FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2125497089> ?p ?o ?g. }

• W2125497089 endingPage "41236" @default.
• W2125497089 startingPage "41227" @default.
• W2125497089 abstract "The multilineage differentiation potential of adult tissue-derived mesenchymal progenitor cells (MPCs), such as those from bone marrow and trabecular bone, makes them a useful model to investigate mechanisms regulating tissue development and regeneration, such as cartilage. Treatment with transforming growth factor-β (TGF-β) superfamily members is a key requirement for the in vitro chondrogenic differentiation of MPCs. Intracellular signaling cascades, particularly those involving the mitogen-activated protein (MAP) kinases, p38, ERK-1, and JNK, have been shown to be activated by TGF-βs in promoting cartilage-specific gene expression. MPC chondrogenesis in vitro also requires high cell seeding density, reminiscent of the cellular condensation requirements for embryonic mesenchymal chondrogenesis, suggesting common chondro-regulatory mechanisms. Prompted by recent findings of the crucial role of the cell adhesion protein, N-cadherin, and Wnt signaling in condensation and chondrogenesis, we have examined here their involvement, as well as MAP kinase signaling, in TGF-β1-induced chondrogenesis of trabecular bone-derived MPCs. Our results showed that TGF-β1 treatment initiates and maintains chondrogenesis of MPCs through the differential chondro-stimulatory activities of p38, ERK-1, and to a lesser extent, JNK. This regulation of MPC chondrogenic differentiation by the MAP kinases involves the modulation of N-cadherin expression levels, thereby likely controlling condensation-like cell-cell interaction and progression to chondrogenic differentiation, by the sequential up-regulation and progressive down-regulation of N-cadherin. TGF-β1-mediated MAP kinase activation also controls WNT-7A gene expression and Wnt-mediated signaling through the intracellular β-catenin-TCF pathway, which likely regulates N-cadherin expression and subsequent N-cadherin-mediated cell-adhesion complexes during the early steps of MPC chondrogenesis. The multilineage differentiation potential of adult tissue-derived mesenchymal progenitor cells (MPCs), such as those from bone marrow and trabecular bone, makes them a useful model to investigate mechanisms regulating tissue development and regeneration, such as cartilage. Treatment with transforming growth factor-β (TGF-β) superfamily members is a key requirement for the in vitro chondrogenic differentiation of MPCs. Intracellular signaling cascades, particularly those involving the mitogen-activated protein (MAP) kinases, p38, ERK-1, and JNK, have been shown to be activated by TGF-βs in promoting cartilage-specific gene expression. MPC chondrogenesis in vitro also requires high cell seeding density, reminiscent of the cellular condensation requirements for embryonic mesenchymal chondrogenesis, suggesting common chondro-regulatory mechanisms. Prompted by recent findings of the crucial role of the cell adhesion protein, N-cadherin, and Wnt signaling in condensation and chondrogenesis, we have examined here their involvement, as well as MAP kinase signaling, in TGF-β1-induced chondrogenesis of trabecular bone-derived MPCs. Our results showed that TGF-β1 treatment initiates and maintains chondrogenesis of MPCs through the differential chondro-stimulatory activities of p38, ERK-1, and to a lesser extent, JNK. This regulation of MPC chondrogenic differentiation by the MAP kinases involves the modulation of N-cadherin expression levels, thereby likely controlling condensation-like cell-cell interaction and progression to chondrogenic differentiation, by the sequential up-regulation and progressive down-regulation of N-cadherin. TGF-β1-mediated MAP kinase activation also controls WNT-7A gene expression and Wnt-mediated signaling through the intracellular β-catenin-TCF pathway, which likely regulates N-cadherin expression and subsequent N-cadherin-mediated cell-adhesion complexes during the early steps of MPC chondrogenesis. Adult-derived mesenchymal progenitor cells (MPCs) 1The abbreviations used are: MPCs, mesenchymal progenitor cells; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; COMP, cartilage oligomeric matrix protein; IGF I, insulin-like growth factor I; TGF-β, transforming growth factor-β; JNK, c-Jun N-terminal kinase; MAP, mitogen-activated protein; UTR, untranslated region; ERK-1, extracellular signal-regulated kinase-1; PBS, phosphate-buffered saline; TCF, T-cell factor; RT, reverse transcription; A-CAM, anti-A cell adhesion molecule; P, phosphorylated; ECM, extracellular matrix. have been considered a candidate cell source for tissue engineering and reparative medicine by virtue of their potential to differentiate into adipocytes, chondrocytes, fibroblasts, osteoblasts, marrow stromal cells, and other tissues of mesenchymal origin (1Tuan R. Boland G. Tuli R. Arthritis Res. 2003; 5: 32-45Crossref Google Scholar, 2Caplan A.I. Clin. Plast. Surg. 1994; 21: 429-435Abstract Full Text PDF PubMed Google Scholar). Numerous adult tissues have been identified that harbor MPCs, including bone marrow (3Osyczka A.M. Noth U. O'Connor J. Caterson E.J. Yoon K. Danielson K.G. Tuan R.S. Calcif. Tissue Int. 2002; 71: 447-458Crossref PubMed Scopus (36) Google Scholar, 4Pittenger M.F. Mackay A.M. Beck S.C. Jaiswal R.K. Douglas R. Mosca J.D. Moorman M.A. Simonetti D.W. Craig S. Marshak D.R. Science. 1999; 284: 143-147Crossref PubMed Scopus (18019) Google Scholar, 5Jiang Y. Jahagirdar B.N. Reinhardt R.L. Schwartz R.E. Keene C.D. Ortiz-Gonzalez X.R. Reyes M. Lenvik T. Lund T. Blackstad M. Du J. Aldrich S. Lisberg A. Low W.C. Largaespada D.A. Verfaillie C.M. Nature. 2002; 418: 41-49Crossref PubMed Scopus (5194) Google Scholar), muscle (6Adachi N. Sato K. Usas A. Fu F.H. Ochi M. Han C.W. Niyibizi C. Huard J. J. Rheumatol. 2002; 29: 1920-1930PubMed Google Scholar, 7Bosch P. Musgrave D.S. Lee J.Y. Cummins J. Shuler T. Ghivizzani T.C. Evans T. Robbins T.D. Huard J. J. Orthop. Res. 2000; 18: 933-944Crossref PubMed Scopus (249) Google Scholar, 8Wada M.R. Inagawa-Ogashiwa M. Shimizu S. Yasumoto S. Hashimoto N. Development. 2002; 129: 2987-2995PubMed Google Scholar), adipose tissue (9Zuk P.A. Zhu M. Mizuno H. Huang J. Futrell J.W. Katz A.J. Benhaim P. Lorenz H.P. Hedrick M.H. Tissue Eng. 2001; 7: 211-228Crossref PubMed Scopus (6451) Google Scholar, 10Gronthos S. Franklin D.M. Leddy H.A. Robey P.G. Storms R.W. Gimble J.M. J. Cell. Physiol. 2001; 189: 54-63Crossref PubMed Scopus (926) Google Scholar), periosteum (11De Bari C. Dell'Accio F. Luyten F.P. Arthritis Rheum. 2001; 44: 85-95Crossref PubMed Scopus (282) Google Scholar, 12Nakahara H. Goldberg V.M. Caplan A.I. J. Orthop. Res. 1991; 9: 465-476Crossref PubMed Scopus (237) Google Scholar), and most recently in our laboratory, human trabecular bone (13Noth U. Osyczka A.M. Tuli R. Hickok N.J. Danielson K.G. Tuan R.S. J. Orthop. Res. 2002; 20: 1060-1069Crossref PubMed Scopus (387) Google Scholar, 14Osyczka A.M. Noth U. Danielson K.G. Tuan R.S. Ann. N. Y. Acad. Sci. 2002; 961: 73-77Crossref PubMed Scopus (28) Google Scholar). We have also developed improved techniques for the isolation and culture of MPCs from trabecular bone to yield clinically significant numbers of such cells (15Tuli R. Seghatoleslami M.R. Tuli S. Wang M.L. Hozack W.J. Manner P.A. Danielson K.G. Tuan R.S. Mol. Biotechnol. 2003; 23: 37-49Crossref PubMed Scopus (87) Google Scholar). That these cells retain their multilineage differentiation potential through long term culture expansion suggests they are a suitable cell source for potential therapeutic and clinical treatment at least in osteogenic, adipogenic, and chondrogenic applications. The in vitro chondrogenic differentiation of MPCs requires the complex involvement of growth factors and cell-cell and cell-matrix interactions, similar to developmental chondrogenesis in vivo (16DeLise A.M. Fischer L. Tuan R.S. Osteoarthritis Cartilage. 2000; 8: 309-334Abstract Full Text PDF PubMed Scopus (655) Google Scholar). Expression of members of the transforming growth factor-β (TGF-β) superfamily of growth factors has been localized to sites of bone repair as well as sites of embryonic bone and cartilage formation in vivo (17Horner A. Kemp P. Summers C. Bord S. Bishop N.J. Kelsall A.W. Coleman N. Compston J.E. Bone. 1998; 23: 95-102Crossref PubMed Scopus (114) Google Scholar, 18Hogan B.L. Genes Dev. 1996; 10: 1580-1594Crossref PubMed Scopus (1722) Google Scholar), and the chondro-inductive effects of the TGF-β superfamily members, particularly the bone morphogenetic proteins and the TGF-βs, have been well established in embryonic and adult mesenchymal cells (13Noth U. Osyczka A.M. Tuli R. Hickok N.J. Danielson K.G. Tuan R.S. J. Orthop. Res. 2002; 20: 1060-1069Crossref PubMed Scopus (387) Google Scholar, 19Johnstone B. Hering T.M. Caplan A.I. Goldberg V.M. Yoo J.U. Exp. Cell Res. 1998; 238: 265-272Crossref PubMed Scopus (2030) Google Scholar, 20Denker A.E. Haas A.R. Nicoll S.B. Tuan R.S. Differentiation. 1999; 64: 67-76Crossref PubMed Scopus (217) Google Scholar, 21Sekiya I. Colter D.C. Prockop D.J. Biochem. Biophys. Res. Commun. 2001; 284: 411-418Crossref PubMed Scopus (275) Google Scholar, 22Majumdar M.K. Wang E. Morris E.A. J. Cell. Physiol. 2001; 189: 275-284Crossref PubMed Scopus (238) Google Scholar, 23Mackay A.M. Beck S.C. Murphy J.M. Barry F.P. Chichester C.O. Pittenger M.F. Tissue Eng. 1998; 4: 415-428Crossref PubMed Scopus (1112) Google Scholar, 24Barry F. Boynton R.E. Liu B. Murphy J.M. Exp. Cell Res. 2001; 268: 189-200Crossref PubMed Scopus (851) Google Scholar). Recent reports have demonstrated the critical roles of intracellular signaling cascades activated by TGF-β family members in promoting cartilage-specific gene expression (25Watanabe H. de Caestecker M.P. Yamada Y. J. Biol. Chem. 2001; 276: 14466-14473Abstract Full Text Full Text PDF PubMed Scopus (245) Google Scholar, 26Tuli R. Seghatoleslami M.R. Tuli S. Howard M.S. Danielson K.G. Tuan R.S. Ann. N. Y. Acad. Sci. 2002; 961: 172-177Crossref PubMed Scopus (35) Google Scholar, 27Nakamura K. Shirai T. Morishita S. Uchida S. Saeki-Miura K. Makishima F. Exp. Cell Res. 1999; 250: 351-363Crossref PubMed Scopus (185) Google Scholar), including the mitogen-activated protein (MAP) kinases, whose major subtypes include p38, extracellular signal-regulated kinase-1 (ERK-1), and c-Jun N-terminal kinase (JNK or stress-activated protein kinase). These major subtypes are activated by a variety of stimuli, and often are differentially regulated by a single stimulus. The roles of the specific MAP kinase subtypes, p38 and ERK-1, in regulating chondrogenesis were elucidated to some degree by Oh et al. (28Oh C.D. Chang S.H. Yoon Y.M. Lee S.J. Lee Y.S. Kang S.S. Chun J.S. J. Biol. Chem. 2000; 275: 5613-5619Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar) who found that p38 and ERK-1 have opposing roles during the chondrogenic induction of chick limb bud cells. Specifically, p38 was an enhancer of chondrogenesis, whereas ERK-1 was a repressor of chondrogenesis, and control was exerted, at least in part, through the regulation of cell adhesion molecules, including N-cadherin, fibronectin, and its receptor α5β1 integrin, during cellular condensation. Precartilage mesenchymal condensation, a requisite for the initiation of chondrogenesis in vivo, has been shown to be equally important in in vitro cultures (29DeLise A.M. Tuan R.S. J. Cell. Biochem. 2002; 87: 342-359Crossref PubMed Scopus (109) Google Scholar, 30Delise A.M. Tuan R.S. Dev. Dyn. 2002; 225: 195-204Crossref PubMed Scopus (155) Google Scholar, 31Haas A.R. Tuan R.S. Differentiation. 1999; 64: 77-89Crossref PubMed Scopus (149) Google Scholar). The spatiotemporal expression pattern of the Ca2+-dependent, homotypic cell adhesion molecule N-cadherin parallels its functional requirement for the initiation and subsequent progression of developmental chondrogenesis (32Oberlender S.A. Tuan R.S. Cell Adhes. Commun. 1994; 2: 521-537Crossref PubMed Scopus (121) Google Scholar, 33Oberlender S.A. Tuan R.S. Development. 1994; 120: 177-187Crossref PubMed Google Scholar). As a transmembrane glycoprotein, N-cadherin is composed of extracellular domains that mediate homophilic interactions between neighboring cells, predominantly via a peptide domain containing the His-Ala-Val (HAV) amino acid sequence, located near the N terminus of the protein within the interface of two molecules and shown to be critical for N-cadherin-mediated cell adhesion (34Blaschuk O.W. Sullivan R. David S. Pouliot Y. Dev. Biol. 1990; 139: 227-229Crossref PubMed Scopus (335) Google Scholar). Additionally, the cytoplasmic domain of N-cadherin is anchored to the intracellular actin cytoskeleton through interactions with the α-, β-, and γ-catenin complex. Besides its functional role, cytoplasmic β-catenin has also been found to interact with other proteins such as glycogen synthase kinase-3β, adenomatous polyposis coli, the scaffolding components, axin and conductin, as well as the transcriptional regulators, lymphoid enhancing factor-1 (LEF-1)/T-cell factor (TCF), all of which play critical roles in the canonical Wnt signal transduction pathway (35Behrens J. J. Cell Sci. 2000; 113: 911-919Crossref PubMed Google Scholar), recently implicated in regulating chondrocyte differentiation. Wnts are a family of secreted glycoproteins that act in a paracrine fashion, thereby mediating cellular interactions during development (35Behrens J. J. Cell Sci. 2000; 113: 911-919Crossref PubMed Google Scholar, 36Cadigan K.M. Nusse R. Genes Dev. 1997; 11: 3286-3305Crossref PubMed Scopus (2228) Google Scholar). Briefly, Wnt signaling proteins act by binding to Frizzled receptors, the activation of which leads to the stabilization of cytosolic β-catenin. Interaction of β-catenin with the high mobility group box transcription factors of the LEF-1/TCF family allows translocation of the complex into the nucleus to subsequently regulate the transcription of Wnt target genes (37Behrens J. von Kries J.P. Kuhl M. Bruhn L. Wedlich D. Grosschedl R. Birchmeier W. Nature. 1996; 382: 638-642Crossref PubMed Scopus (2595) Google Scholar). A number of WNT genes are expressed during development, including WNT3A (38Kengaku M. Capdevila J. Rodriguez-Esteban C. De La Pena J. Johnson R.L. Belmonte J.C. Tabin C.J. Science. 1998; 280: 1274-1277Crossref PubMed Scopus (365) Google Scholar) localized in mouse apical ectodermal ridge, WNT4 localized in developing joints (39Kawakami Y. Wada N. Nishimatsu S.I. Ishikawa T. Noji S. Nohno T. Dev. Growth Differ. 1999; 41: 29-40Crossref PubMed Scopus (116) Google Scholar), WNT5A localized in distal mesenchyme (40Parr B.A. Shea M.J. Vassileva G. McMahon A.P. Development. 1993; 119: 247-261Crossref PubMed Google Scholar), and WNT7A in dorsal ectoderm (41Parr B.A. McMahon A.P. Nature. 1995; 374: 350-353Crossref PubMed Scopus (623) Google Scholar). Wnt-7a has been shown to be chondro-inhibitory in vitro (42Rudnicki J.A. Brown A.M. Dev. Biol. 1997; 185: 104-118Crossref PubMed Scopus (160) Google Scholar), and recently the misexpression of WNT7A in limb mesenchymal chondrogenic cultures directly led to the prolonged expression of N-cadherin, the stabilization of N-cadherin-mediated cell-cell adhesion, and the eventual inhibition of chondrogenesis (43Tufan A.C. Tuan R.S. FASEB J. 2001; 15: 1436-1438Crossref PubMed Scopus (79) Google Scholar, 44Tufan A.C. Daumer K.M. DeLise A.M. Tuan R.S. Exp. Cell Res. 2002; 273: 197-203Crossref PubMed Scopus (51) Google Scholar). The involvement of Wnt signaling has also been shown in the BMP-2 mediated chondrogenic effect on the mouse C3H10T1/2 mesenchymal cell line (45Fischer L. Boland G. Tuan R.S. J. Cell. Biochem. 2002; 84: 816-831Crossref PubMed Scopus (103) Google Scholar, 46Fischer L. Boland G. Tuan R.S. J. Biol. Chem. 2002; 277: 30870-30878Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar). Recent evidence has increasingly suggested that signaling cascades and pathways act in an interconnected manner within the cell. Here we attempt to define the early cellular processes and cross-regulatory signaling events that take place during mesenchymal chondrogenesis, specifically in adult tissue-derived, multipotential MPCs. A recent report (47Ishitani T. Ninomiya-Tsuji J. Nagai S. Nishita M. Meneghini M. Barker N. Waterman M. Bowerman B. Clevers H. Shibuya H. Matsumoto K. Nature. 1999; 399: 798-802Crossref PubMed Scopus (516) Google Scholar) described the cross-regulation and subsequent inhibition of the Wnt signaling pathway by MAPKKK and the downstream MAP kinase, NLK. Here we report that TGF-β1-stimulated chondrogenesis of trabecular bone-derived MPCs initiates intracellular signaling via activation of the chondro-stimulatory MAP kinases, p38, ERK-1, and JNK, which differentially regulate cartilage-specific gene and protein expression in a lineage-specific manner. Additionally, our results suggest that mesenchymal cell condensation initiated by TGF-β1 within the pellet culture is mediated via N-cadherin and is critical for the progression of chondrogenesis, similar to developmental chondrogenesis in vivo. Moreover, N-cadherin expression appeared to be regulated at the cellular condensation phase by the tight control of WNT7A gene expression individually by the p38, ERK-1, and JNK MAP kinases. Reagents—All reagents were purchased from Sigma unless otherwise stated. Isolation and Culture of Human Trabecular Bone-derived Cells— Normal human trabecular bone was obtained from the femoral heads of patients undergoing total hip arthroplasty and processed using a high efficiency and high yield protocol established previously in our laboratory (15Tuli R. Seghatoleslami M.R. Tuli S. Wang M.L. Hozack W.J. Manner P.A. Danielson K.G. Tuan R.S. Mol. Biotechnol. 2003; 23: 37-49Crossref PubMed Scopus (87) Google Scholar) and approved by the Institutional Review Boards of Thomas Jefferson University and George Washington University. Processed trabecular bone fragments were subsequently cultured in Dulbecco's modified Eagle's medium (high glucose and l-glutamine; Mediatech, Inc., Herndon, VA) supplemented with 10% fetal bovine serum (Premium Select, Atlanta Biologicals, Atlanta, GA), from selected lots (48Caterson E.J. Nesti L.J. Danielson K.G. Tuan R.S. Mol. Biotechnol. 2002; 20: 245-256Crossref PubMed Scopus (183) Google Scholar), and 50 μg/ml penicillin/streptomycin. Subconfluent cell monolayers were dissociated and removed using 0.25% trypsin containing 1 mm EDTA (Invitrogen) and either passaged at a ratio of 1:3 or utilized for study. In Vitro Chondrogenic Differentiation of MPCs—The chondrogenic induction of trabecular bone-derived MPCs was initiated using high density pellet cultures (2 × 105 cells/pellet, 500 × g for 5 min) in a chemically defined medium containing Dulbecco's modified Eagle's medium supplemented with 50 μg/ml ascorbate, 0.1 μm dexamethasone, 40 μg/ml l-proline, 100 μg/ml sodium pyruvate, and ITS-plus (Collaborative Biomedical Products, Cambridge, MA) (4Pittenger M.F. Mackay A.M. Beck S.C. Jaiswal R.K. Douglas R. Mosca J.D. Moorman M.A. Simonetti D.W. Craig S. Marshak D.R. Science. 1999; 284: 143-147Crossref PubMed Scopus (18019) Google Scholar, 13Noth U. Osyczka A.M. Tuli R. Hickok N.J. Danielson K.G. Tuan R.S. J. Orthop. Res. 2002; 20: 1060-1069Crossref PubMed Scopus (387) Google Scholar, 19Johnstone B. Hering T.M. Caplan A.I. Goldberg V.M. Yoo J.U. Exp. Cell Res. 1998; 238: 265-272Crossref PubMed Scopus (2030) Google Scholar, 23Mackay A.M. Beck S.C. Murphy J.M. Barry F.P. Chichester C.O. Pittenger M.F. Tissue Eng. 1998; 4: 415-428Crossref PubMed Scopus (1112) Google Scholar, 49Yoo J.U. Barthel T.S. Nishimura K. Solchaga L. Caplan A.I. Goldberg V.M. Johnstone B. J. Bone Joint Surg. Am. 1998; 80: 1745-1757Crossref PubMed Scopus (782) Google Scholar). Recombinant human transforming growth factor-β1 (R&D Systems, Minneapolis, MN) was added to the pellet cultures at a final concentration of 10 ng/ml. For MAP kinase inhibition studies, specific chemical inhibitors of p38 (SB20350), ERK-1-specific MAP kinase kinase (MEK1) inhibitor (PD98059), and JNK (SP600125, Calbiochem-Novabiochem) were used at final concentrations of 5, 10, and 100 nm, respectively, representing concentrations well within the range of IC50 values determined for similar cell types. Reverse Transcription (RT)-PCR Analysis—Total cellular RNA was extracted using Trizol reagent (Invitrogen) according to the manufacturer's protocol. Chondrogenic pellet cultures were first briefly homogenized in Trizol reagent to increase yield efficiency. Equal amounts of RNA samples were reverse-transcribed by using random hexamers and the SuperScript First Strand Synthesis System (Invitrogen). PCR amplification of cDNA was carried out using AmpliTaq DNA polymerase (PerkinElmer Life Sciences) and the gene-specific primer sets listed in Table I. Amplification cycles consisted of 1-min denaturation at 95 °C, 1-min annealing, 1-min polymerization at 72 °C, and finally a 10-min extension at 72 °C. The housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), was used as a control for RNA loading of samples. PCR products were analyzed electrophoretically using the Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA).Table IRT-PCR primers for differentiation-specific gene expression analysis, sequence and expected product sizeGenePrimer sequences (5′-3′)Expected product sizebpGAPDHaControl.GGGCTGCTTTTAACTCTGGT702TGGCAGGTTTTTCTAGACGGAggrecanbCartilage-specific genes.TGAGGAGGGCTGGAACAAGTACCGGAGGTGGTAATTGCAGGGAACA350Col IICAGGTCAAGATGGTCTTCAGCACCTGTCTCACCA377Col IXGAAAATGAAGACCTGCTGGGAAAAGGCTGCTGTTTGGAGAC516Col XGCCCAAGAGGTGCCCCTGGAATACCCTGAGAAAGAGGAGTGGACATAC703COMPCAACTGTCCCCAGAAGAGCAATGGTAGCCAAAGATGAAGCCC588DMPNTGGACCTCAGTCTTCTCTGGGTCCTAGCTAGCTTCAGAGCCG547IGF 1TGTCCTCCTCGCATCTCTTCTGTACTTCCTTCTGGTCTTGGG310Sox 9ATCTGAAGAAGGAGAGCGAGTCAGAAGTCTCCAGAGCTTG264WNT-3A cWNT-specific genes.CAGGAACTACGTGGAGATCATGCCATCCCACCAAACTCGATGTC326WNT-5AACACCTCTTTCCAAACAGGCCGATTGTTAAACTCAACTCTC392WNT-7AGCCGTTCACGTGGAGCCTGTGCGTGCAGCATCCTGCCAGGGAGCCCCGCAGCT438WNT-11GTGAAGGACTCGGAACTCGTAGCGCTATGTCTGCAAGTGA364a Control.b Cartilage-specific genes.c WNT-specific genes. Open table in a new tab Reporter Gene Assays—Human trabecular bone-derived MPCs were harvested at 60–80% confluence for electroporation using the Human Mesenchymal Stem Cell Nucleofector kit (Amaxa Biosystems, Cologne, Germany) according to a modified protocol established in our laboratory for the efficient transfection of human MPCs. 2H. Haleem-Smith, A. Derfoul, C. Okafor, R. Tuli, D. Olsen, D. J. Hall, and R. S. Tuan, manuscript in preparation. Promoter reporter constructs include the following: 1) TOPFLASH, containing multimeric TCF-binding sites (Upstate Cell Signaling Solutions, Waltham, MA); 2) FOPFLASH, containing multimeric mutated TCF-binding sites (Upstate Cell Signaling Solutions, Waltham, MA); 3) a pGL3 basic vector (Promega, Madison, WI) containing 4.0 kb of the 5′-flanking sequences of the human collagen type II α1 procollagen (COL2A1, –577/+3428) gene, which encompasses the promoter, exon 1, and the putative enhancer sequence in the first intron, linked to a luciferase reporter (a kind gift from Dr. M. Goldring); and 4) a plasmid pAGC1(–2368)/5′-UTR containing 2368 bp of the human aggrecan promoter region along with the entire exon 1 and 5′-UTR, linked to a luciferase reporter (a kind gift from Dr. W. B. Valhmu). Luciferase activity was determined using the Luciferase Assay System kit (Promega, Madison, WI). A green fluorescent protein expression vector under the control of the SV40 promoter (pCMS-EGFP; Clontech, Palo Alto, CA) was used to normalize transfection efficiencies. Results were analyzed using Student's t test, p ≤ 0.05. Protein Isolation and Western Analysis—Cell pellets were washed twice with ice-cold phosphate-buffered saline (PBS), lysed with immunoprecipitation buffer (50 mm Tris-HCl, pH 7.4; 1% Nonidet P-40, 0.25% sodium deoxycholate, 150 mm NaCl, 1 mm EDTA) and protease and phosphatase inhibitor mixture, incubated on ice for 30 min, homogenized, and centrifuged at 14,000 × g for 15 min. The supernatant was collected, and protein concentrations were determined by using the BCA assay (Pierce). Equal amounts of protein extracts were fractionated by 10% SDS-PAGE, electroblotted onto Hybond-P membrane (Amersham Biosciences), probed with antibodies to p38, P-p38, ERK1, P-ERK1/2, JNK1, P-JNK, N-cadherin, β-actin (Santa Cruz Biotechnology, Santa Cruz, CA), and β-catenin (Cell Signaling Technology, Beverly, MA), immunoblotted using the ECF Western blotting kit according to the manufacturer's protocol (Amersham Biosciences), and visualized using the Typhoon 9410 Imager (Amersham Biosciences). Metabolic Sulfate Incorporation—Chondrogenic pellet cultures received 1.0 μCi/ml sodium [35S]sulfate and 1.0 μCi/ml [3H]leucine (PerkinElmer Life Sciences) 24 h prior to the time point chosen for measurement of newly synthesized proteoglycans and protein, respectively. Incorporation of radioactivity was measured by liquid scintillation counting (51San Antonio J.D. Tuan R.S. Dev. Biol. 1986; 115: 313-324Crossref PubMed Scopus (85) Google Scholar) and statistically analyzed by using Student's t test (p ≤ 0.05). Histological and Immunohistochemical Analysis—Cell pellet cultures, rinsed twice with PBS, were fixed for 2 h in 2% PBS-buffered paraformaldehyde, dehydrated through a graded ethanol series, infiltrated with isoamyl alcohol, embedded in paraffin, and sectioned at 8 μm thickness for analysis. Histological staining with Alcian blue (pH 1.0) or hematoxylin and eosin was performed as described previously (20Denker A.E. Haas A.R. Nicoll S.B. Tuan R.S. Differentiation. 1999; 64: 67-76Crossref PubMed Scopus (217) Google Scholar, 31Haas A.R. Tuan R.S. Differentiation. 1999; 64: 77-89Crossref PubMed Scopus (149) Google Scholar). Immunohistochemical localization of collagen type II (II-II6B3, 15 μg/ml) and aggrecan (1-C-6, 10 μg/ml, Developmental Studies Hybridoma Bank, Iowa City, IA) was performed by pre-digesting sections with 300 units/ml hyaluronidase or 1.5 units/ml chondroitinase for 15 min at 37 °C, respectively. Colorimetric detection of staining was performed using Histostain-SP kit for DAB (Zymed Laboratories Inc., San Francisco, CA). Cell pellets treated with the N-cadherin antibody, A-CAM (see below), were fixed in 2% PBS-buffered paraformaldehyde and stained directly using Alcian blue, pH 1.0. Inhibition of N-cadherin-mediated Cell Adhesion—A monoclonal antibody to N-cadherin, anti-A cell adhesion molecule (A-CAM, Sigma), was used to functionally inhibit homotypic interactions between N-cadherin molecules during precartilage condensation. Trabecular bone-derived MPCs were prepared for pellet culture as described above, and A-CAM was added as a single dose at the beginning of culture at concentrations varying from 0 to 240 μg/ml. A nonspecific mouse antibody was used as a negative control. Chondrogenesis was assayed at day 3 using the pAGC1(–2368)/5′-UTR promoter reporter construct, and at day 21 by Alcian blue staining, as described above. Activation of MAP Kinase Subtypes, p38, ERK-1, and JNK, upon TGF-β1 Stimulation—Trabecular bone-derived cell pellets treated with and without TGF-β1 were assayed for MAP kinase activities and kinetics of activation. The addition of TGF-β1 led to the rapid transient phosphorylation of p38, ERK-1, and JNK, as determined by Western analysis (Fig. 1). Phosphorylated p38 (P-p38) levels increased dramatically at 0.5 h, peaked at 1 h, and returned to basal levels by 2 h, remaining constant through day 5 of chondrogenic culture. This transient increase in protein levels upon TGF-β1 treatment was kinetically mimicked by phosphorylated ERK-1 (P-ERK-1), the major ERK isoform, as well as phosphorylated JNK (P-JNK), which similarly increased at 0.5 h relative to time 0 h, peaked at 1 h, and returned to basal levels by 2 h. Unlike P-p38, however, P-ERK protein levels peaked again at day 3, and P-JNK levels peaked again at day 1 as chondrogenesis proceeded. Reprobing the same blots with antibodies against the unphosphorylated forms of p38, ERK-1, and JNK MAP kinases revealed no change in total p38, ERK-1, or JNK levels, respectively, during the chondrogenic culture period. Activations of p38, ERK-1, and JNK were absent in untreated control pellet cultures (data not shown). p38, ERK-1, and JNK MAP Kinases Differentially Regulate Chondrogenesis-associated Activities Stimulated by TGF-β1— RT-PCR analysis of MPC pellets maintained in TGF-β1-supplemented chondrogenic medium for 21 days showed significant up-regulation of cartilage-specific gene expression (Fig. 2C), as compared with the untreated control (Fig. 2A). The addition of 5 μm p38 specific inhibitor (SB203580), 10 μm MEK-1 inhibitor (PD98059), or 100 nm JNK-specific chemical inhibitor (SP600125), to TGF-β1-treated pellet cultures led to the lineage-specific down-regulation or complete abrogation of chondrogenic gene expression levels (Fig. 2D). Inhibition of p38 with SB203580 completely abrogated TGF-β1-induced collagen type II (COL2A1) and SOX9 gene expression, with significant down-regulation of aggrecan expression, and reduction of collagen type X (COL10), dermatopontin, and insulin-like growth factor I (IGF I) expression. Relative to the housekeeping gene, GAPDH, collagen type IX (COL9) and cartilage oligomeric matrix protein (COMP) expression levels were unaffected by addition of the p38 inhibitor. ERK inhibition with PD98059 also completely inhibited the TGF-β1-induced gene expression of aggrecan, as well as collagen types II and IX and SOX9. Down-regulated expression of collagen type X, dermatopontin, and IGF I was also seen, whereas similar to the p38 inhibited cultures, mRNA levels of GAPDH and COMP remained unaltered. Finally, JNK inhibition with SP600125 abolished TGF-β1-induced collagen typ" @default.
• W2125497089 created "2016-06-24" @default.
• W2125497089 creator A5024750927 @default.
• W2125497089 creator A5032528396 @default.
• W2125497089 creator A5035412354 @default.
• W2125497089 creator A5039303466 @default.
• W2125497089 creator A5048785031 @default.
• W2125497089 creator A5055374766 @default.
• W2125497089 creator A5057499766 @default.
• W2125497089 creator A5063613593 @default.
• W2125497089 creator A5076569842 @default.
• W2125497089 date "2003-10-01" @default.
• W2125497089 modified "2023-10-14" @default.
• W2125497089 title "Transforming Growth Factor-β-mediated Chondrogenesis of Human Mesenchymal Progenitor Cells Involves N-cadherin and Mitogen-activated Protein Kinase and Wnt Signaling Cross-talk" @default.
• W2125497089 cites W1544751778 @default.
• W2125497089 cites W1572014524 @default.
• W2125497089 cites W1574722884 @default.
• W2125497089 cites W1777605394 @default.
• W2125497089 cites W1902879109 @default.
• W2125497089 cites W1971791040 @default.
• W2125497089 cites W1975853332 @default.
• W2125497089 cites W1978969115 @default.
• W2125497089 cites W1979047519 @default.
• W2125497089 cites W1983795715 @default.
• W2125497089 cites W1986216505 @default.
• W2125497089 cites W1989215255 @default.
• W2125497089 cites W1991415492 @default.
• W2125497089 cites W1996130650 @default.
• W2125497089 cites W2004582943 @default.
• W2125497089 cites W2006004787 @default.
• W2125497089 cites W2008063990 @default.
• W2125497089 cites W2013515157 @default.
• W2125497089 cites W2020078448 @default.
• W2125497089 cites W2027600661 @default.
• W2125497089 cites W2027736364 @default.
• W2125497089 cites W2032372303 @default.
• W2125497089 cites W2032554521 @default.
• W2125497089 cites W2036748347 @default.
• W2125497089 cites W2049015255 @default.
• W2125497089 cites W2053675422 @default.
• W2125497089 cites W2055110202 @default.
• W2125497089 cites W2056752656 @default.
• W2125497089 cites W2059011972 @default.
• W2125497089 cites W2064472921 @default.
• W2125497089 cites W2064770982 @default.
• W2125497089 cites W2070715920 @default.
• W2125497089 cites W2073676252 @default.
• W2125497089 cites W2077443925 @default.
• W2125497089 cites W2088142207 @default.
• W2125497089 cites W2092429962 @default.
• W2125497089 cites W2101361529 @default.
• W2125497089 cites W2111334408 @default.
• W2125497089 cites W2113549157 @default.
• W2125497089 cites W2114094342 @default.
• W2125497089 cites W2120032969 @default.
• W2125497089 cites W2130933340 @default.
• W2125497089 cites W2133526415 @default.
• W2125497089 cites W2137626479 @default.
• W2125497089 cites W2149790590 @default.
• W2125497089 cites W2153042507 @default.
• W2125497089 cites W2153623499 @default.
• W2125497089 cites W2158048826 @default.
• W2125497089 cites W2159999899 @default.
• W2125497089 cites W2173497140 @default.
• W2125497089 cites W2185288066 @default.
• W2125497089 cites W2405694227 @default.
• W2125497089 cites W80132655 @default.
• W2125497089 doi "https://doi.org/10.1074/jbc.m305312200" @default.
• W2125497089 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12893825" @default.
• W2125497089 hasPublicationYear "2003" @default.
• W2125497089 type Work @default.
• W2125497089 sameAs 2125497089 @default.
• W2125497089 citedByCount "441" @default.
• W2125497089 countsByYear W21254970892012 @default.
• W2125497089 countsByYear W21254970892013 @default.
• W2125497089 countsByYear W21254970892014 @default.
• W2125497089 countsByYear W21254970892015 @default.
• W2125497089 countsByYear W21254970892016 @default.
• W2125497089 countsByYear W21254970892017 @default.
• W2125497089 countsByYear W21254970892018 @default.
• W2125497089 countsByYear W21254970892019 @default.
• W2125497089 countsByYear W21254970892020 @default.
• W2125497089 countsByYear W21254970892021 @default.
• W2125497089 countsByYear W21254970892022 @default.
• W2125497089 countsByYear W21254970892023 @default.
• W2125497089 crossrefType "journal-article" @default.
• W2125497089 hasAuthorship W2125497089A5024750927 @default.
• W2125497089 hasAuthorship W2125497089A5032528396 @default.
• W2125497089 hasAuthorship W2125497089A5035412354 @default.
• W2125497089 hasAuthorship W2125497089A5039303466 @default.
• W2125497089 hasAuthorship W2125497089A5048785031 @default.
• W2125497089 hasAuthorship W2125497089A5055374766 @default.
• W2125497089 hasAuthorship W2125497089A5057499766 @default.
• W2125497089 hasAuthorship W2125497089A5063613593 @default.
• W2125497089 hasAuthorship W2125497089A5076569842 @default.
• W2125497089 hasBestOaLocation W21254970891 @default.
• W2125497089 hasConcept C132149769 @default.
• W2125497089 hasConcept C137620995 @default.

• next