The resultant fragments were inserted in p507, which was used as a vector. Ligation was done within the gel by using 1% low melt agarose. The plasmids were amplified in XL-1 Blue cells and isolated by the Qiagen Mini Prep kit. The DNA sequencing of the mutated hBVR segment was carried out with the oligonucleotides OL.582–OL.587 (Table I) using the ABI PRISM dye Terminator Cycle Sequencing Ready Reaction kit with AmpliTaq DNA polymerase (Big Dye).Native and Denaturing Gel AnalysesIn vitrotranslated protein was assayed on native gel immediately after synthesis. One μl of in vitro translated material was added to 2 μl (25 ng) of annealed, unlabeled control DNA fragment. To this, 0.4 μg of poly(dI·dC) (Amersham Biosciences) in 14 μl of DNA binding buffer (10 mm Tris-chloride (pH 7.4), 50 mm NaCl, 1 mm MgCl2, 1 mm EDTA, 1 mm dithiothreitol, 5% glycerol) was added. It was incubated for 5 min at room temperature, and after adding 5 μl of loading buffer (1.5× DNA binding buffer with bromphenol blue dye), samples were resolved on 12% native polyacrylamide gel in Tris-acetate/EDTA buffer at 35 milliamps. The control DNA helps to prevent the formation of nonspecific protein aggregates, thereby increasing the resolution of protein bands (26Halazonetis T.D Georgopoulos K. Greenberg M.E. Leder P. Cell. 1988; 55: 917-924Abstract Full Text PDF PubMed Scopus (765) Google Scholar). A portion of the translated protein was treated with SDS and analyzed on a denaturing 12% polyacrylamide gel.DNA Binding AssayAs with native gel analysis, in vitro translated proteins were assayed for DNA binding immediately after synthesis. 1 μl of translated material was added to 5000–500,000 cpm of 32P-labeled DNA fragment representing ∼2–3 ng of DNA. 0.1 μg of poly(dI·dC) in 10 μl of DNA binding buffer was added to the labeled DNA. After incubating samples for 20 min at room temperature, 5 μl of loading buffer was added. The samples were resolved on 12% native polyacrylamide gel with 35 milliamps at 4 °C. The gels were processed as described above. Dried gels were put on two pieces of film separated by a piece of paper. Autoradiography was done at −70 °C for different time periods.Western Blot AnalysisFor Western blot analysis, the primary antibody was rabbit anti-human kidney BVR (27Maines M.D. Trakshel G.M. Arch. Biochem. Biophys. 1993; 300: 320-326Crossref PubMed Scopus (68) Google Scholar) with ECL detection system RPN 2106 (Amersham Biosciences). Briefly, in vitro translated hBVR was subjected to 12% SDS-polyacrylamide gel, transferred to polyvinylidene difluoride transfer membrane (Pall Corp.), and subjected to Western blot analysis as described earlier (1Salim M. Brown-Kipphut B.A. Maines M.D. J. Biol. Chem. 2001; 276: 10929-10934Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar).COS Cell Transfection and BVR MeasurementA cytotoxicity curve for the drug G418 sulfate (Geneticin), used as a marker for the selection of clonal cell lines, was established for exponentially grown COS cells in Dulbecco's modified Eagle's medium (37 °C, 5% CO2). At a concentration of 440 mg/ml and beyond, the drug was found toxic to the parental cell line. Therefore, the selection medium contained G418 at a concentration of 450 mg/ml. pcDNA3 plasmid containing the antisense sequence was isolated from E. coli cultures using Qiagen Midi Prep kit. Transfection was carried out by electroporation. The following day, transfected cells were split 1:2 and seeded on a 100-mm culture dish in the selection medium. The selection process was continued for 8–10 days with a change of selection medium every 2 days. Cells grown in culture flasks to 75% confluence were pooled from three flasks and were used for BVR enzyme activity measurement and mRNA analysis. BVR activity was measured from an increase in absorbance at 450 nm as described before (5Kutty R.K. Maines M.D. J. Biol. Chem. 1981; 256: 3956-3962Abstract Full Text PDF PubMed Google Scholar) using bilirubin as the substrate and NADH as the cofactor. The activity is expressed as units, a unit representing 1 nmol of bilirubin formed/min/mg of protein.Northern BlottingThe HO-1 hybridization probe was a 569-base pair HO-1 fragment corresponding to nucleotides 86–654 of rat HO-1 cDNA (28Shibahara S. Muller R.M. Taguchi H. J. Biol. Chem. 1987; 262: 12889-12892Abstract Full Text PDF PubMed Google Scholar). Cells from a minimum of three culture flasks were pooled and used for each analysis. Total RNA was extracted from COS cells for preparation of poly(A)+ RNA that was separated by electrophoresis on denaturing formaldehyde gel, and transferred onto a Nytran membrane. The HO-1 and actin probes were labeled using [α-32P]dCTP with the Random Primers Labeling System (Invitrogen). Prehybridization and hybridization were performed as described previously (29Ewing J.F. Maines M.D. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 5364-5368Crossref PubMed Scopus (249) Google Scholar). Blots were probed sequentially with HO-1 and actin. The signals were quantitated using TempDens Platform version 1.0.0 and are expressed relative to that of the control. The control level is arbitrarily given the value of 1.RESULTSThe comparison of the primary structure of hBVR between amino acids 100 and 157 with known leucine zipper-type DNA binding proteins shows certain common features (Fig. 1). These include the five repeating amino acids L1, L2, K3, L4, and L5, spaced every seventh residue, and a basic domain that is flanked by an upstream alanine residue and starts exactly seven residues N-terminal to L1. There are, however, differences in the primary structure of hBVR and those of most leucine zipper DNA binding proteins; a second basic domain that is present in DNA-binding proteins GCN4, c-Jun, c-Fos, and YAP-1 is not present in BVR. Fig.2 shows the secondary structure of hBVR, which is modeled after x-ray diffraction analyses of rat BVR crystal structure and shows a U-shaped α-helix-turn-β motif for the leucine zipper motif. Residues that form heptads are identified by a space-filling model. It is noted that a leucine-rich α-helix-turn-β structure is also present in porcine ribonuclease inhibitor and is involved in heterodimer and homodimer formations (12Kobe B. Diesenhofer J. Nature. 1993; 366: 751-756Crossref PubMed Scopus (541) Google Scholar, 13Kobe B. Diesenhofer J. Trends Biochem. Sci. 1994; 19: 415-421Abstract Full Text PDF PubMed Scopus (1036) Google Scholar). On the basis of the crystal structure, Kobe and Deisenhofer (12Kobe B. Diesenhofer J. Nature. 1993; 366: 751-756Crossref PubMed Scopus (541) Google Scholar, 13Kobe B. Diesenhofer J. Trends Biochem. Sci. 1994; 19: 415-421Abstract Full Text PDF PubMed Scopus (1036) Google Scholar) have shown that the leucine-rich repeat of the ribonuclease inhibitor is also “horseshoe-shaped.”Figure 2The predicted three-dimensional structure of hBVR. Rat BVR coordinates were used to model the three-dimensional structure of hBVR. The residues of the leucine zipper (green and red) at key positions Leu129, Leu136, Lys143, Leu150, and Leu157 are shown in the space-filling model. Residues between Leu129 and Lys143 are predicted to form an α-helix; those between Lys143 and Leu157 form a β-sheet.N and C denote the N and C terminus, respectively. The figure was generated with the molecular graphic program RasMol (36Ahmad Z. Sherman F. J. Biol. Chem. 2001; 276: 18450-18456Abstract Full Text Full Text PDF PubMed Scopus (4) Google Scholar).View Large Image Figure ViewerDownload Hi-res image Download (PPT)hBVR Forms a Homodimer and Binds DNAObservations with the primary and secondary features of hBVR were followed by examination of whether hBVR forms a dimer, and if so, whether the dimer interacts with DNA. For DNA interaction analysis, 56-mer and a 100-mer (TableI) DNA fragments encompassing AP-1 sites were used. The 56-mer fragment was a random fragment with one AP-1 site used for investigation of c-Jun and c-Fos DNA binding (26Halazonetis T.D Georgopoulos K. Greenberg M.E. Leder P. Cell. 1988; 55: 917-924Abstract Full Text PDF PubMed Scopus (765) Google Scholar). AP-1 also has been tested for GCN4 binding (30Hope I.A. Struhl K. Cell. 1985; 43: 177-188Abstract Full Text PDF PubMed Scopus (265) Google Scholar). The 100-mer DNA fragment corresponded to the HO-1 promoter region encompassing two AP-1 sites (31Alam J. Cai J. Smith A. J. Biol. Chem. 1994; 269: 1001-1009Abstract Full Text PDF PubMed Google Scholar). In order to bind to DNA, leucine zipper type proteins form a dimer, which takes place at the leucine zipper motif (32Busch S.J. Sassone-Corsi P. Trends Genet. 1990; 6: 36-40Abstract Full Text PDF PubMed Scopus (292) Google Scholar, 33Johnson P.F. McKnight S.L. Annu. Rev. Biochem. 1989; 58: 799-839Crossref PubMed Scopus (826) Google Scholar). Most proteins bearing this structural feature form homodimers, and dimer formation is required for its efficient DNA binding. The only known exception, Fos, forms a stable heterodimer with Jun oncoprotein (17Angel P. Karin M. Biochim. Biophys. Acta. 1991; 1072: 129-157Crossref PubMed Scopus (3249) Google Scholar). Therefore, we examined hBVR for homodimer formation immediately afterin vitro translation of hBVR mRNA, using cold native polyacrylamide gel (4 °C), and employed denaturing/SDS-polyacrylamide gel to dissociate the dimer immediately after in vitro translation of hBVR mRNA, should it be formed. On the native gel, the translated protein migrated as an approximately 69-kDa protein (Fig. 3). The protein size was assessed using standard native high molecular weight markers (Amersham Biosciences). Nonspecific protein aggregation was prevented by the addition of control unlabeled DNA (26Halazonetis T.D Georgopoulos K. Greenberg M.E. Leder P. Cell. 1988; 55: 917-924Abstract Full Text PDF PubMed Scopus (765) Google Scholar).Figure 3Detection of high molecular weight protein synthesized by hBVR mRNA. A, in vitrotranslated hBVR as visualized on a 12% native polyacrylamide gel. From the left, the first two lanes contain translated hBVR. The molecular mass of the translated protein was approximated to be 69 kDa. This value was obtained using high molecular weight native markers. Thethird lane is that of the control, which consisted of rabbit reticulocyte lysate with all components present in the translation system minus hBVR mRNA.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Next, whether the protein synthesized by reticulocyte lysate is in fact hBVR was tested. For this, the in vitro translated protein was examined on a 12% SDS-polyacrylamide gel, and the gel was processed either for autoradiography (Fig.4 A) or for Western blot analysis (Fig. 4 B). As shown in the autoradiogram, two prominent bands at ∼35 and ∼40 kDa were detected. hBVR, based on its predicted amino acid composition, has a molecular mass of ∼34 kDa (4Maines M.D. Polevoda B.V. Huang T.J. McCoubrey Jr., W.K. Eur. J. Biochem. 1996; 235: 372-381Crossref PubMed Scopus (50) Google Scholar). However, because of extensive posttranslational modification, it migrates as a group of size variants with an approximate molecular mass in the range of ∼38–42 kDa in SDS gel (4Maines M.D. Polevoda B.V. Huang T.J. McCoubrey Jr., W.K. Eur. J. Biochem. 1996; 235: 372-381Crossref PubMed Scopus (50) Google Scholar, 34Huang T.J. Trakshel G.M. Maines M.D. J. Biol. Chem. 1989; 264: 7844-7849Abstract Full Text PDF PubMed Google Scholar). The West" @default.
• W2124163811 created "2016-06-24" @default.
• W2124163811 creator A5001051903 @default.
• W2124163811 creator A5037668304 @default.
• W2124163811 creator A5051122218 @default.
• W2124163811 date "2002-03-01" @default.
• W2124163811 modified "2023-10-16" @default.
• W2124163811 title "Human Biliverdin Reductase Is a Leucine Zipper-like DNA-binding Protein and Functions in Transcriptional Activation of Heme Oxygenase-1 by Oxidative Stress" @default.
• W2124163811 cites W1483070973 @default.
• W2124163811 cites W1483926031 @default.
• W2124163811 cites W1497013369 @default.
• W2124163811 cites W1501532586 @default.
• W2124163811 cites W1531497588 @default.
• W2124163811 cites W1551687657 @default.
• W2124163811 cites W1556885373 @default.
• W2124163811 cites W1563771052 @default.
• W2124163811 cites W1599313043 @default.
• W2124163811 cites W1680009429 @default.
• W2124163811 cites W1788436564 @default.
• W2124163811 cites W1833690096 @default.
• W2124163811 cites W1869734513 @default.
• W2124163811 cites W1968301638 @default.
• W2124163811 cites W1975511017 @default.
• W2124163811 cites W1979672764 @default.
• W2124163811 cites W1980920477 @default.
• W2124163811 cites W1981601576 @default.
• W2124163811 cites W1987897953 @default.
• W2124163811 cites W2000024512 @default.
• W2124163811 cites W2000371106 @default.
• W2124163811 cites W2003962192 @default.
• W2124163811 cites W2005393972 @default.
• W2124163811 cites W2006491153 @default.
• W2124163811 cites W2008570049 @default.
• W2124163811 cites W2009229612 @default.
• W2124163811 cites W2014117083 @default.
• W2124163811 cites W2017730912 @default.
• W2124163811 cites W2033883110 @default.
• W2124163811 cites W2038500334 @default.
• W2124163811 cites W2048646132 @default.
• W2124163811 cites W2049490722 @default.
• W2124163811 cites W2055181868 @default.
• W2124163811 cites W2062589077 @default.
• W2124163811 cites W2064089886 @default.
• W2124163811 cites W2070044720 @default.
• W2124163811 cites W2072256632 @default.
• W2124163811 cites W2073764175 @default.
• W2124163811 cites W2081062649 @default.
• W2124163811 cites W2081643570 @default.
• W2124163811 cites W2094272759 @default.
• W2124163811 cites W2110374270 @default.
• W2124163811 cites W2130066440 @default.
• W2124163811 cites W2130581660 @default.
• W2124163811 cites W2132781864 @default.
• W2124163811 cites W2137682724 @default.
• W2124163811 cites W4248096216 @default.
• W2124163811 doi "https://doi.org/10.1074/jbc.m108239200" @default.
• W2124163811 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11773068" @default.
• W2124163811 hasPublicationYear "2002" @default.
• W2124163811 type Work @default.
• W2124163811 sameAs 2124163811 @default.
• W2124163811 citedByCount "98" @default.
• W2124163811 countsByYear W21241638112012 @default.
• W2124163811 countsByYear W21241638112013 @default.
• W2124163811 countsByYear W21241638112014 @default.
• W2124163811 countsByYear W21241638112015 @default.
• W2124163811 countsByYear W21241638112016 @default.
• W2124163811 countsByYear W21241638112017 @default.
• W2124163811 countsByYear W21241638112018 @default.
• W2124163811 countsByYear W21241638112019 @default.
• W2124163811 countsByYear W21241638112020 @default.
• W2124163811 countsByYear W21241638112021 @default.
• W2124163811 countsByYear W21241638112022 @default.
• W2124163811 countsByYear W21241638112023 @default.
• W2124163811 crossrefType "journal-article" @default.
• W2124163811 hasAuthorship W2124163811A5001051903 @default.
• W2124163811 hasAuthorship W2124163811A5037668304 @default.
• W2124163811 hasAuthorship W2124163811A5051122218 @default.
• W2124163811 hasBestOaLocation W21241638111 @default.
• W2124163811 hasConcept C104317684 @default.
• W2124163811 hasConcept C105782903 @default.
• W2124163811 hasConcept C11413529 @default.
• W2124163811 hasConcept C156860981 @default.
• W2124163811 hasConcept C165474305 @default.
• W2124163811 hasConcept C181199279 @default.
• W2124163811 hasConcept C185592680 @default.
• W2124163811 hasConcept C23849879 @default.
• W2124163811 hasConcept C2776151105 @default.
• W2124163811 hasConcept C2776217839 @default.
• W2124163811 hasConcept C2776253728 @default.
• W2124163811 hasConcept C2779219270 @default.
• W2124163811 hasConcept C41008148 @default.
• W2124163811 hasConcept C552990157 @default.
• W2124163811 hasConcept C55493867 @default.
• W2124163811 hasConcept C86339819 @default.
• W2124163811 hasConceptScore W2124163811C104317684 @default.
• W2124163811 hasConceptScore W2124163811C105782903 @default.
• W2124163811 hasConceptScore W2124163811C11413529 @default.
• W2124163811 hasConceptScore W2124163811C156860981 @default.

• next