FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2126040395> ?p ?o ?g. }

• W2126040395 endingPage "33474" @default.
• W2126040395 startingPage "33466" @default.
• W2126040395 abstract "Uridine diphosphate-glucuronosyltransferase 2 (UGT2)B15 and B17 enzymes conjugate dihydrotestosterone (DHT) and its metabolites androstane-3α, 17β-diol (3α-DIOL) and androsterone (ADT). The presence of UGT2B15/B17 in the epithelial cells of the human prostate has been clearly demonstrated, and significant 3α-DIOL glucuronide and ADT-glucuronide concentrations have been detected in this tissue. The human androgen-dependent cancer cell line, LNCaP, expresses UGT2B15 and -B17 and is also capable of conjugating androgens. To assess the impact of these two genes in the inactivation of androgens in LNCaP cells, their expression was inhibited using RNA interference. The efficient inhibitory effects of a UGT2B15/B17 small interfering RNA (siRNA) probe was established by the 70% reduction of these UGT mRNA levels, which was further confirmed at the protein levels. The glucuronidation of dihydrotestosterone (DHT), 3α-DIOL, and ADT by LNCaP cell homogenates was reduced by more than 75% in UGT2B15/B17 siRNA-transfected LNCaP cells when compared with cells transfected with a non-target probe. In UGT2B15/B17-deficient LNCaP cells, we observe a stronger response to DHT than in control cells, as determined by cell proliferation and expression of eight known androgen-sensitive genes. As expected, the amounts of DHT in cell culture media from control cells were significantly lower than that from UGT2B15/B17 siRNA-treated cells, which was caused by a higher conversion to its corresponding glucuronide derivative. Taken together these data support the idea that UGT2B15 and -B17 are critical enzymes for the local inactivation of androgens and that glucuronidation is a major determinant of androgen action in prostate cells. Uridine diphosphate-glucuronosyltransferase 2 (UGT2)B15 and B17 enzymes conjugate dihydrotestosterone (DHT) and its metabolites androstane-3α, 17β-diol (3α-DIOL) and androsterone (ADT). The presence of UGT2B15/B17 in the epithelial cells of the human prostate has been clearly demonstrated, and significant 3α-DIOL glucuronide and ADT-glucuronide concentrations have been detected in this tissue. The human androgen-dependent cancer cell line, LNCaP, expresses UGT2B15 and -B17 and is also capable of conjugating androgens. To assess the impact of these two genes in the inactivation of androgens in LNCaP cells, their expression was inhibited using RNA interference. The efficient inhibitory effects of a UGT2B15/B17 small interfering RNA (siRNA) probe was established by the 70% reduction of these UGT mRNA levels, which was further confirmed at the protein levels. The glucuronidation of dihydrotestosterone (DHT), 3α-DIOL, and ADT by LNCaP cell homogenates was reduced by more than 75% in UGT2B15/B17 siRNA-transfected LNCaP cells when compared with cells transfected with a non-target probe. In UGT2B15/B17-deficient LNCaP cells, we observe a stronger response to DHT than in control cells, as determined by cell proliferation and expression of eight known androgen-sensitive genes. As expected, the amounts of DHT in cell culture media from control cells were significantly lower than that from UGT2B15/B17 siRNA-treated cells, which was caused by a higher conversion to its corresponding glucuronide derivative. Taken together these data support the idea that UGT2B15 and -B17 are critical enzymes for the local inactivation of androgens and that glucuronidation is a major determinant of androgen action in prostate cells. Production and secretion of testosterone by the testis has long been considered one of the major factors influencing androgen function in androgen target tissues, namely, the prostate. Thus, circulating testosterone taken up from the circulation is converted by 5α-reductase to dihydrotestosterone (DHT), 4The abbreviations used are: DHT, dihydrotestosterone; DHT-G, DHT-glucuronide; 3α-DIOL, androstane-3α, 17β-diol; ADT, androsterone; UGT2, UDP-glucuronosyltransferase 2; UDPGA, UDP-glucuronic acid; LC, liquid chromatography; MS, mass spectometry; RT, reverse transcription; VEGF, vascular endothelial growth factor; AR, androgen receptor; siRNA, small interfering RNA; PSA, prostate-specific antigen. the natural androgen receptor agonist (1Zhou Z.X. Lane M.V. Kemppainen J.A. French F.S. Wilson E.M. Mol. Endocrinol. 1995; 9: 208-218Crossref PubMed Google Scholar). There is clear evidence now that adrenal steroid precursors, namely dehydroepiandrosterone and its sulfate, are converted to testosterone in several tissues (2Bélanger A. Pelletier G. Labrie F. Barbier O. Chouinard S. Trends Endocrinol. Metab. 2003; 14: 473-479Abstract Full Text Full Text PDF PubMed Scopus (203) Google Scholar, 3Labrie F. Luu-The V. Labrie C. Bélanger A. Simard J. Lin S.X. Pelletier G. Endocr. Rev. 2003; 24: 152-182Crossref PubMed Scopus (464) Google Scholar). The observation that the DHT concentration in prostate is only decreased by 50% in castrated patients treated for prostate cancer further support the role of adrenal steroid precursors as a source of androgens (4Geller J. Albert J. Urol. Res. 1987; 15: 151-153Crossref PubMed Scopus (40) Google Scholar, 5Bélanger B. Bélanger A. Labrie F. Dupont A. Cusan L. Monfette G. J. Steroid Biochem. 1989; 32: 695-698Crossref PubMed Scopus (196) Google Scholar, 6Page S.T. Amory J.K. Anawalt B.D. Irwig M.S. Brockenbrough A.T. Matsumoto A.M. Bremner W.J. J. Clin. Endocrinol. Metab. 2006; 91: 4374-4380Crossref PubMed Scopus (66) Google Scholar). These findings of local transformation of circulating steroids into bioactive testosterone and DHT have been integrated in the process called “intracrinology,” where several steroidogenic enzymes, including 3α-hydroxysteroid dehydrogenase-Δ4–5 isomerase (3α-HSD type 1), 17β-HSDs, and 5α-reductase, contribute to the formation of DHT (2Bélanger A. Pelletier G. Labrie F. Barbier O. Chouinard S. Trends Endocrinol. Metab. 2003; 14: 473-479Abstract Full Text Full Text PDF PubMed Scopus (203) Google Scholar, 7Labrie F. Mol. Cell. Endocrinol. 1991; 78: 113-118Crossref PubMed Scopus (769) Google Scholar). Growing evidence indicates that tissue DHT concentrations are also modulated by 3α-hydroxysteroid dehydrogenase (3α-HSD) type 3 and 17β-HSD type 7, which form inactive androstane-3α, 17β-diol (3α-DIOL) and androsterone (ADT) (8Couture J.F. de Jesus-Tran K.P. Roy A.M. Cantin L. Cote P.L. Legrand P. Luu-The V. Labrie F. Breton R. Protein Sci. 2005; 14: 1485-1497Crossref PubMed Scopus (20) Google Scholar, 9Liu H. Robert A. Luu-The V. J. Steroid Biochem. Mol. Biol. 2005; 94: 173-179Crossref PubMed Scopus (23) Google Scholar). Although extremely important in modulating tissue DHT levels, these steroidogenic enzymes are reversible. By contrast, glucuronidation of these substrates, namely DHT, 3α-DIOL, and ADT, is an irreversible process of steroid metabolism, and this conjugation is present in several androgen target tissues (10Green M.D. Oturu E.M. Tephly T.R. Drug Metab. Dispos. 1994; 22: 799-805PubMed Google Scholar, 11Lévesque É. Beaulieu M. Green M.D. Tephly T.R. Bélanger A. Hum D.W. Pharmacogenetics. 1997; 7: 317-325Crossref PubMed Scopus (205) Google Scholar, 12Turgeon D. Carrier J.-S. Lévesque E. Hum D.W. Bélanger A. Endocrinology. 2001; 142: 778-787Crossref PubMed Scopus (249) Google Scholar, 13Beaulieu M. Lévesque E. Hum D.W. Bélanger A. J. Biol. Chem. 1996; 271: 22855-22862Abstract Full Text Full Text PDF PubMed Scopus (176) Google Scholar). Uridine diphosphate-glucuronosyltransferase (UGT) enzymes inactivate substrates by the addition of the glucuronyl moiety of the UDP-glucuronic acid (UDPGA) (14Evans W.E. Relling M.V. Science. 1999; 286: 487-491Crossref PubMed Scopus (2144) Google Scholar, 15Mackenzie P.I. Walter Bock K. Burchell B. Guillemette C. Ikushiro S.I. Iyanagi T. Miners J.O. Owens I.S. Nebert D.W. Pharmacogenet. Genomics. 2005; 15: 677-685Crossref PubMed Scopus (705) Google Scholar). Thus, the bulky, polar metabolite is no longer able to interact with its corresponding receptor, and its excretion is facilitated by the increase in water solubility (15Mackenzie P.I. Walter Bock K. Burchell B. Guillemette C. Ikushiro S.I. Iyanagi T. Miners J.O. Owens I.S. Nebert D.W. Pharmacogenet. Genomics. 2005; 15: 677-685Crossref PubMed Scopus (705) Google Scholar, 16Dutton G.J. Glucuronidation of Drugs and Other Compounds. CRC Press, Boca Raton, FL1980Google Scholar). Of the 17 UGT enzymes identified in humans, only 3 conjugate testosterone and its metabolites at physiologically relevant levels: UGT2B7, -B15, and -B17 (2Bélanger A. Pelletier G. Labrie F. Barbier O. Chouinard S. Trends Endocrinol. Metab. 2003; 14: 473-479Abstract Full Text Full Text PDF PubMed Scopus (203) Google Scholar). UGT2B7 and -B17 conjugate ADT at the position 3-hydroxyl, whereas only UGT2B7 forms 3α-DIOL-3-glucuronide. UGT2B15 and -B17 specifically conjugate DHT and 3α-DIOL at the 17-hydroxyl position (2Bélanger A. Pelletier G. Labrie F. Barbier O. Chouinard S. Trends Endocrinol. Metab. 2003; 14: 473-479Abstract Full Text Full Text PDF PubMed Scopus (203) Google Scholar, 17Chouinard S. Pelletier G. Bélanger A. Barbier O. Endocrinology. 2006; 147: 5431-5442Crossref PubMed Scopus (44) Google Scholar). 3α-DIOL-17G is the predominant form of circulating 3α-DIOL-glucuronide in adult men and has been identified as a strong predicator of prostate volume (18Vandenput L. Labrie F. Mellstrom D. Swanson C. Knutsson T. Peeker R. Ljunggren O. Orwoll E. Eriksson A.L. Damber J.E. Ohlsson C. J. Bone Miner. Res. 2007; 22: 220-227Crossref PubMed Scopus (60) Google Scholar). This was in agreement with previous reports indicating the presence of UGT2B15 and -B17 transcripts in the prostate and the localization of both enzymes by immunohistochemistry in luminal and basal epithelial cells, respectively (19Barbier O. Lapointe H. El Alfy M. Hum D.W. Bélanger A. J. Clin. Endocrinol. Metab. 2000; 85: 4819-4826Crossref PubMed Scopus (50) Google Scholar, 20Chouinard S. Pelletier G. Bélanger A. Barbier O. Endocr. Res. 2004; 30: 717-725Crossref PubMed Scopus (49) Google Scholar). Although circulating testosterone and adrenal steroid precursors and several local steroidogenic enzymes are implicated to ensure production of tissue DHT in a given tissue and, consequently, the expression of androgen-dependent genes, it is now clear that androgen-conjugating enzymes also contribute to local androgen homeostasis. Most interestingly, the presence of a single nucleotide polymorphism within the coding region of the UGT2B15 gene, which results in an amino acid change from an aspartic acid to a tyrosine at position 85, has been previously reported (11Lévesque É. Beaulieu M. Green M.D. Tephly T.R. Bélanger A. Hum D.W. Pharmacogenetics. 1997; 7: 317-325Crossref PubMed Scopus (205) Google Scholar). The UGT2B15D85 enzyme is less efficient in glucuronidating DHT, and it was postulated that the presence of this low activity allele would result in higher intraprostatic DHT concentrations (11Lévesque É. Beaulieu M. Green M.D. Tephly T.R. Bélanger A. Hum D.W. Pharmacogenetics. 1997; 7: 317-325Crossref PubMed Scopus (205) Google Scholar, 19Barbier O. Lapointe H. El Alfy M. Hum D.W. Bélanger A. J. Clin. Endocrinol. Metab. 2000; 85: 4819-4826Crossref PubMed Scopus (50) Google Scholar). Recent genotyping studies (21MacLeod S.L. Nowell S. Plaxco J. Lang N.P. Ann. Surg. Oncol. 2000; 7: 777-782Crossref PubMed Scopus (72) Google Scholar, 22Park J. Chen L. Shade K. Lazarus P. Seigne J. Patterson S. Helal M. Pow-Sang J. J. Urol. 2004; 171: 2484-2488Crossref PubMed Scopus (61) Google Scholar, 23Hajdinjak T. Zagradisnik B. Prostate. 2004; 59: 436-439Crossref PubMed Scopus (34) Google Scholar, 24Okugi H. Nakazato H. Matsui H. Ohtake N. Nakata S. Suzuki K. Cancer Detect. Prev. 2006; 30: 262-268Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar) revealed that the homozygous UGT2B15D85 allele was significantly more common in prostate cancer patients than in control individuals, thus supporting the concept that alteration in androgen inactivation could be implicated in androgen function and prostate cancer. In the present study we have tested the hypothesis that glucuronidation of androgen in LNCaP cells may alter the expression of androgen-dependent genes. In androgen-dependent prostate cancer cells, LNCaP, UGT2B15 and -B17 are highly expressed (17Chouinard S. Pelletier G. Bélanger A. Barbier O. Endocrinology. 2006; 147: 5431-5442Crossref PubMed Scopus (44) Google Scholar) and the conjugation of androgen metabolites such as DHT, 3α-DIOL, and ADT have been demonstrated (2Bélanger A. Pelletier G. Labrie F. Barbier O. Chouinard S. Trends Endocrinol. Metab. 2003; 14: 473-479Abstract Full Text Full Text PDF PubMed Scopus (203) Google Scholar, 25Turgeon D. Chouinard S. Bélanger P. Picard S. Labbe J.F. Borgeat P. Bélanger A. J. Lipid Res. 2003; 44: 1182-1191Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar). The presence of UGT2B15/B17 in LNCaP cells was particularly useful to investigate the regulation of their expression by several factors, including androgen, growth factors, and cytokines (17Chouinard S. Pelletier G. Bélanger A. Barbier O. Endocrinology. 2006; 147: 5431-5442Crossref PubMed Scopus (44) Google Scholar, 26Guillemette C. Hum D.W. Bélanger A. Endocrinology. 1996; 137: 2872-2879Crossref PubMed Scopus (34) Google Scholar, 27Guillemette C. Lévesque E. Beaulieu M. Turgeon D. Hum D.W. Bélanger A. Endocrinology. 1997; 138: 2998-3005Crossref PubMed Scopus (88) Google Scholar, 28Lévesque E. Beaulieu M. Guillemette C. Hum D.W. Bélanger A. Endocrinology. 1998; 139: 2375-2381Crossref PubMed Google Scholar). In the present study we have investigated the effect of knocking down UGT2B15 and -B17 expression on the formation of androgen glucuronides and on the response of androgen-sensitive genes to DHT treatment in LNCaP cells. Our data demonstrate for the first time that changes in UGT2B activity alter the androgen-dependent gene expression. Materials—R1881 was purchased from PerkinElmer Life Sciences. Protein assay reagents were obtained from Bio-Rad. UDPGA and [14C]UDPGA were obtained from Sigma and PerkinElmer Life Sciences, respectively. 3α-DIOL, DHT, and DHT-glucuronide (DHT-G) were purchased from Steraloids (Newport, RI). 3α-DIOL-3-glucuronide, 3α-DIOL-17-glucuronide, and Casodex were provided by the Medicinal Chemistry Division of our laboratory (17Chouinard S. Pelletier G. Bélanger A. Barbier O. Endocrinology. 2006; 147: 5431-5442Crossref PubMed Scopus (44) Google Scholar). Ammonium formate was from Aldrich, and high performance liquid chromatography-grade methanol was provided by VWR Canlab (Montréal, Québec, Canada). Human prostate cancer (LNCaP) cells were obtained from the American Type Culture Collection (Manassas, VA). siRNA for UGT2B15/B17 (Individual siGENOME duplex D-020195-01) and Non-Target #1 were obtained from Dharmacon (Chicago, IL). SYBRGreen PCR Mix 2× was obtained from Applied Biosystems (Foster City, CA). The CellTiter 96 Aqueous One Solution Cell Proliferation Assay was purchased from Promega (Fisher Scientific, Ltd., Nepean, Ontario, Canada). Cell Culture—LNCaP cells were grown as previously described (25Turgeon D. Chouinard S. Bélanger P. Picard S. Labbe J.F. Borgeat P. Bélanger A. J. Lipid Res. 2003; 44: 1182-1191Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar, 27Guillemette C. Lévesque E. Beaulieu M. Turgeon D. Hum D.W. Bélanger A. Endocrinology. 1997; 138: 2998-3005Crossref PubMed Scopus (88) Google Scholar). For transfections with siRNA, LNCaP cells were plated at 2.5 × 104, 5 × 104, 2 × 105, and 5 × 105 cells/well in 96, 24, 12, and 6 wells plates, respectively. Twenty-four hours before transfection, medium was changed for RPMI without serum, and transfections were performed for 24 h using 2 μl of Lipofectin per μg of siRNA in Opti-MEM (Invitrogen). siRNA concentrations ranged from 25 to 100 nm in dose-response experiments (see Table 2), and for time-course experiments, cells were cultured for 24–96 h post-transfections in RPMI with 2% charcoal stripped fetal bovine serum. For glucuronidation assays, cells were homogenized 72 and 96 h after transfections. When required, DHT, R1881, or Casodex was added to media 96 h post-transfection for a duration of 12 h (gene expression assays and media DHT and DHT-G assays) or 72 h post-transfection for a duration of 48 h (cell proliferation assays). 20 μl of Cell Proliferation Quantification kit (Promega) was added to each well for 2 h, and absorbance was quantified at 490 nm. AR agonists were dissolved in ethanol, and the volume added to media never exceeded 0.1% ethanol (v/v). For longer treatments, fresh medium was added every 48 h.TABLE 2Sequence of the UGT2B15/B17 siRNA probe and alignment with the sequence of exon 5 from all human UGT2B genesUGT2B4AATGTCGAGTACAGACTTACTCAATGCACTGAAGACAGTAUGT2B7AATGTCGAGTACAGACTTGCTGAATGCATTGAAGAGAGTAUGT2B10AATGTCGAGTACAGACCTGCTGAATGCACTGAAGACAGTAUGT2B11AATGTCGAGTACAGACCTGCTGAATGCACTGAAGACAGTAUGT2B15CATGTCAAGTAGAGATTTGCTCAATGCATTGAAGTCAGTCUGT2B17CATGTCAAGTAGAGATTTGCTCAATGCATTGAAGTCAGTCUGT2B28AATGTCGAGTACAGACCTGCTGAATGCACTGAAGACAGTA Open table in a new tab Western Blot Experiments—LNCaP cell homogenates were prepared in phosphate-buffered saline solution with dithiothreitol (0.5 mm). For Western blot experiments, 10–20 μg of total proteins were separated by 10% SDS-polyacrylamide gel. Gels were transferred onto nitrocellulose membranes and probed with anti-UGT2B15 (1849 at 1:1500 dilution) (20Chouinard S. Pelletier G. Bélanger A. Barbier O. Endocr. Res. 2004; 30: 717-725Crossref PubMed Scopus (49) Google Scholar), anti-UGT2B17 (EL-95 at 1:2000 dilution) (11Lévesque É. Beaulieu M. Green M.D. Tephly T.R. Bélanger A. Hum D.W. Pharmacogenetics. 1997; 7: 317-325Crossref PubMed Scopus (205) Google Scholar), or the anti-calnexin antibodies (1:5000 dilution) as internal control (Stressgen, Victoria, British Columbia, Canada). An anti-rabbit IgG horse antibody conjugated with peroxidase (Amersham Biosciences) was used as the second antibody, and the resulting immunocomplexes were visualized using a chemiluminescence kit (ECL) (Renaissance, Quebec, Quebec, Canada) and exposed on Hyperfilm™ (Eastman Kodak Co) for 15–60 s. Glucuronidation Assay and Steroid Assays—Enzymatic assays were performed using 10–20 μg of total proteins in 50 mm Tris-buffered saline (pH 7.4) with dithiothreitol (0.5 mm) in the presence of 1 mm UDPGA, 10 mm MgCl2, 50 mm Tris-HCl (pH 7.5), 100 μg/ml phosphatidylcholine, 8.5 mm saccharolactone, and 200 μm concentrations of the different substrates (25Turgeon D. Chouinard S. Bélanger P. Picard S. Labbe J.F. Borgeat P. Bélanger A. J. Lipid Res. 2003; 44: 1182-1191Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar). Assays were incubated at 37 °C for 1 h and terminated by adding 100 μl of methanol followed by centrifugation at 14,000 × g for 10 min, as previously described (13Beaulieu M. Lévesque E. Hum D.W. Bélanger A. J. Biol. Chem. 1996; 271: 22855-22862Abstract Full Text Full Text PDF PubMed Scopus (176) Google Scholar). The formation of glucuronide conjugates in cell homogenate and in cell media DHT-G was measured by using liquid chromatography coupled with mass spectrometry (LC-MS/MS) as previously described (25Turgeon D. Chouinard S. Bélanger P. Picard S. Labbe J.F. Borgeat P. Bélanger A. J. Lipid Res. 2003; 44: 1182-1191Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar). Non-conjugated DHT was determined by gas chromatography mass spectrometry as previously described (29Labrie F. Bélanger A. Bélanger P. Berube R. Martel C. Cusan L. Gomez J. Candas B. Chaussade V. Castiel I. Deloche C. Leclaire J. J. Steroid Biochem. Mol. Biol. 2007; 103: 178-188Crossref PubMed Scopus (108) Google Scholar). The formation of DHT- and R1881-glucuronide by LNCaP cell homogenates (40 μg) was investigated using 0.2 μCi of [14C]UDPGA in enzymatic assay buffer using 20 μm R1881 or DHT for 16 h of incubation at 37 °C and stopped as described above. The presence of glucuronide was demonstrated on TLC using a migration buffer containing toluene:methanol:acetic acid (7:3:1). RNA Isolation, Reverse Transcription (RT), and Real Time PCR—Total RNA was isolated from LNCaP cells according to the Tri-Reagent acid phenol protocol as specified by the supplier (Molecular Research Center Inc., Cincinnati, OH). The reverse transcription reaction was performed using 1.0 μg of total RNA with 100 units of Superscript II (Invitrogen) and 3.75 ng of random hexamer (Roche Applied Science) at 42 °C for 50 min. The real time PCR reactions were performed using an ABI Prism 7000 instrument from Applied Biosystems. For each gene, the amplification efficiency was tested using 2–5 log of concentrations of cDNA produced from LNCaP cell-purified mRNA, and real time PCR were performed as previously described (17Chouinard S. Pelletier G. Bélanger A. Barbier O. Endocrinology. 2006; 147: 5431-5442Crossref PubMed Scopus (44) Google Scholar). A final volume of 20 μl for each reaction comprised 10 μl of SYBRGreen PCR mix, 2 μl of each primer (Table 1), and 6 μl of a RT product (1/100 dilution for genes of interest and 1/1000 for 28S). Conditions for real time PCR were 95 °C for 10 min, 95 °C for 15 s, and 56 °C (UGT2B10, -B15, -B17, KLK4, and VEGF), 60 °C (TMPRSS2 and 28S), 62 °C (B11, AR, and PSA), 63 °C (ABCG1 and SLC16A6), 65 °C (NKX3.1), or 68 °C (RAD23) for 60 s for 40 cycles. ΔΔCt values were calculated by normalizing target gene mRNA with 28S RNA levels. The Ct values of UGT2B were normalized with the internal control 28S (ΔCt = Ctgene of interest – Ct28S, and ΔΔCt were obtained by comparison of siRNA UGT2B15/B17, and Non-Target. For expression of PSA, NKX3.1, TMPRSS2, KLK4, SLC16A6, VEGF, ABCG1, and RAD23A, ΔΔCt values were obtained by normalizing treated cells with control cells.TABLE 1Conditions for real time PCRGenesPrimersFinal concentrationnm28SForward, 5′-AAACTCTGGTGGAGGTCCGT-3′125Reverse, 5′-CTTACCAAAAGTGGCCCACTA-3′UGT2B10Forward, 5′-ATCCCACAAAAGGTTCTT-3′125Reverse, 5′-GCCTTCATGTGAGCAATA-3′UGT2B11Forward, 5′-AAAGGTTCTGTGGAGATTTGAC-3′125Reverse, 5′-GACATTGTGTTGAAGTCCAAT-3′UGT2B15Forward, 5′-GTGTTGGGAATATTATGACTACAGTAAC-3′125Reverse, 5′-GGGTATGTTAAATAGTTCAGCCAGT-3′UGT2B17Forward, 5′-TGACTTTTGGTTTCAAGC-3′300Reverse, 5′-TTCCATTTCCTTAGGCAA-3′PSAForward, 5′-GGCAGGTGCTTGTAGCCTCTC-3′400Reverse, 5′-CACCCGAGCAGGTGCTTTTGC-3′ARForward, 5′-GAAGCCATTGAGCCAGGTGT-3′125Reverse, 5′-TCGTCCACGTGTAAGTTGCG-3′NKX3.1Forward, 5′-CGCTCACGTCCTTCCTCATC-3′400Reverse, 5′-CCTTTCTGGCTCGGTCTCTGC-3′TMPRSS2Forward, 5′-GTGATTTCTCATCCAAATTA-3′300Reverse, 5′-TCCAGCAGAGCTGTTCTGGC-3′KLK4Forward, 5′-GGCACTGGTCATGGAAAACGA-3′300Reverse, 5′-TCAAGACTGTGCAGGCCCAGCC-3′SLC16A6Forward, 5′-ACATCTTCATTCAGAGCATAGC-3′150Reverse, 5′-GTCCCATCTTACACGGTCTC-3′VEGFForward, 5′-GACAAGAAAATCCCTGTGGGC-3′150Reverse, 5′-AACGCGAGTCTGTGTTTTTGC-3′ABCG1Forward, 5′-CGCATCACCTCGCACATTG-3′150Reverse, 5′-TCCCGAAGAAAGACTCCCATG-3′RAD23AForward, 5′-CCCACCTCAGGCATGTCCCATCCC-3′150Reverse, 5′-GCAGATACTCCACGGCTCGGTGGG-3′ Open table in a new tab Statistical Analyses—A nonparametric Student t test was used to analyze for significant difference between the experimental groups by using the JMP Version 5.0.2 software (SAS Institute, Cary, NC). Dose- and Time-dependent Inhibition of UGT2B mRNA Levels Using UGT2B15/B17 siRNA—The UGT inhibition efficiency was assayed by transfecting LNCaP cells with a non-target (control) or with increasing concentrations of a specific UGT2B15/B17 siRNA probe (Table 2) for 72 h. We observed a 70% inhibition of UGT2B15 and -B17 mRNA levels with 25 nm siRNA with no further significant inhibition using higher concentrations (Fig. 1A). Analyses of other UGT2B genes expressed in LNCaP cells reveal that the siRNA probe is specific for UGT2B15 and -B17 mRNA (Fig. 1B). UGT2B7 was also expressed in this cell line, but its levels of expression were almost at the limit of detection (data not shown). Using 25 nm siRNA, we next performed a time-course experiment up to 96 h after transfection. We observed a decrease of 70% in mRNA expression for UGT2B15/B17 at 24 h after transfection with the siRNA, and this inhibition was maintained up to 96 h (Fig. 2A).FIGURE 2Time-dependent inhibition of UGT2B15/B17 mRNA (A) and protein (B) levels. LNCaP cells were transfected with 25 nm of Non-target (control) or B15/B17 siRNA and subsequently cultured for 24, 48, 72, or 96 h. A, UGT2B15 and -B17 mRNA levels were quantified using real time PCR. Data are the mean of two experiments performed in triplicate. B, UGT2B15, B17, and calnexin (loading control) protein levels were analyzed using specific antibodies in total LNCaP cells proteins.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Time-dependent Inhibition of UGT2B15 mRNA and Protein Levels in LNCaP Cells—To further ascertain the inhibition of UGT2B15/B17 expression, we then quantified the UGT2B15 and -B17 protein levels in transfected cells cultured for 72 and 96 h. As expected, Western blot experiments reveal significant levels of UGT2B15 and -B17 protein in both human liver microsome (positive control) and non-target siRNA-transfected cells. Interestingly, the UGT2B15 protein levels in UGT2B15/B17 siRNA-transfected cells were reduced to an undetectable level after 72 and 96 h, whereas the UGT2B17 protein content was significantly reduced but still detectable (Fig. 2B). The equal loading of SDS-PAGE gels was subsequently ensured by Western blotting with the anti-calnexin antibody. These observations confirm that the UGT2B15/B17 siRNA drastically affects the synthesis of the two proteins in LNCaP cells. Inhibition of Androgen-conjugating Activity of UGT2B15/B17 in LNCaP Cells—The consequences of UGT2B15 and -B17 inhibition on the formation of androgen glucuronide were subsequently investigated in glucuronidation assays with siRNA-transfected LNCaP cell homogenates and DHT, ADT, and 3α-DIOL as substrates. The UGT2B17-dependent formation of ADT-3G was 62 and 75%-reduced in UGT2B15/B17-deficient cells cultured for 72 and 96 h, respectively (Fig. 3), which confirms the marked inhibition of UGT2B17 transcript and protein levels. The conjugation of 3α-DIOL and DHT was also decreased by more than 55% (after 72 h) to reach a maximal reduction of almost 95% for 3α-DIOL and 85% for DHT (after 96 h). Because both androgens are substrates of UGT2B15 and UGT2B17, these reductions further confirm that both UGT activities are affected by the UGT2B15/B17 probe (Fig. 3). These data demonstrate that reduction of UGT2B15 and -B17 expression in LNCaP cells results in a lower androgen-conjugating activity in these cells. The impact of the loss in UGT2B15/B17 proteins was also assessed in living cells by measuring the concentrations of DHT and DHT-G in media of UGT-deficient and control cells (Fig. 4). In control cells treated with DHT at 1000 and 5000 pm, the amounts of DHT in media after 12 h of incubation were still significant and were dose-dependent as previously demonstrated (30Guillemette C. Bélanger A. Mol. Cell. Endocrinol. 1995; 107: 131-139Crossref PubMed Scopus (32) Google Scholar). In the presence of DHT, LNCaP cells also produced DHT-G in a dose-dependent manner. This observation confirms that LNCaP cells in culture are able to glucuronidate physiologically relevant concentrations of DHT. Marked increased amounts of DHT in media were measured in UGT2B15/B17-deficient cells compared with control cells when 1000 and 5000 pm DHT was added for 12 h (Fig. 4A). By contrast, a significant decrease in production of DHT-G was observed (Fig. 4B). Taken together, these observations demonstrated that inhibition of UGT2B15 and -B17 expression reduces the formation of androgen-glucuronide derivatives both in in vitro assay and in cultured cell media and that this inhibition results in higher DHT concentrations in cell media. Inhibition of UGT2B15/B17 Enhances the Androgen Signaling Pathway in LNCaP Cells—To first decipher the consequences of the reduction of DHT glucuronidation on the cellular response to androgens, the mRNA levels of eight androgen-regulated genes were compared in control and UGT-deficient LNCaP cells cultured in the presence or absence of 1 nm concentration of R1881 and DHT for 12 h. As illustrated in Table 3, this set of genes (six up-regulated: PSA, KLK4, NKX3.1, SLC16A6, TMPRSS2, and VEGF; two down-regulated: ABCG1 and RAD23A) was chosen based on previous studies having reported the androgen-dependent regulation of their expression in LNCaP cells (31Ma A.H. Xia L. Desai S.J. Boucher D.L. Guan Y. Shih H.M. Shi X.B. Devere White R.W. Chen H.W. Tepper C.G. Kung H.J. Cancer Res. 2006; 66: 8439-8447Crossref PubMed Scopus (29) Google Scholar, 32Kazmin D. Prytkova T. Cook C.E. Wolfinger R. Chu T.M. Beratan D. Norris J.D. Chang C.Y. McDonnell D.P. Mol. Endocrinol. 2006; 20: 1201-1217Crossref PubMed Scopus (59) Google Scholar, 33Prescott J. Jariwala U. Jia L. Cogan J.P. Barski A. Pregizer S. Shen H.C. Arasheben A. Neilson J.J. Frenkel B. Coetzee G.A. Prostate. 2007; 67: 1371-1383Crossref PubMed Scopus (35) Google Scholar, 34Arnold J.T. Le H. McFann K.K. Blackman M.R. Am. J. Physiol. Endocrinol. Metab. 2005; 288: 573-584Crossref PubMed Scopus (104) Google Scholar, 35Xu L.L. Srikantan V. Sesterhenn I.A. Augustus M. Dean R. Moul J.W. Carter K.C. Srivastava S. J. Urol. 2000; 163: 972-979Crossref PubMed Scopus (88) Google Scholar, 36Korkmaz K.S. Korkmaz C.G. Ragnhildstveit E. Kizildag S. Pretlow T.G. Saatcioglu F. Gene (Amst.). 2000; 260: 25-36Crossref PubMed Scopus (42) Google Scholar, 37Jacquinet E. Ra" @default.
• W2126040395 created "2016-06-24" @default.
• W2126040395 creator A5040618366 @default.
• W2126040395 creator A5051681683 @default.
• W2126040395 creator A5079262202 @default.
• W2126040395 date "2007-11-01" @default.
• W2126040395 modified "2023-10-18" @default.
• W2126040395 title "UDP-glucuronosyltransferase 2B15 (UGT2B15) and UGT2B17 Enzymes Are Major Determinants of the Androgen Response in Prostate Cancer LNCaP Cells" @default.
• W2126040395 cites W1551315328 @default.
• W2126040395 cites W1965000608 @default.
• W2126040395 cites W1965516808 @default.
• W2126040395 cites W1966034949 @default.
• W2126040395 cites W1967436688 @default.
• W2126040395 cites W1975906380 @default.
• W2126040395 cites W1982014262 @default.
• W2126040395 cites W1982057232 @default.
• W2126040395 cites W1984248209 @default.
• W2126040395 cites W1988871942 @default.
• W2126040395 cites W1990622908 @default.
• W2126040395 cites W1992985137 @default.
• W2126040395 cites W2002321066 @default.
• W2126040395 cites W2007136533 @default.
• W2126040395 cites W2012186981 @default.
• W2126040395 cites W2019845113 @default.
• W2126040395 cites W2023507149 @default.
• W2126040395 cites W2023862781 @default.
• W2126040395 cites W2024390703 @default.
• W2126040395 cites W2024913341 @default.
• W2126040395 cites W2030756436 @default.
• W2126040395 cites W2038564788 @default.
• W2126040395 cites W2048327703 @default.
• W2126040395 cites W2058850167 @default.
• W2126040395 cites W2061587734 @default.
• W2126040395 cites W2064602503 @default.
• W2126040395 cites W2066538248 @default.
• W2126040395 cites W2071498240 @default.
• W2126040395 cites W2077257393 @default.
• W2126040395 cites W2088977633 @default.
• W2126040395 cites W2093498393 @default.
• W2126040395 cites W2098243593 @default.
• W2126040395 cites W2099086346 @default.
• W2126040395 cites W2100087320 @default.
• W2126040395 cites W2101625495 @default.
• W2126040395 cites W2114770772 @default.
• W2126040395 cites W2122680090 @default.
• W2126040395 cites W2125822435 @default.
• W2126040395 cites W2127711138 @default.
• W2126040395 cites W2145801998 @default.
• W2126040395 cites W2150488741 @default.
• W2126040395 cites W2150775704 @default.
• W2126040395 cites W2164718200 @default.
• W2126040395 cites W2172811803 @default.
• W2126040395 cites W3017354167 @default.
• W2126040395 cites W4246234200 @default.
• W2126040395 doi "https://doi.org/10.1074/jbc.m703370200" @default.
• W2126040395 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17848572" @default.
• W2126040395 hasPublicationYear "2007" @default.
• W2126040395 type Work @default.
• W2126040395 sameAs 2126040395 @default.
• W2126040395 citedByCount "93" @default.
• W2126040395 countsByYear W21260403952012 @default.
• W2126040395 countsByYear W21260403952013 @default.
• W2126040395 countsByYear W21260403952014 @default.
• W2126040395 countsByYear W21260403952015 @default.
• W2126040395 countsByYear W21260403952016 @default.
• W2126040395 countsByYear W21260403952017 @default.
• W2126040395 countsByYear W21260403952018 @default.
• W2126040395 countsByYear W21260403952019 @default.
• W2126040395 countsByYear W21260403952020 @default.
• W2126040395 countsByYear W21260403952021 @default.
• W2126040395 countsByYear W21260403952022 @default.
• W2126040395 countsByYear W21260403952023 @default.
• W2126040395 crossrefType "journal-article" @default.
• W2126040395 hasAuthorship W2126040395A5040618366 @default.
• W2126040395 hasAuthorship W2126040395A5051681683 @default.
• W2126040395 hasAuthorship W2126040395A5079262202 @default.
• W2126040395 hasBestOaLocation W21260403951 @default.
• W2126040395 hasConcept C121608353 @default.
• W2126040395 hasConcept C126322002 @default.
• W2126040395 hasConcept C134018914 @default.
• W2126040395 hasConcept C181199279 @default.
• W2126040395 hasConcept C185592680 @default.
• W2126040395 hasConcept C2777911890 @default.
• W2126040395 hasConcept C2779723316 @default.
• W2126040395 hasConcept C2780192828 @default.
• W2126040395 hasConcept C2781278898 @default.
• W2126040395 hasConcept C502942594 @default.
• W2126040395 hasConcept C55493867 @default.
• W2126040395 hasConcept C71315377 @default.
• W2126040395 hasConcept C71924100 @default.
• W2126040395 hasConcept C87644729 @default.
• W2126040395 hasConceptScore W2126040395C121608353 @default.
• W2126040395 hasConceptScore W2126040395C126322002 @default.
• W2126040395 hasConceptScore W2126040395C134018914 @default.
• W2126040395 hasConceptScore W2126040395C181199279 @default.
• W2126040395 hasConceptScore W2126040395C185592680 @default.
• W2126040395 hasConceptScore W2126040395C2777911890 @default.
• W2126040395 hasConceptScore W2126040395C2779723316 @default.

• next