FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2126459623> ?p ?o ?g. }

• W2126459623 endingPage "14498" @default.
• W2126459623 startingPage "14492" @default.
• W2126459623 abstract "c-Jun is a transcription factor that plays an important role in regulating cell growth, apoptosis, differentiation, and transformation. The transcriptional activity of c-Jun can be regulated by both phosphorylation and sumoylation. It has also been shown that c-Jun transcription can be regulated by SuPr-1, an alternatively spliced form of SUMO-specific protease 2 (SENP2). However, the ability of SuPr-1 to enhance c-Jun transcription is dependent on promyelocytic leukemia but is independent of the desumoylation activity of SuPr-1. Here, we show that SUMO-specific protease 1 (SENP1) also markedly enhances the transcription activity of c-Jun. The action of SENP1 on c-Jun transcription is independent of the sumoylation and phosphorylation status of c-Jun but is critically dependent on the desumoylation activity of SENP1. We further show that p300 is essential for SENP1 to enhance c-Jun-dependent transcription because SENP1 can desumoylate the CRD1 domain of p300, thereby releasing the cis-repression of CRD1 on p300. Thus, two SUMO-specific proteases regulate c-Jun-dependent transcription through entirely different mechanisms. c-Jun is a transcription factor that plays an important role in regulating cell growth, apoptosis, differentiation, and transformation. The transcriptional activity of c-Jun can be regulated by both phosphorylation and sumoylation. It has also been shown that c-Jun transcription can be regulated by SuPr-1, an alternatively spliced form of SUMO-specific protease 2 (SENP2). However, the ability of SuPr-1 to enhance c-Jun transcription is dependent on promyelocytic leukemia but is independent of the desumoylation activity of SuPr-1. Here, we show that SUMO-specific protease 1 (SENP1) also markedly enhances the transcription activity of c-Jun. The action of SENP1 on c-Jun transcription is independent of the sumoylation and phosphorylation status of c-Jun but is critically dependent on the desumoylation activity of SENP1. We further show that p300 is essential for SENP1 to enhance c-Jun-dependent transcription because SENP1 can desumoylate the CRD1 domain of p300, thereby releasing the cis-repression of CRD1 on p300. Thus, two SUMO-specific proteases regulate c-Jun-dependent transcription through entirely different mechanisms. c-Jun is a major component of the heterodimeric transcription factor AP-1 and plays an important role in regulating cell growth, apoptosis, differentiation, and transformation (1Angel P. Karin M. Biochim. Biophys. Acta. 1991; 1072: 129-157Crossref PubMed Scopus (3256) Google Scholar, 2Eferl R. Wagner E.F. Nat. Rev. Cancer. 2003; 3: 859-868Crossref PubMed Scopus (1618) Google Scholar, 3Karin M. Liu Z. Zandi E. Curr. Opin. Cell Biol. 1997; 9: 240-246Crossref PubMed Scopus (2289) Google Scholar, 4Shaulian E. Karin M. Oncogene. 2001; 20: 2390-2400Crossref PubMed Scopus (1369) Google Scholar, 5Shaulian E. Karin M. Nat. Cell Biol. 2002; 4: E131-E136Crossref PubMed Scopus (2173) Google Scholar). A plethora of physiological stimuli and environmental stresses can induce c-Jun activity through the c-Jun N-terminal kinase (JNK) 1The abbreviations used are: JNK, c-Jun N-terminal kinase; SENP, SUMO/Sentrin-specific protease; HDAC, histone deacetylase; siRNA, small interfering RNA; PMA, phorbol 12-myristate 13-acetate; TSA, trichostatin A; HA, hemagglutinin; mCRD1, minimal CRD1 domain; CRD1, cell cycle regulatory domain 1; DBD, DNA-binding domain; SUMO, small ubiquitin-related modifier.1The abbreviations used are: JNK, c-Jun N-terminal kinase; SENP, SUMO/Sentrin-specific protease; HDAC, histone deacetylase; siRNA, small interfering RNA; PMA, phorbol 12-myristate 13-acetate; TSA, trichostatin A; HA, hemagglutinin; mCRD1, minimal CRD1 domain; CRD1, cell cycle regulatory domain 1; DBD, DNA-binding domain; SUMO, small ubiquitin-related modifier.-mediated pathway (3Karin M. Liu Z. Zandi E. Curr. Opin. Cell Biol. 1997; 9: 240-246Crossref PubMed Scopus (2289) Google Scholar, 4Shaulian E. Karin M. Oncogene. 2001; 20: 2390-2400Crossref PubMed Scopus (1369) Google Scholar, 5Shaulian E. Karin M. Nat. Cell Biol. 2002; 4: E131-E136Crossref PubMed Scopus (2173) Google Scholar, 6Behrens A. Sibilia M. Wagner E.F. Nat. Genet. 1999; 21: 326-329Crossref PubMed Scopus (594) Google Scholar, 7Dunn C. Wiltshire C. MacLaren A. Gillespie D.A. Cell. Signal. 2002; 14: 585-593Crossref PubMed Scopus (169) Google Scholar, 8Minden A. Lin A. Smeal T. Derijard B. Cobb M. Davis R. Karin M. Mol. Cell. Biol. 1994; 14: 6683-6688Crossref PubMed Scopus (436) Google Scholar, 9Minden A. Karin M. Biochim. Biophys. Acta. 1997; 1333: F85-104PubMed Google Scholar). Once activated, JNKs translocate to the nucleus, phosphorylate c-Jun at Ser-63 and Ser-73, and thereby enhance c-Jun transcriptional activity (3Karin M. Liu Z. Zandi E. Curr. Opin. Cell Biol. 1997; 9: 240-246Crossref PubMed Scopus (2289) Google Scholar, 6Behrens A. Sibilia M. Wagner E.F. Nat. Genet. 1999; 21: 326-329Crossref PubMed Scopus (594) Google Scholar, 8Minden A. Lin A. Smeal T. Derijard B. Cobb M. Davis R. Karin M. Mol. Cell. Biol. 1994; 14: 6683-6688Crossref PubMed Scopus (436) Google Scholar, 9Minden A. Karin M. Biochim. Biophys. Acta. 1997; 1333: F85-104PubMed Google Scholar, 10Behrens A. Jochum W. Sibilia M. Wagner E.F. Oncogene. 2000; 19: 2657-2663Crossref PubMed Scopus (176) Google Scholar, 11Smeal T. Binetruy B. Mercola D.A. Birrer M. Karin M. Nature. 1991; 354: 494-496Crossref PubMed Scopus (697) Google Scholar). Although JNK-mediated c-Jun phosphorylation is a well documented mechanism for activating c-Jun-dependent transcription, studies with knock-in mice indicated that phosphorylation of c-Jun at Ser-63 and Ser-73 is not essential for some of the biological functions of c-Jun (12Eferl R. Ricci R. Kenner L. Zenz R. David J.P. Rath M. Wagner E.F. Cell. 2003; 112: 181-192Abstract Full Text Full Text PDF PubMed Scopus (404) Google Scholar, 13Grimm C. Wenzel A. Behrens A. Hafezi F. Wagner E.F. Reme C.E. Cell Death Differ. 2001; 8: 859-867Crossref PubMed Scopus (35) Google Scholar, 14Wisdom R. Johnson R.S. Moore C. EMBO J. 1999; 18: 188-197Crossref PubMed Scopus (523) Google Scholar). These observations suggest that regulation of c-Jun transcriptional activity is complex and may occur at different levels. It is well known that c-Jun interacts with various co-regulatory proteins; this interaction can regulate the transcriptional activity of c-Jun (7Dunn C. Wiltshire C. MacLaren A. Gillespie D.A. Cell. Signal. 2002; 14: 585-593Crossref PubMed Scopus (169) Google Scholar, 15Claret F.X. Hibi M. Dhut S. Toda T. Karin M. Nature. 1996; 383: 453-457Crossref PubMed Scopus (406) Google Scholar, 16Lee J.S. See R.H. Deng T. Shi Y. Mol. Cell. Biol. 1996; 16: 4312-4326Crossref PubMed Scopus (137) Google Scholar, 17Bannister A.J. Oehler T. Wilhelm D. Angel P. Kouzarides T. Oncogene. 1995; 11: 2509-2514PubMed Google Scholar, 18Arias J. Alberts A.S. Brindle P. Claret F.X. Smeal T. Karin M. Feramisco J. Montminy M. Nature. 1994; 370: 226-229Crossref PubMed Scopus (680) Google Scholar). p300 is a well known co-activator of c-Jun (7Dunn C. Wiltshire C. MacLaren A. Gillespie D.A. Cell. Signal. 2002; 14: 585-593Crossref PubMed Scopus (169) Google Scholar, 16Lee J.S. See R.H. Deng T. Shi Y. Mol. Cell. Biol. 1996; 16: 4312-4326Crossref PubMed Scopus (137) Google Scholar, 19Vries R.G. Prudenziati M. Zwartjes C. Verlaan M. Kalkhoven E. Zantema A. EMBO J. 2001; 20: 6095-6103Crossref PubMed Scopus (72) Google Scholar, 20Albanese C. D'Amico M. Reutens A.T. Fu M. Watanabe G. Lee R.J. Kitsis R.N. Henglein B. Avantaggiati M. Somasundaram K. Thimmapaya B. Pestell R.G. J. Biol. Chem. 1999; 274: 34186-34195Abstract Full Text Full Text PDF PubMed Scopus (170) Google Scholar) that has been shown to physically interact with c-Jun and activate c-Jun-dependent transcription (16Lee J.S. See R.H. Deng T. Shi Y. Mol. Cell. Biol. 1996; 16: 4312-4326Crossref PubMed Scopus (137) Google Scholar). Because the transcriptional activity of p300 can be modulated by a number of signaling pathways (21Goodman R.H. Smolik S. Genes Dev. 2000; 14: 1553-1577PubMed Google Scholar, 22Girdwood D. Bumpass D. Vaughan O.A. Thain A. Anderson L.A. Snowden A.W. Garcia-Wilson E. Perkins N.D. Hay R.T. Mol. Cell. 2003; 11: 1043-1054Abstract Full Text Full Text PDF PubMed Scopus (381) Google Scholar, 23Gregory D.J. Garcia-Wilson E. Poole J.C. Snowden A.W. Roninson I.B. Perkins N.D. Cell Cycle. 2002; 1: 343-350Crossref PubMed Scopus (5) Google Scholar, 24Thompson P.R. Wang D. Wang L. Fulco M. Pediconi N. Zhang D. An W. Ge Q. Roeder R.G. Wong J. Levrero M. Sartorelli V. Cotter R.J. Cole P.A. Nat. Struct. Mol. Biol. 2004; 11: 308-315Crossref PubMed Scopus (326) Google Scholar, 25Ait-Si-Ali S. Ramirez S. Barre F.X. Dkhissi F. Magnaghi-Jaulin L. Girault J.A. Robin P. Knibiehler M. Pritchard L.L. Ducommun B. Trouche D. Harel-Bellan A. Nature. 1998; 396: 184-186Crossref PubMed Scopus (269) Google Scholar), p300 provides an additional level of regulation for c-Jun-dependent transcription. It has been reported that p21 regulates p300 transcriptional activity (23Gregory D.J. Garcia-Wilson E. Poole J.C. Snowden A.W. Roninson I.B. Perkins N.D. Cell Cycle. 2002; 1: 343-350Crossref PubMed Scopus (5) Google Scholar, 25Ait-Si-Ali S. Ramirez S. Barre F.X. Dkhissi F. Magnaghi-Jaulin L. Girault J.A. Robin P. Knibiehler M. Pritchard L.L. Ducommun B. Trouche D. Harel-Bellan A. Nature. 1998; 396: 184-186Crossref PubMed Scopus (269) Google Scholar, 26Perkins N.D. Cell Cycle. 2002; 1: 39-41Crossref PubMed Scopus (63) Google Scholar, 27Snowden A.W. Anderson L.A. Webster G.A. Perkins N.D. Mol. Cell. Biol. 2000; 20: 2676-2686Crossref PubMed Scopus (112) Google Scholar). p21 not only inhibits p300-bound cyclin E-Cdk2 activity through repression of the histone acetyltransferase activity of p300 (28Perkins N.D. Felzien L.K. Betts J.C. Leung K. Beach D.H. Nabel G.J. Science. 1997; 275: 523-527Crossref PubMed Scopus (666) Google Scholar), it also stimulates p300 transactivation (27Snowden A.W. Anderson L.A. Webster G.A. Perkins N.D. Mol. Cell. Biol. 2000; 20: 2676-2686Crossref PubMed Scopus (112) Google Scholar). Within p300, a domain named CRD1 has been identified as a domain with strong transcriptional repression (27Snowden A.W. Anderson L.A. Webster G.A. Perkins N.D. Mol. Cell. Biol. 2000; 20: 2676-2686Crossref PubMed Scopus (112) Google Scholar). CRD1 functions independently of the p300 histone acetyltransferase domains but can repress the transactivational activity of p300 (22Girdwood D. Bumpass D. Vaughan O.A. Thain A. Anderson L.A. Snowden A.W. Garcia-Wilson E. Perkins N.D. Hay R.T. Mol. Cell. 2003; 11: 1043-1054Abstract Full Text Full Text PDF PubMed Scopus (381) Google Scholar, 27Snowden A.W. Anderson L.A. Webster G.A. Perkins N.D. Mol. Cell. Biol. 2000; 20: 2676-2686Crossref PubMed Scopus (112) Google Scholar). p21 de-represses this CRD1 activity and thus selectively activates p300-dependent transcription at specific promoters (27Snowden A.W. Anderson L.A. Webster G.A. Perkins N.D. Mol. Cell. Biol. 2000; 20: 2676-2686Crossref PubMed Scopus (112) Google Scholar). Recent findings indicate that sumoylation is required for CRD1-dependent transcriptional repression (22Girdwood D. Bumpass D. Vaughan O.A. Thain A. Anderson L.A. Snowden A.W. Garcia-Wilson E. Perkins N.D. Hay R.T. Mol. Cell. 2003; 11: 1043-1054Abstract Full Text Full Text PDF PubMed Scopus (381) Google Scholar). The two SUMO modification sites within the CRD1 domain of p300 have been identified, and mutation at these two sites can reduce the repression of CRD1 domain and p21 inducibility (22Girdwood D. Bumpass D. Vaughan O.A. Thain A. Anderson L.A. Snowden A.W. Garcia-Wilson E. Perkins N.D. Hay R.T. Mol. Cell. 2003; 11: 1043-1054Abstract Full Text Full Text PDF PubMed Scopus (381) Google Scholar). Therefore, SUMO modification provides a new mechanism to control p300 function. Because a number of transcription factors and co-regulators are sumoylated, SUMO modification has emerged as an important mechanism for transcription regulation (22Girdwood D. Bumpass D. Vaughan O.A. Thain A. Anderson L.A. Snowden A.W. Garcia-Wilson E. Perkins N.D. Hay R.T. Mol. Cell. 2003; 11: 1043-1054Abstract Full Text Full Text PDF PubMed Scopus (381) Google Scholar, 29Ross S. Best J.L. Zon L.I. Gill G. Mol. Cell. 2002; 10: 831-842Abstract Full Text Full Text PDF PubMed Scopus (315) Google Scholar, 30Yang S.H. Jaffray E. Hay R.T. Sharrocks A.D. Mol. Cell. 2003; 12: 63-74Abstract Full Text Full Text PDF PubMed Scopus (213) Google Scholar, 31Yang S.H. Sharrocks A.D. Mol. Cell. 2004; 13: 611-617Abstract Full Text Full Text PDF PubMed Scopus (290) Google Scholar, 32Best J.L. Ganiatsas S. Agarwal S. Changou A. Salomoni P. Shirihai O. Meluh P.B. Pandolfi P.P. Zon L.I. Mol. Cell. 2002; 10: 843-855Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar, 33David G. Neptune M.A. DePinho R.A. J. Biol. Chem. 2002; 277: 23658-23663Abstract Full Text Full Text PDF PubMed Scopus (195) Google Scholar, 34Hay R.T. Trends Biochem. Sci. 2001; 26: 332-333Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar, 35Schmidt D. Muller S. Cell. Mol. Life Sci. 2003; 60: 2561-2574Crossref PubMed Scopus (222) Google Scholar, 36Holmstrom S. Van Antwerp M.E. Iniguez-Lluhi J.A. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 15758-15763Crossref PubMed Scopus (129) Google Scholar, 37Seeler J.S. Dejean A. Nat. Rev. Mol. Cell. Biol. 2003; 4: 690-699Crossref PubMed Scopus (575) Google Scholar, 38Freiman R.N. Tjian R. Cell. 2003; 112: 11-17Abstract Full Text Full Text PDF PubMed Scopus (196) Google Scholar, 39Cheng J. Wang D. Wang Z. Yeh E.T. Mol. Cell. Biol. 2004; 24: 6021-6028Crossref PubMed Scopus (155) Google Scholar, 40Muller S. Berger M. Lehembre F. Seeler J.S. Haupt Y. Dejean A. J. Biol. Chem. 2000; 275: 13321-13329Abstract Full Text Full Text PDF PubMed Scopus (350) Google Scholar). Sumoylation is a dynamic and reversible process (34Hay R.T. Trends Biochem. Sci. 2001; 26: 332-333Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar, 41Yeh E.T. Gong L. Kamitani T. Gene (Amst.). 2000; 248: 1-14Crossref PubMed Scopus (412) Google Scholar, 42Gong L. Millas S. Maul G.G. Yeh E.T. J. Biol. Chem. 2000; 275: 3355-3359Abstract Full Text Full Text PDF PubMed Scopus (234) Google Scholar, 43Li S.J. Hochstrasser M. Nature. 1999; 398: 246-251Crossref PubMed Scopus (604) Google Scholar). SUMO-specific proteases (SENPs) responsible for desumoylation have been identified from yeast to mammals (32Best J.L. Ganiatsas S. Agarwal S. Changou A. Salomoni P. Shirihai O. Meluh P.B. Pandolfi P.P. Zon L.I. Mol. Cell. 2002; 10: 843-855Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar, 41Yeh E.T. Gong L. Kamitani T. Gene (Amst.). 2000; 248: 1-14Crossref PubMed Scopus (412) Google Scholar, 42Gong L. Millas S. Maul G.G. Yeh E.T. J. Biol. Chem. 2000; 275: 3355-3359Abstract Full Text Full Text PDF PubMed Scopus (234) Google Scholar, 43Li S.J. Hochstrasser M. Nature. 1999; 398: 246-251Crossref PubMed Scopus (604) Google Scholar, 44Hang J. Dasso M. J. Biol. Chem. 2002; 277: 19961-19966Abstract Full Text Full Text PDF PubMed Scopus (191) Google Scholar, 45Kadoya T. Yamamoto H. Suzuki T. Yukita A. Fukui A. Michiue T. Asahara T. Tanaka K. Asashima M. Kikuchi A. Mol. Cell. Biol. 2002; 22: 3803-3819Crossref PubMed Scopus (67) Google Scholar, 46Li S.J. Hochstrasser M. Mol. Cell. Biol. 2000; 20: 2367-2377Crossref PubMed Scopus (311) Google Scholar, 47Bachant J. Alcasabas A. Blat Y. Kleckner N. Elledge S.J. Mol. Cell. 2002; 9: 1169-1182Abstract Full Text Full Text PDF PubMed Scopus (219) Google Scholar). Although several SENPs have been reported in mammals (32Best J.L. Ganiatsas S. Agarwal S. Changou A. Salomoni P. Shirihai O. Meluh P.B. Pandolfi P.P. Zon L.I. Mol. Cell. 2002; 10: 843-855Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar, 39Cheng J. Wang D. Wang Z. Yeh E.T. Mol. Cell. Biol. 2004; 24: 6021-6028Crossref PubMed Scopus (155) Google Scholar, 41Yeh E.T. Gong L. Kamitani T. Gene (Amst.). 2000; 248: 1-14Crossref PubMed Scopus (412) Google Scholar, 45Kadoya T. Yamamoto H. Suzuki T. Yukita A. Fukui A. Michiue T. Asahara T. Tanaka K. Asashima M. Kikuchi A. Mol. Cell. Biol. 2002; 22: 3803-3819Crossref PubMed Scopus (67) Google Scholar, 48Kim K.I. Baek S.H. Jeon Y.J. Nishimori S. Suzuki T. Uchida S. Shimbara N. Saitoh H. Tanaka K. Chung C.H. J. Biol. Chem. 2000; 275: 14102-14106Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar), the biological function of SENPs remains to be characterized. Recent studies indicate that SENP1 and SENP2 can regulate the transcriptional activity of transcription factors. SENP1 is a nuclear protease that can enhance androgen receptor-dependent transcription through the desumoylation of histone deacetylase 1 (HDAC1) (39Cheng J. Wang D. Wang Z. Yeh E.T. Mol. Cell. Biol. 2004; 24: 6021-6028Crossref PubMed Scopus (155) Google Scholar, 42Gong L. Millas S. Maul G.G. Yeh E.T. J. Biol. Chem. 2000; 275: 3355-3359Abstract Full Text Full Text PDF PubMed Scopus (234) Google Scholar). SENP2 is a nuclear envelope-associated protease (44Hang J. Dasso M. J. Biol. Chem. 2002; 277: 19961-19966Abstract Full Text Full Text PDF PubMed Scopus (191) Google Scholar). A spliced isoform of mouse SENP2, called SuPr1, acts as a transcriptional regulator to induce c-Jun and Sp3 activity (29Ross S. Best J.L. Zon L.I. Gill G. Mol. Cell. 2002; 10: 831-842Abstract Full Text Full Text PDF PubMed Scopus (315) Google Scholar, 32Best J.L. Ganiatsas S. Agarwal S. Changou A. Salomoni P. Shirihai O. Meluh P.B. Pandolfi P.P. Zon L.I. Mol. Cell. 2002; 10: 843-855Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar, 49Sapetschnig A. Rischitor G. Braun H. Doll A. Schergaut M. Melchior F. Suske G. EMBO J. 2002; 21: 5206-5215Crossref PubMed Scopus (224) Google Scholar). However, the activity of SuPr1 on c-Jun is independent of its catalytic activity (32Best J.L. Ganiatsas S. Agarwal S. Changou A. Salomoni P. Shirihai O. Meluh P.B. Pandolfi P.P. Zon L.I. Mol. Cell. 2002; 10: 843-855Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar). In this study, we show that SENP1 can induce c-Jun-dependent transcription. In contrast to that of SuPr1, the desumoylation activity of SENP1 is absolutely required for its ability to induce c-Jun-dependent transcription. We show that p300 is essential for the activation of c-Jun-dependent transcription by SENP1. Furthermore, SENP1 can desumoylate p300 and release the repression of SUMO-CRD1, leading to an increase in p300 transactivation. Our findings demonstrate a difference between SENP1 and SENP2 in the regulation of c-Jun-dependent transcription and provide a novel mechanism for regulating c-Jun-dependent transcription. Plasmids—Gal4-p300, Gal4-p300ΔCRD1, Gal4-p300N, Gal4-p300N+mCRD1, Gal4-p300N+mCRD1KR, HA-SUMO-1, FLAG-SENP1, FLAG-SENP1 mutant (R630L, K631M), and FLAG-SENP2 have been described previously (22Girdwood D. Bumpass D. Vaughan O.A. Thain A. Anderson L.A. Snowden A.W. Garcia-Wilson E. Perkins N.D. Hay R.T. Mol. Cell. 2003; 11: 1043-1054Abstract Full Text Full Text PDF PubMed Scopus (381) Google Scholar, 39Cheng J. Wang D. Wang Z. Yeh E.T. Mol. Cell. Biol. 2004; 24: 6021-6028Crossref PubMed Scopus (155) Google Scholar). Gal4-c-Jun full-length, Gal4-c-Jun full-length mutant (K226R), His-p300 (1–1004), His-p300 (1–1045), GST-p300 (1–1045), HA-p300ΔCRD1, and FLAG-SENP2 mutant (R577L, K578M) were prepared by standard cloning and PCR-based mutagenesis. Details of these constructions are available upon request. Plasmids Gal4-luciferase, Gal4-DBD, Gal4-c-Jun, Gal4-c-Jun S63A, S73A, and Jun (–79/+170)-luc were gifts from Dr. Bing Su (The University of Texas M. D. Anderson Cancer Center). The Jun (–79/+170)-luc mutant was prepared by PCR-based mutagenesis with the oligonucleotide CGGGGATCCACCATTGGGCT. Expression plasmids HA-p300, E1A, and E1AΔ2–36 were gifts from Dr. Yongzhong Wu (Virginia Commonwealth University). We used antibodies against FLAG (M2, Sigma), HA (HA-7, Sigma), His (HIS1, Sigma), Gal4-DBD (BD Biosciences), c-Jun, phospho-Jun (Ser73) (Upstate Biotechnology), and E1a (sc-430, Santa Cruz Biotechnology). Cell Transfection and Luciferase Assays—PC-3 cells were grown in RPMI 1640 medium (Invitrogen) supplemented with 10% fetal bovine serum. COS-7 cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum. After 24 h of cultivation, these cells were transiently transfected with expression plasmids by Lipofectamine (Invitrogen) according to the manufacturer's instructions. The cells were starved for 18 h before luciferase was assayed as described previously (50Su B. Jacinto E. Hibi M. Kallunki T. Karin M. Ben-Neriah Y. Cell. 1994; 77: 727-736Abstract Full Text PDF PubMed Scopus (849) Google Scholar). β-Galactosidase activity was used as an internal control. TALON Resin Precipitation—TALON resin (Clontech) precipitation of His-p300 was carried out as described in a previous publication (51Kamitani T. Kito K. Nguyen H.P. Wada H. Fukuda-Kamitani T. Yeh E.T. J. Biol. Chem. 1998; 273: 26675-26682Abstract Full Text Full Text PDF PubMed Scopus (274) Google Scholar). Briefly, total cell lysates were prepared in lysis buffer (6 m guanidine hydrochloride, 20 mm sodium phosphate, 500 mm sodium chloride, pH 7.8). DNA in the sample was sheared with a 25-gauge needle, and the lysate was centrifuged at 100,000 × g at 15 °C for 30 min. The supernatant was incubated with TALON resin beads for 1 h at room temperature. The beads were washed twice with washing buffer (8 m urea, 20 mm sodium phosphate, 500 mm sodium chloride, pH 7.8) and then twice more with another washing buffer (8 m urea, 20 mm sodium phosphate, 500 mm sodium chloride, pH 6.0). Subsequently, the beads were washed with phosphate-buffered saline twice and treated in 2% sodium dodecyl sulfate treating solution for SDS-polyacrylamide gel electrophoretic analysis. Western Blotting—Western blotting was carried out as described in our previous publication (52Kamitani T. Nguyen H.P. Yeh E.T. J. Biol. Chem. 1997; 272: 14001-14004Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar). RNA Interference—The 21-nucleotide SENP1 small interfering RNA (siRNA) (GTGAACCACAACTCCGTATTC) was synthesized by Dharmacon (39Cheng J. Wang D. Wang Z. Yeh E.T. Mol. Cell. Biol. 2004; 24: 6021-6028Crossref PubMed Scopus (155) Google Scholar). The same sequence in the inverted orientation was used as a nonspecific siRNA control. The SENP1 and nonspecific siRNA oligonucleotides were inserted into the pSuppressorNeo vector (IMGENEX Corporation) according to the manufacturer's instructions. PC-3 cells were grown in 6-well plates and transfected with the siRNA plasmid (1 μg) three times at 12-h intervals using Lipofectamine 2000 (Invitrogen). The cells were harvested 72 h after transfection. Expression of SENP1 and c-Jun was detected by using real-time PCR (for SENP1) and Western blot (for c-Jun). SENP1 Is a Stronger Activator of c-Jun than SENP2—Best et al. (32Best J.L. Ganiatsas S. Agarwal S. Changou A. Salomoni P. Shirihai O. Meluh P.B. Pandolfi P.P. Zon L.I. Mol. Cell. 2002; 10: 843-855Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar) reported that SuPr-1, an alternatively spliced form of SENP2, could induce c-Jun-dependent transcription. Because both SENP1 and SENP2 belong to the SUMO-specific protease family with broad substrate specificity (41Yeh E.T. Gong L. Kamitani T. Gene (Amst.). 2000; 248: 1-14Crossref PubMed Scopus (412) Google Scholar), we speculated that SENP1 might also be an activator of c-Jun. To test this hypothesis, we performed a luciferase reporter gene assay by using Gal4 fused to the transactivation domain (1–223) of c-Jun (G4-c-Jun) and the Gal4-luciferase reporter plasmid. When expressed in PC-3 cells, SENP1 markedly induced G4-c-Jun-dependent transcription (Fig. 1A). SENP1 exhibited stronger activation of c-Jun-dependent transcription than SENP2. Titration of SENP1 showed a dose-dependent effect of SENP1 on c-Jun-dependent transcription (Fig. 1B). The effects of SENP1 in different cell lines, such as 293, MCF-7, HeLa, and U-2OS cells, were tested, and cell type specificity was not observed (data not shown). These results suggest that SENP1 can function as a strong activator of c-Jun-dependent transcription. A previous study indicated that desumoylation activity was not required for SuPr-1, a splice variant of SENP2, to induce c-Jun activity (32Best J.L. Ganiatsas S. Agarwal S. Changou A. Salomoni P. Shirihai O. Meluh P.B. Pandolfi P.P. Zon L.I. Mol. Cell. 2002; 10: 843-855Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar). We similarly observed that the catalytic mutant of SENP2 actually induces more c-Jun activity than wild-type SENP2 (Fig. 1A). However, these two proteases SENP1 and SENP2 diverged in their effects on c-Jun-dependent transcription. In contrast to SENP2, the action of SENP1 on c-Jun is dependent on its catalytic activity, as the catalytic inactive mutation markedly reduced the effect of SENP1 on c-Jun-dependent transcription (Fig. 1A). We confirmed this result by increasing the amount of SENP1 mutant transfected, which did not prompt any significant change in c-Jun-dependent transcription (Fig. 1B). Western blot analysis insured that the wild-type and mutant SENP1 were expressed at similar levels and did not alter G4-c-Jun expression (Fig. 1C). Collectively, these data suggest that the action of SENP1 on c-Jun-dependent transcription, unlike that of SENP2, is mediated through a desumoylation mechanism. To determine whether SENP1 could affect transcription of an endogenous promoter, we examined the effect of SENP1 on the c-Jun promoter (–79/+170), which contains AP-1 binding sites in the –72 position (53Han T.H. Lamph W.W. Prywes R. Mol. Cell. Biol. 1992; 12: 4472-4477Crossref PubMed Scopus (90) Google Scholar, 54Angel P. Hattori K. Smeal T. Karin M. Cell. 1988; 55: 875-885Abstract Full Text PDF PubMed Scopus (989) Google Scholar). As shown in Fig. 1D, SENP1 induced c-Jun promoter activity in a dose-dependent manner. The catalytic activity of SENP1 is also required for this effect. We also examined whether the effect of SENP1 on the c-Jun promoter is through the AP-1 binding site. The mutation of the AP-1 binding site markedly abolished the activity of the c-Jun promoter by SENP1 (Fig. 1D). To further confirm the effect of SENP1 on c-Jun-dependent transcription, we used siRNA to silence endogenous SENP1 and then examined whether the expression of endogenous c-Jun, a target dependent on c-Jun transactivation, was affected. The transfection of the SENP1-specific siRNA plasmid into PC-3 cells decreased endogenous SENP1 expression by 53% (real-time PCR analysis, data not shown), whereas expression of SENP1-siRNA reduced endogenous c-Jun expression by 60% (Fig. 1E). Collectively, these data indicate that SENP1 can strongly activate c-Jun-dependent transcription through its desumoylation activity. SENP1 Activation of c-Jun Is Independent of Phosphorylation—c-Jun is a transcription factor involved in the JNK signaling pathway (2Eferl R. Wagner E.F. Nat. Rev. Cancer. 2003; 3: 859-868Crossref PubMed Scopus (1618) Google Scholar, 3Karin M. Liu Z. Zandi E. Curr. Opin. Cell Biol. 1997; 9: 240-246Crossref PubMed Scopus (2289) Google Scholar, 7Dunn C. Wiltshire C. MacLaren A. Gillespie D.A. Cell. Signal. 2002; 14: 585-593Crossref PubMed Scopus (169) Google Scholar, 8Minden A. Lin A. Smeal T. Derijard B. Cobb M. Davis R. Karin M. Mol. Cell. Biol. 1994; 14: 6683-6688Crossref PubMed Scopus (436) Google Scholar, 55Karin M. Philos. Trans. R. Soc. Lond B. Biol. Sci. 1996; 351: 127-134Crossref PubMed Scopus (227) Google Scholar, 56Johnson G.L. Lapadat R. Science. 2002; 298: 1911-1912Crossref PubMed Scopus (3464) Google Scholar, 57Kennedy N.J. Davis R.J. Cell Cycle. 2003; 2: 199-201Crossref PubMed Google Scholar). JNK modulates c-Jun-dependent transcription through phosphorylation of c-Jun at Ser-63 and Ser-73 (8Minden A. Lin A. Smeal T. Derijard B. Cobb M. Davis R. Karin M. Mol. Cell. Biol. 1994; 14: 6683-6688Crossref PubMed Scopus (436) Google Scholar). To investigate the mechanism underlying c-Jun activation by SENP1, we first examined whether SENP1 could indirectly induce phosphorylation of c-Jun. Anti-phosphorylated c-Jun antibody was used to identify G4-c-Jun phosphorylation. As shown in Fig. 2A, phorbol 12-myristate 13-acetate (PMA), a stimulator of the JNK pathway, strongly induced c-Jun phosphorylation; however, co-expression of SENP1 and the SENP1 mutant could not induce the phosphorylation of G4-c-Jun (Fig. 2A). We also used the G4-c-Jun S63A, S73A construct in which Ser-63 and Ser-73 are mutated to Ala to perform the luciferase reporter assay. Mutation of both Ser-63 and Ser-73 to Ala did not affect the ability of SENP1 to induce G4-c-Jun activity (Fig. 2B), whereas PMA induction of c-Jun was abolished by the mutation (Fig. 2C). These results suggest that the action of SENP1 on c-Jun-dependent transcription is not mediated through a phosphorylation mechanism. SENP1-Inducing c-Jun Transcriptional Activity Occurs Independently of c-Jun Desumoylation—c-Jun could be conjugated by SUMO at amino acid 229 (40Muller S. Berger M. Lehembre F. Seeler J.S. Haupt Y. Dejean A. J. Biol. Chem. 2000; 275: 13321-13329Abstract Full Text Full Text PDF PubMed Scopus (350) Google Scholar). Although the G4-c-Jun plasmid used in the above experiments only contained amino acids 1–223 of the c-Jun transactivation domain and thus could not be sumoylated, it is still possible that c-Jun transcriptional activity induced by SENP1 is dependent on its sumoylation status in vivo. To test this possibility, we generated G4-c-Jun full-length and G4-c-Jun full-length sumoylation mutant (K229R) plasmids. The mutant was then compared with the wild-type p" @default.
• W2126459623 created "2016-06-24" @default.
• W2126459623 creator A5029897769 @default.
• W2126459623 creator A5039266781 @default.
• W2126459623 creator A5047453378 @default.
• W2126459623 date "2005-04-01" @default.
• W2126459623 modified "2023-10-09" @default.
• W2126459623 title "Differential Regulation of c-Jun-dependent Transcription by SUMO-specific Proteases" @default.
• W2126459623 cites W1491979926 @default.
• W2126459623 cites W1664472327 @default.
• W2126459623 cites W1666755687 @default.
• W2126459623 cites W1884928119 @default.
• W2126459623 cites W1966063731 @default.
• W2126459623 cites W1974051152 @default.
• W2126459623 cites W1982284863 @default.
• W2126459623 cites W1984405912 @default.
• W2126459623 cites W1987249622 @default.
• W2126459623 cites W1992125440 @default.
• W2126459623 cites W1993785975 @default.
• W2126459623 cites W1994219871 @default.
• W2126459623 cites W1994403682 @default.
• W2126459623 cites W1999687531 @default.
• W2126459623 cites W2000177129 @default.
• W2126459623 cites W2001994128 @default.
• W2126459623 cites W2002630364 @default.
• W2126459623 cites W2006247396 @default.
• W2126459623 cites W2007332095 @default.
• W2126459623 cites W2009856824 @default.
• W2126459623 cites W2011757017 @default.
• W2126459623 cites W2020527627 @default.
• W2126459623 cites W2024973490 @default.
• W2126459623 cites W2027874507 @default.
• W2126459623 cites W2030252781 @default.
• W2126459623 cites W2036224418 @default.
• W2126459623 cites W2037845650 @default.
• W2126459623 cites W2042260090 @default.
• W2126459623 cites W2042389934 @default.
• W2126459623 cites W2042862271 @default.
• W2126459623 cites W2060630008 @default.
• W2126459623 cites W2060817283 @default.
• W2126459623 cites W2067427748 @default.
• W2126459623 cites W2070052000 @default.
• W2126459623 cites W2072319964 @default.
• W2126459623 cites W2073286776 @default.
• W2126459623 cites W2074129822 @default.
• W2126459623 cites W2079508317 @default.
• W2126459623 cites W2080101736 @default.
• W2126459623 cites W2080294916 @default.
• W2126459623 cites W2086008721 @default.
• W2126459623 cites W2086438431 @default.
• W2126459623 cites W2092109378 @default.
• W2126459623 cites W2094872845 @default.
• W2126459623 cites W2097141418 @default.
• W2126459623 cites W2097155763 @default.
• W2126459623 cites W2101619133 @default.
• W2126459623 cites W2107733280 @default.
• W2126459623 cites W2112294647 @default.
• W2126459623 cites W2112468983 @default.
• W2126459623 cites W2114003326 @default.
• W2126459623 cites W2116074861 @default.
• W2126459623 cites W2117909268 @default.
• W2126459623 cites W2123256728 @default.
• W2126459623 cites W2124516418 @default.
• W2126459623 cites W2125069527 @default.
• W2126459623 cites W2129063436 @default.
• W2126459623 cites W2139914947 @default.
• W2126459623 cites W2140513365 @default.
• W2126459623 cites W2148487263 @default.
• W2126459623 cites W2170915150 @default.
• W2126459623 cites W2322523258 @default.
• W2126459623 cites W2333853059 @default.
• W2126459623 cites W2334847151 @default.
• W2126459623 doi "https://doi.org/10.1074/jbc.m412185200" @default.
• W2126459623 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15701643" @default.
• W2126459623 hasPublicationYear "2005" @default.
• W2126459623 type Work @default.
• W2126459623 sameAs 2126459623 @default.
• W2126459623 citedByCount "54" @default.
• W2126459623 countsByYear W21264596232012 @default.
• W2126459623 countsByYear W21264596232013 @default.
• W2126459623 countsByYear W21264596232014 @default.
• W2126459623 countsByYear W21264596232015 @default.
• W2126459623 countsByYear W21264596232019 @default.
• W2126459623 countsByYear W21264596232020 @default.
• W2126459623 countsByYear W21264596232021 @default.
• W2126459623 countsByYear W21264596232022 @default.
• W2126459623 countsByYear W21264596232023 @default.
• W2126459623 crossrefType "journal-article" @default.
• W2126459623 hasAuthorship W2126459623A5029897769 @default.
• W2126459623 hasAuthorship W2126459623A5039266781 @default.
• W2126459623 hasAuthorship W2126459623A5047453378 @default.
• W2126459623 hasBestOaLocation W21264596231 @default.
• W2126459623 hasConcept C104317684 @default.
• W2126459623 hasConcept C121332964 @default.
• W2126459623 hasConcept C138885662 @default.
• W2126459623 hasConcept C179926584 @default.
• W2126459623 hasConcept C181199279 @default.
• W2126459623 hasConcept C182220744 @default.

• next