FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2127114313> ?p ?o ?g. }

• W2127114313 endingPage "2459" @default.
• W2127114313 startingPage "2451" @default.
• W2127114313 abstract "Studies have indicated the role of HSF1 (heat-shock transcription factor 1) in repressing the transcription of some nonheat shock genes. XAF1 (XIAP-associated factor 1) was an inhibitor of apoptosis-interacting protein with the effect of antagonizing the cytoprotective role of XIAP. XAF1 expression was lower in gastrointestinal cancers than in normal tissues with the mechanism unclear. Here we showed that gastrointestinal cancer tissues expressed higher levels of HSF1 than matched normal tissues. The expression of XAF1 and HSF1 was negatively correlated in gastrointestinal cancer cell lines. Stress stimuli, including heat, hypo-osmolarity, and H2O2, significantly suppressed the expression of XAF1, whereas the alteration of HSF1 expression negatively correlated with XAF1 expression. We cloned varying lengths of the 5′-flanking region of the XAF1 gene into luciferase reporter vectors, and we evaluated their promoter activities. A transcription silencer was found between the –592- and –1414-nucleotide region that was rich in nGAAn/nT-TCn elements (where n indicates G, A, T, or C). A high affinity and functional HSF1-binding element within the –862/–821-nucleotide region was determined by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. Inactivation of this “heat-shock element” by either site-directed mutation or an HSF1 inhibitor, pifithrin-α, restored the promoter activity of the silencer structure. Moreover, pretreatment with antioxidants suppressed HSF1 binding activity and increased the transcriptional activity and expression of XAF1. These findings suggested that endogenous stress pressure in cancer cells sustained the high level expression of HSF1 and subsequently suppressed XAF1 expression, implicating the synergized effect of two anti-apoptotic protein families, HSP and inhibitors of apoptosis, in cytoprotection under stress circumstances. Studies have indicated the role of HSF1 (heat-shock transcription factor 1) in repressing the transcription of some nonheat shock genes. XAF1 (XIAP-associated factor 1) was an inhibitor of apoptosis-interacting protein with the effect of antagonizing the cytoprotective role of XIAP. XAF1 expression was lower in gastrointestinal cancers than in normal tissues with the mechanism unclear. Here we showed that gastrointestinal cancer tissues expressed higher levels of HSF1 than matched normal tissues. The expression of XAF1 and HSF1 was negatively correlated in gastrointestinal cancer cell lines. Stress stimuli, including heat, hypo-osmolarity, and H2O2, significantly suppressed the expression of XAF1, whereas the alteration of HSF1 expression negatively correlated with XAF1 expression. We cloned varying lengths of the 5′-flanking region of the XAF1 gene into luciferase reporter vectors, and we evaluated their promoter activities. A transcription silencer was found between the –592- and –1414-nucleotide region that was rich in nGAAn/nT-TCn elements (where n indicates G, A, T, or C). A high affinity and functional HSF1-binding element within the –862/–821-nucleotide region was determined by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. Inactivation of this “heat-shock element” by either site-directed mutation or an HSF1 inhibitor, pifithrin-α, restored the promoter activity of the silencer structure. Moreover, pretreatment with antioxidants suppressed HSF1 binding activity and increased the transcriptional activity and expression of XAF1. These findings suggested that endogenous stress pressure in cancer cells sustained the high level expression of HSF1 and subsequently suppressed XAF1 expression, implicating the synergized effect of two anti-apoptotic protein families, HSP and inhibitors of apoptosis, in cytoprotection under stress circumstances. Heat-shock proteins (HSPs) 2The abbreviations used are: HSP, heat-shock protein; IAP, inhibitor of apoptosis; XIAP, X-linked IAP protein; HSF, heat-shock factor; HSE, heat-shock element; HS, heat shock; HO, hypo-osmosis; NAc, N-acetyl-l-cysteine; PFA, pifithrin-α; RACE, rapid amplification of cDNA ends; EMSA, electrophoretic mobility shift assay, TSS, transcription starting site; GSP, gene specific primer; AP, adapter primer; RLU, relative luciferase unit; ChIP, chromatin immunoprecipitation; GI, gastrointestinal; DTT, dithiothreitol; siRNA, small interfering RNA; ROS, reactive oxygen species; TNF, tumor necrosis factor; nt, nucleotide. 2The abbreviations used are: HSP, heat-shock protein; IAP, inhibitor of apoptosis; XIAP, X-linked IAP protein; HSF, heat-shock factor; HSE, heat-shock element; HS, heat shock; HO, hypo-osmosis; NAc, N-acetyl-l-cysteine; PFA, pifithrin-α; RACE, rapid amplification of cDNA ends; EMSA, electrophoretic mobility shift assay, TSS, transcription starting site; GSP, gene specific primer; AP, adapter primer; RLU, relative luciferase unit; ChIP, chromatin immunoprecipitation; GI, gastrointestinal; DTT, dithiothreitol; siRNA, small interfering RNA; ROS, reactive oxygen species; TNF, tumor necrosis factor; nt, nucleotide. are conserved molecules present in all prokaryotes and eukaryotes (1Feder M.E. Hofmann G.E. Annu. Rev. Physiol. 1999; 61: 243-282Crossref PubMed Scopus (3129) Google Scholar, 2Sarto C. Binz P.A. Mocarelli P. Electrophoresis. 2000; 21: 1218-1226Crossref PubMed Scopus (123) Google Scholar). The expression of these proteins is very low under normal physiological conditions and can be induced by stress factors, including physiological (growth factors, oxidative stress, and hormonal stimulation), environmental (heat shock, heavy metals, and ultraviolet radiation), or pathological stimuli (inflammation and autoimmune reactions and viral, bacteriological, or parasitic infections) (3Carper S.W. Duffy J.J. Gerner E.W. Cancer Res. 1987; 47: 5249-5255PubMed Google Scholar, 4Trautinger F. Kindas-Mugge I. Knobler R.M. Honigsmann H. J. Photochem. Photobiol. B Biol. 1996; 35: 141-148Crossref PubMed Scopus (88) Google Scholar). Some stress factors, such as oxidative stress, have been considered as tumorigenic agents at low concentrations (5Wang D. Kreutzer D.A. Essigmann J.M. Mutat. Res. 1998; 400: 99-115Crossref PubMed Scopus (426) Google Scholar, 6Wei H. Med. Hypotheses. 1992; 39: 267-270Crossref PubMed Scopus (43) Google Scholar). The main function of HSPs is to operate as an intracellular chaperone for aberrantly folded or mutated proteins and to provide cytoprotection against the stress conditions (31Garrido C. Gurbuxani S. Ravagnan L. Kroemer G. Biochem. Biophys. Res. Commun. 2001; 286: 433-442Crossref PubMed Scopus (657) Google Scholar). For this reason, the presence of a cellular stress response in cancer cells reduces their sensitivity to chemical stress caused by insufficient tumor perfusion of chemotherapeutic agents (2Sarto C. Binz P.A. Mocarelli P. Electrophoresis. 2000; 21: 1218-1226Crossref PubMed Scopus (123) Google Scholar).Heat-shock transcription factors (HSFs or HSTFs) were originally characterized as regulators of the expression of the heat-shock protein, through binding to specific sequences (“heat-shock element” (HSE)), typically a pentanucleotide nGAAn structure (where n indicates G, A, T, or C) oriented in inverted dyad repeats (7Kroeger P.E. Morimoto R.I. Mol. Cell. Biol. 1994; 14: 7592-7603Crossref PubMed Google Scholar, 8Wang Y. Morgan W.D. Nucleic Acids Res. 1994; 22: 3113-3118Crossref PubMed Scopus (24) Google Scholar). The HSF family consists of three members in human, namely HSF1, HSF2, and HSF4. HSF1 is specifically responsible for the stress-mediated HSP induction. In unstressed cells, HSF1 is present in the cytoplasm either as a monomer or forming heteromeric complexes. Upon treatment with stress inducers, HSF1 homotrimerizes, translocates to the nucleus, and binds the HSE for its transactivation capacity (9Mivechi N.F. Shi X.Y. Hahn G.M. J. Cell. Biochem. 1995; 59: 266-280Crossref PubMed Scopus (15) Google Scholar, 10Pirkkala L. Nykanen P. Sistonen L. FASEB J. 2001; 15: 1118-1131Crossref PubMed Scopus (811) Google Scholar). Recent studies have shown that HSF1 can also act as a negative regulator of certain nonheat-shock genes, including IL-1β, c-fos, and TNF-α (11Cahill C.M. Waterman W.R. Xie Y. Auron P.E. Calderwood S.K. J. Biol. Chem. 1996; 271: 24874-24879Abstract Full Text Full Text PDF PubMed Google Scholar, 12Xie Y. Zhong R. Chen C. Calderwood S.K. J. Biol. Chem. 2003; 278: 4687-4698Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar, 13Singh I.S. He J.R. Calderwood S. Hasday J.D. J. Biol. Chem. 2002; 277: 4981-4988Abstract Full Text Full Text PDF PubMed Scopus (123) Google Scholar).Inhibitors of apoptosis (IAPs) constitute another family of anti-apoptotic proteins. They were identified in baculoviruses where they function to prevent the death of infected host cells (14Hay B.A. Cell Death Differ. 2000; 7: 1045-1056Crossref PubMed Scopus (115) Google Scholar). XIAP is a potent member of IAPs that is expressed in all adult and fetal tissues with the exception of peripheral blood leukocytes. XIAP binds directly to caspases and functions as a competitive inhibitor of caspase catalytic function (15Arnt C.R. Chiorean M.V. Heldebrant M.P. Gores G.J. Kaufmann S.H. J. Biol. Chem. 2002; 277: 44236-44243Abstract Full Text Full Text PDF PubMed Scopus (257) Google Scholar).Yeast two-hybrid studies identified a XIAP-interacting N-terminal zinc finger protein designated XAF1 (XIAP-associated factor-1) (16Fong W.G. Liston P. Rajcan-Separovic E. St Jean M. Craig C. Korneluk R.G. Genomics. 2000; 70: 113-122Crossref PubMed Scopus (201) Google Scholar). The incubation of recombinant XIAP with caspase-3 in the absence or presence of XAF1 demonstrated that XAF1 blocked the inhibitory activity of XIAP for caspase-3, and co-expression of XAF1 and XIAP inhibited XIAP-dependent caspase-3 suppression (17Liston P. Fong W.G. Kelly N.L. Toji S. Miyazaki T. Conte D. Tamai K. Craig C.G. McBurney M.W. Korneluk R.G. Nat. Cell Biol. 2001; 3: 128-133Crossref PubMed Scopus (389) Google Scholar). XAF1 has been implicated as a tumor suppressor because its expression was lower in tumor cells than in normal tissues, and transient expression of XAF1 sensitized tumor cells to the pro-apoptotic effects of etoposide as well as tumor necrosis factor-related apoptosis-inducing ligand (17Liston P. Fong W.G. Kelly N.L. Toji S. Miyazaki T. Conte D. Tamai K. Craig C.G. McBurney M.W. Korneluk R.G. Nat. Cell Biol. 2001; 3: 128-133Crossref PubMed Scopus (389) Google Scholar, 18Leaman D.W. Chawla-Sarkar M. Vyas K. Reheman M. Tamai K. Toji S. Borden E.C. J. Biol. Chem. 2002; 277: 28504-28511Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar). In gastrointestinal (GI) cancers, Byun et al. (23Byun D.S. Cho K. Ryu B.K. Lee M.G. Kang M.J. Kim H.R. Chi S.G. Cancer Res. 2003; 63: 7068-7075PubMed Google Scholar) reported gastric cancer tissues expressed lower levels of XAF1 than normal tissues. However, few studies have focused on the regulation of XAF1. In this study, we described the presence of a high affinity HSF1-binding sequence within the 5′-flanking region of the XAF1 gene. GI cancer cells expressed high levels of HSF1, which enhanced cell survival under stress stimulation, by negatively regulating XAF1 expression.EXPERIMENTAL PROCEDURESPrimers, Oligonucleotides, and Probes—All oligonucleotides were synthesized by Proligo, Singapore. Table 1 shows the sequences of each oligonucleotide used for reverse transcription-PCR, 5′-rapid amplification of 5′-cDNA ends (5′-RACE), electrophoretic mobility shift assays (EMSA), luciferase construction, site-directed mutagenesis, and chromatin immunoprecipitation (ChIP).TABLE 1List of the oligonucleotide primers for amplification and mutationExperimentNamePosition or orientationSequence (5′-3′)Luciferase constructionReverse-42 to -20CCGCTCGAGTTCGGTTGAGTTTCGTTTCTTGCForward 107-90 to -107GGGGTACCGATCTCCTCCCTCCCTGAAForward 254-235 to -254GGGGTACCCAGCCTCAGGGAGGTAGATGForward 592-592 to -69GGGGTACCAGGGTCTGGAAAAACTCTAAGGACForward 920-920 to -896GGGGTACCATGCTTACATGAGGGATTAAAACGAForward 1414-1414 to 1391GGGGTACCTTTTTAGTAGAGACGGGGTTTCACSite- directed mutagenesisWild type sequenceSenseAACATAGGAACAATGTTGAAACAGTCTTTCATTCTTCCCTMutant 1SenseAACATAGCCCCAATGTTGAAACAGTCTTTCATTCGGGCCTMutant 2SenseCAATGTTCCCACAGTCTGGGATTCTTEMSA-1008/-982SenseATTTTCTCTTTTTTCATTTCATTTTTCTTT-862/-821SenseTGAACATAGGAACAATGTTGAAACAGTCTTTCATTCTTCCCTRACEAdapter 1ForwardCCATCCTAATACGACTCACTATAGGGCAdapter 1ForwardACTCACTATAGGGCTCGAGCGGCXAFGSP1ReverseACACTCCGGACACAGGACCAGGAACXAFGSP2CATGGAGGGTGAAGTTGGCAGAGACTReverse transcription-PCRXAF1ForwardGCTCCACGAGTCCTACTGXAF2ReverseACTCTGAGTCTGGACAACGAPDHForwardGACCACAGTCCATGCCATCACGAPDHReverseGTCCACCACCCTGTTGCTGTAChIP-1021/-779ForwardTCTCTGCCTCCATTTTCTCTTTReverseGAGAAGCAGTGTGTGGTGGT Open table in a new tab Reagents—Catalase, N-acetyl-l-cysteine (NAc), and pifithrin-α (PFA) were purchased from Sigma. Goat anti-human XAF1 (C-16), goat anti-human actin (I-19), normal goat IgG, goat anti-human HSTF-1 (C-19), and horseradish peroxidase-conjugated anti-goat IgG were all purchased from Santa Cruz Biotechnology (Santa Cruz, CA).Tissue Specimens and Human Cell Lines—Three gastric cancer and nine colon cancer specimens and their adjacent normal tissues were obtained from patients by surgical resection in the Nanfang Hospital (Guangzhou, China). All colon tissues were from sporadic colon cancer patients. Tissue specimens were snap-frozen in liquid N2 and stored at –70 °C until used. Tissue slices were subjected to histopathological review, and tumor specimens consisting of at least 80% carcinoma cells were chosen for molecular analysis. Gastric cancer cell lines AGS and Kato-III and colon cancer cell lines SW1116, HT-29, Lovo, and Colo205 were obtained from American Type Culture Collection (ATCC, Manassas, VA). Gastric cancer cell lines MKN45 and BCG823 were maintained by our laboratory and were described in a previous study (21Wong B.C. Jiang X.H. Lin M.C. Tu S.P. Cui J.T. Jiang S.H. Wong W.M. Yuen M.F. Lam S.K. Kung H.F. Gastroenterology. 2004; 126: 136-147Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar). They were all maintained in RPMI1640 (Invitrogen) supplemented with 10% fetal bovine serum, 100 μg/ml streptomycin, and 100 units/ml penicillin in a humidified incubator at 37 °C with an atmosphere of 5% CO2. For stress treatment, the cells were incubated in complete medium at 42 °C (heat stress (HS)) or in hypo-osmotic (HO) medium for 30 min, followed by culture in normal medium at 37 °C for 24 h. The hypoosmotic medium contained 67% complete medium and 33% sterile double distilled water with the osmolarity of about 209 mosm/kg. For oxidative stress, the cells were exposed to 200 μm of H2O2 for various time points.Transient Transfection—For transient transfection, 4 μg of the pcDNA3.1 construct encoding HSF1 (pcDNA3.1/HSF1, kindly provided by Dr. R. E. Kingston) was mixed with 250 μl of serum and antibiotics-free medium containing 10 μl of LipofectAMINE2000 reagent for 20 min at room temperature. The mixtures were overlaid onto monolayers of cells seeded in a 6-well tissue culture plate preincubated under serum-free conditions. After 4 h of incubation at 37 °C, the DNA-liposome complex was replaced with complete medium without antibiotics and cultivated at 37 °C. Whole cell lysates were prepared 48 h later to evaluate the protein expression.Immunoblotting—The whole cell lysates were prepared with lysis buffer (20 mm Tris-HCl, 1 mm EDTA, 1 mm EGTA, 1 mm sodium vanadate, 0.2 mm phenylmethylsulfonyl fluoride, 0.5% Nonidet P-40, 1 μg/ml leupeptin, 1 μg/ml aprotinin, and 1 μg/ml pepstatin A). To prepare protein sample for tissue specimens, homogenization was performed in protein lysis buffer. The protein concentration was determined by the bicinchoninic acid assay (BCA protein assay kit, Pierce) with bovine serum albumin (Sigma) as the standard. Equal aliquots of total cell lysates (30 μg) were solubilized in sample buffer and electrophoresed on denaturing SDS-polyacrylamide gel (5% stacking gel and 12% separating gel). The proteins were then transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA). Nonspecific binding was blocked with 10 mm Tris-HCl buffer saline, pH 7.6, plus 0.05% Tween 20 containing 2% skimmed milk. The blots were probed with primary anti-human XAF1 antibody for 1 h at room temperature followed by the horseradish peroxidase-conjugated anti-goat secondary antibody. Goat anti-human actin antibody (1:1000) was used as an internal control. Antigen-antibody complexes were visualized by the ECL system (Amersham Biosciences).5′-RACE—To extend the cDNA transcript, 5′-extension PCRs were performed by using SMART RACE cDNA amplification kit (Clontech) with Human Colon 5′-STRETCH PLUS cDNA Library (Clontech) as the template, as described previously (19Syagailo Y.V. Okladnova O. Reimer E. Grassle M. Mossner R. Gattenlohner S. Marx A. Meyer J. Lesch K.P. Gene (Amst.). 2002; 294: 259-268Crossref PubMed Scopus (14) Google Scholar). Briefly, the first round of touchdown PCR was performed using HotStart Taq polymerase (Qiagen, Hilden, Germany) with AP1 (adapter primer 1) provided by the kit and the XAF1 GSP1 (gene-specific reverse primer 1). The PCR product was separated in a 1% gel. Because no intensified PCR product was found under UV light, a pair of nested primers was used to re-amplify the PCR product by using AP2 (adapter primer 2) provided by the kit and XAF1 GSP2. Both GSP1 and GSP2 were located at exon 2 of XAF1 gene. The sequences of primers are listed in Table 1. The conditions of touchdown PCR were as follows: 94 °C for 30 min; 5 cycles at 94 °C for 30 s and 72 °C for 4 min; 5 cycles at 94 °C for 30 s and 70 °C for 4 min; and 25 cycles at 94 °C for 30 s and 68 °C for 4 min. The PCR product was separated in a 1% gel. DNA was isolated using a GFX PCR DNA and gel band purification kit (Amersham Biosciences) and cloned into a pGEMT-T cloning vector (Promega, Madison, WI). Plasmid DNAs were purified using a commercial kit (Promega) and sequenced using the ABI PRISM 377 DNA Sequencer (Applied Biosystems), according to the manufacturer's instructions.Generation of XAF1-Promoter Luciferase Constructs—Genomic DNA was isolated from cancer cells by proteinase K digestion and sequential phenol extraction. To locate the regulatory promoter of XAF1, five DNA segments that shared the same proximal site and different distal sites were obtained by PCR amplification. The distal sites were located at –1414, –920, –592, –254, and –107 nt, respectively, and the proximal primers were located at –42 to –20 bp of the XAF1 gene. The upstream nucleotide adjacent to the translation starting ATG codon is defined here as –1 (20den Dunnen J.T. Antonarakis S.E. Hum. Genet. 2001; 109: 121-124Crossref PubMed Scopus (801) Google Scholar). KpnI site was added into the 5′ terminus of all of the forward primers, and the XhoI site was added into the reverse primer. The primers used were listed in the Table 1. Genomic DNA of AGS cell was used as the template for PCR amplification with HotStart Taq polymerase. PCR products were visualized on 1% agarose gels by ethidium bromide staining and were purified using GFX PCR DNA and gel band purification kit (Amersham Biosciences). After digestion of both the pGL3 basic vector (Promega) and the PCR products with KpnI and XhoI, the purified products were inserted in the forward orientation upstream of a luciferase reporter gene of pGL3 basic vector to generate pLuc-1414, pLuc-920, pLuc-592, pLuc-254, and pLuc-107 constructs.XAF1 Promoter-Luciferase Reporter Expression—For luciferase assay, the cells were seeded into 24-well plates to 70–80% confluence and transfected with the various pLuc constructs by Lipofectamine 2000 as described previously (21Wong B.C. Jiang X.H. Lin M.C. Tu S.P. Cui J.T. Jiang S.H. Wong W.M. Yuen M.F. Lam S.K. Kung H.F. Gastroenterology. 2004; 126: 136-147Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar). pRL-CMV (Promega) was used to normalize the reporter gene activity. 0.8 μg of pLuc plasmids and 0.008 μg of pRL-CMV vector were mixed with 50 μl of serum and antibiotics-free medium containing 4 μl of LipofectAMINE2000 reagent for 20 min at room temperature. The mixtures were overlaid onto monolayers of the various cell lines preincubated under serum-free conditions. After 4 h of incubation at 37 °C, the DNA-liposome complex was replaced with complete medium without antibiotics and cultivated for an additional 48 h at 37 °C. Cells were solubilized in 1× passive lysis buffer (Promega), scraped with a rubber policeman, and mixed with 50 μl of luciferase assay reagent (Promega). The firefly and Renilla luciferase activities were measured using the dual-luciferase reporter assay system (Promega) with a model TD-20/20 luminometer (EG & G Berthold, Australia). Firefly luciferase activity value was normalized to Renilla activity value. Promoter activity was presented as the fold of relative luciferase unit (RLU) compared with the basic vector control. RLU indicates values of firefly luciferase unit/values of Renilla luciferase unit.Preparation of Cytoplasmic and Nuclear Extract—After treatment, cells were resuspended in 400 μl of buffer A (containing 10 mm Hepes, pH 7.9, 1.5 mm MgCl2, 10 mm KCl, 0.5 mm DTT, 0.5 mm phenylmethylsulfonyl fluoride, 1 μg/ml leupeptin, 1 μg/ml aprotinin, and 1 μg/ml pepstatin A), lysed with 12.5 μl of 10% Nonidet P-40, and centrifuged at 12,000 × g for 10 min at 4 °C. The supernatant was collected and used as the cytoplasmic extracts. The nuclei pellet was resuspended in 40 μlof buffer B (20 mm Hepes, pH 7.9, containing 1.5 mm MgCl2, 450 mm NaCl, 25% glycerol, 0.2 mm EDTA, 0.5 mm DTT, 0.5 mm phenylmethylsulfonyl fluoride, 1 μg/ml leupeptin, 1 μg/ml aprotinin, 1 μg/ml pepstatin A) and agitated for 60 min at 4 °C, and the nuclear debris was spun down at 20,000 × g for 15 min. The supernatant (nuclear extract) was collected and stored at –80 °C until ready for analysis. Protein concentrations were determined with BCA protein assay kit.EMSA—Double-strand DNA probes were labeled with 5 μCi of [γ-32P]ATP (PerkinElmer Life Sciences) using T4 polynucleotide kinase (Promega). The labeled oligonucleotides were separated from the free [γ-32P]ATP using a column (Bio-Rad) according to the manufacturer's instructions. For EMSA, total reaction mixtures containing 10 mm Tris-HCl, pH 7.5, 1 mm MgCl2, 0.5 mm DTT, 0.5 mm EDTA, 50 mm NaCl, 4% glycerol, and 50 μg of poly(dI-dC)-poly(dI-C)/ml were incubated with 3 μg of nuclear extracts and various unlabeled competing oligonucleotides for 10 min at room temperature, followed by addition of 1 μl ((0.5–2) × 105 cpm) of 32P-end-labeled oligonucleotides. Samples were separated by electrophoresis on 8% nondenaturing polyacrylamide gel, with detection of radioactive bands by autoradiography for 16–24 h at –80 °C.siRNA Transfection—The siRNA duplexes consisted of 21 bp with a 2-base deoxynucleotide overhang (Proligo, Singapore). The sequences of the HSF1 siRNA were as follows (sense strand): siRNA 1, GAUGGCGGCGGCCAUGCUGdTdT. The control siRNA, GL2 (CGUACGCGGAAUACUUCGA), was directed against the luciferase gene. The cells were transfected with siRNA duplexes using Oligofectamine (Invitrogen) according to the manufacturer's instructions.ChIP Assay—The ChIP assays were performed according to the protocol provided by the ChIP assay kit (Upstate Cell Signaling Solutions, Lake Placid, NY). Briefly, cells were treated with 1% formaldehyde to cross-link proteins to DNA. After washing, the cell pellets were resuspended in lysis buffer and sonicated to yield an average DNA size of 500 bp. Sonicated extracts were subsequently clarified by centrifugation and diluted with ChIP dilution buffer. 20 μl of the diluted lysates was left as the input control. Other lysates were pre-cleared with protein A-agarose/salmon sperm DNA and then divided into two fractions and incubated with 5 μg of normal goat IgG or goat anti-human HSTF-1 antibody each. Protein A-agarose/salmon sperm DNA was added to each fraction and rotated at 4 °C. After thoroughly washing, immunoprecipitated products were eluted using elution buffer. The cross-linked DNA-protein complexes were reversed by heating at 65 °C. DNA was purified by phenol/chloroform extraction and ethanol precipitation. Quantitation of the DNA from the XAF1 promoter regions was determined by PCR using gene-specific primers as described in Table 1. Hotstart PCR amplification was performed by using either immunoprecipitated DNA, a control with goat IgG, or chromatin input that had not been immunoprecipitated. To ensure linear amplification of DNA, pilot PCRs were performed initially to determine the optimal PCR conditions. In general, samples were heated at 95 °C for 30 min, followed by 34 cycles of 95 °C for 1 min, 55 °C for 1 min, and 72 °C for 1 min. After cycling, samples were incubated at 72 °C for 7 min to permit completion of primer extension.Site-directed Mutagenesis—The QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) was used to generate constructs with mutation of HSF-binding elements. Briefly, the pLuc-920 construct was PCR-amplified in the elongation process by using Pfu DNA polymerase and primers (Table 1) with the mutation of the predicted HSF1-binding elements. The incorporation of oligonucleotide primers generated a mutated plasmid containing staggered nicks. The product was then treated with DpnI endonuclease, specific for methylated and hemimethylated DNA, and hence the parental DNA template was digested (because DNA originating from Escherichia coli is usually dam methylated). The nicked vector DNA carrying the desired mutations was proliferated in Epicurian coli XL1-Blue supercompetent cells. Plasmid DNA was isolated and sequenced to verify the prospective mutated sequence.Statistical Analysis—Results obtained from triplicate luciferase experiments were expressed as the mean ± S.D. RLU with different treatments were compared using a two-tailed Student's t test and were considered significant if the p value was less than 0.05.RESULTSGastric and Colon Cancer Expressed Higher Levels of HSF1 Than Normal Tissues—We detected HSF1 expression in three gastric cancer (Fig. 1A) and nine colon cancer (Fig. 1B) specimens and matched normal tissues by immunoblotting assay. All of the gastric cancer tissues and 7 of 9 colon cancer tissues expressed higher level of HSF1 than normal tissues. To evaluate the activity of HSF1, double-strand DNA probe consensus to the HSE sequence of human HSP70 promoter (HSE/consensus, Fig. 4B) was labeled with 32P, and EMSA was carried out to detect its binding to the whole cell lysates of tissue specimens. It showed that 5 of 7 cancer tissues (GT1, GT2, CT1, CT2, and CT4) displayed higher binding activity than matched normal tissues (Fig. 1C). Because the HSF1 expression and activity reflected cellular stress status, these results inferred that cancer cells have encountered higher stress pressure than normal cells.FIGURE 4Analysis of 5′-flanking sequence of XAF1 gene. A, consensus sequence of HSE. B, HSE sequence presented in human HSP70 promoter. C, two nGAAn (nTTCn)-rich sequences presented in the 5′-flanking region of the XAF1 gene. The putative HSF1-binding elements are underlined, and the nGAAn (nTTCn) motifs are italicized.View Large Image Figure ViewerDownload Hi-res image Download (PPT)XAF1 Expression Inversely Correlated with HSF1 in GI Cancer Cell Lines—To elucidate the correlation between XAF1 and HSF1 in cancer cells, we first checked their expression in GI cancer cell lines by immunoblotting. As shown in Fig. 2A, negative correlation was found between these two proteins in 6 of 7 cell lines except gastric cancer cell line MKN45. Second, to confirm the down-regulation of XAF1 by HSF1, we next transfected AGS and Lovo cells with pCDNA3.1-HSF1 expressing vector and detected XAF1 expression. We showed that overexpression of HSF1 down-regulated XAF1 expression in both cell lines (Fig. 2B). Third, we suppressed HSF1 expression by RNA interference (Fig. 2C). Consequently, XAF1 expression was up-regulated (Fig. 2C). These findings indicated that the low level expression of XAF1 in cancer cells might be attributed to the high expression of HSF1 and stress pressure.FIGURE 2XAF1 expression inversely correlated with HSF1 in GI cancer cells. A, immunoblotting assay for HSF1 and XAF1 expression in GI cancer cell lines. B, AGS and Lovo cells were transfected with empty vector or pcDNA3.1-HSF1 construct for 48 h. HSF1 and XAF1 expressions were detected by immunoblotting. C, AGS cell was transfected without or with GL2 (control) or HSF1 siRNA for 48 h, and HSF1 and XAF1 expressions were detected by immunoblotting with actin as the internal control. This experiment was repeated twice in both AGS and Lovo cells with identical findings. D, Kato-III cell was treated with 200 μm of H2O2 for 24 h and HS (42 °C) or HO for 30 min followed by culture in standard medium for 24 h. HSF1 and XAF1 expressions were detected by immunoblotting. These figures are representative of two to three independent experiments.View Large Image Figure ViewerDownload Hi-res image Download (PPT)To test the effect of HSF1 activator (stress stimuli) on XAF1 expression, we then treated gastric cancer cell Kato-III, which constitutively express XAF1, with oxidation (200 μm of H2O2), HO (for 30 min), or HS (42 °C for 30 min). We showed that stress stimuli up-regula" @default.
• W2127114313 created "2016-06-24" @default.
• W2127114313 creator A5002034641 @default.
• W2127114313 creator A5002345698 @default.
• W2127114313 creator A5002596295 @default.
• W2127114313 creator A5021384155 @default.
• W2127114313 creator A5030367664 @default.
• W2127114313 creator A5037499657 @default.
• W2127114313 creator A5039054300 @default.
• W2127114313 creator A5040732864 @default.
• W2127114313 creator A5070450933 @default.
• W2127114313 creator A5087213990 @default.
• W2127114313 creator A5087979395 @default.
• W2127114313 creator A5090532858 @default.
• W2127114313 date "2006-02-01" @default.
• W2127114313 modified "2023-10-16" @default.
• W2127114313 title "HSF1 Down-regulates XAF1 through Transcriptional Regulation" @default.
• W2127114313 cites W105302811 @default.
• W2127114313 cites W1527817144 @default.
• W2127114313 cites W1979149072 @default.
• W2127114313 cites W1986088839 @default.
• W2127114313 cites W1988140254 @default.
• W2127114313 cites W1999675038 @default.
• W2127114313 cites W1999965011 @default.
• W2127114313 cites W2005602594 @default.
• W2127114313 cites W2009187135 @default.
• W2127114313 cites W2015640955 @default.
• W2127114313 cites W2020620545 @default.
• W2127114313 cites W2022112761 @default.
• W2127114313 cites W2022818751 @default.
• W2127114313 cites W2023259543 @default.
• W2127114313 cites W2035493275 @default.
• W2127114313 cites W2035780906 @default.
• W2127114313 cites W2053211604 @default.
• W2127114313 cites W2054164997 @default.
• W2127114313 cites W2056455930 @default.
• W2127114313 cites W2062994425 @default.
• W2127114313 cites W2065294001 @default.
• W2127114313 cites W2066620521 @default.
• W2127114313 cites W2069182261 @default.
• W2127114313 cites W2072304361 @default.
• W2127114313 cites W2073710122 @default.
• W2127114313 cites W2083427483 @default.
• W2127114313 cites W2085736139 @default.
• W2127114313 cites W2092985720 @default.
• W2127114313 cites W2093293871 @default.
• W2127114313 cites W2104773672 @default.
• W2127114313 cites W2106966818 @default.
• W2127114313 cites W2141261198 @default.
• W2127114313 cites W2145588122 @default.
• W2127114313 cites W2157595436 @default.
• W2127114313 cites W2160991496 @default.
• W2127114313 cites W2165178917 @default.
• W2127114313 cites W2229869028 @default.
• W2127114313 cites W2292673840 @default.
• W2127114313 cites W2327290508 @default.
• W2127114313 doi "https://doi.org/10.1074/jbc.m505890200" @default.
• W2127114313 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16303760" @default.
• W2127114313 hasPublicationYear "2006" @default.
• W2127114313 type Work @default.
• W2127114313 sameAs 2127114313 @default.
• W2127114313 citedByCount "60" @default.
• W2127114313 countsByYear W21271143132012 @default.
• W2127114313 countsByYear W21271143132013 @default.
• W2127114313 countsByYear W21271143132014 @default.
• W2127114313 countsByYear W21271143132015 @default.
• W2127114313 countsByYear W21271143132016 @default.
• W2127114313 countsByYear W21271143132017 @default.
• W2127114313 countsByYear W21271143132018 @default.
• W2127114313 countsByYear W21271143132019 @default.
• W2127114313 countsByYear W21271143132020 @default.
• W2127114313 countsByYear W21271143132021 @default.
• W2127114313 countsByYear W21271143132022 @default.
• W2127114313 countsByYear W21271143132023 @default.
• W2127114313 crossrefType "journal-article" @default.
• W2127114313 hasAuthorship W2127114313A5002034641 @default.
• W2127114313 hasAuthorship W2127114313A5002345698 @default.
• W2127114313 hasAuthorship W2127114313A5002596295 @default.
• W2127114313 hasAuthorship W2127114313A5021384155 @default.
• W2127114313 hasAuthorship W2127114313A5030367664 @default.
• W2127114313 hasAuthorship W2127114313A5037499657 @default.
• W2127114313 hasAuthorship W2127114313A5039054300 @default.
• W2127114313 hasAuthorship W2127114313A5040732864 @default.
• W2127114313 hasAuthorship W2127114313A5070450933 @default.
• W2127114313 hasAuthorship W2127114313A5087213990 @default.
• W2127114313 hasAuthorship W2127114313A5087979395 @default.
• W2127114313 hasAuthorship W2127114313A5090532858 @default.
• W2127114313 hasConcept C104317684 @default.
• W2127114313 hasConcept C27153228 @default.
• W2127114313 hasConcept C54355233 @default.
• W2127114313 hasConcept C86339819 @default.
• W2127114313 hasConcept C86803240 @default.
• W2127114313 hasConcept C95444343 @default.
• W2127114313 hasConceptScore W2127114313C104317684 @default.
• W2127114313 hasConceptScore W2127114313C27153228 @default.
• W2127114313 hasConceptScore W2127114313C54355233 @default.
• W2127114313 hasConceptScore W2127114313C86339819 @default.
• W2127114313 hasConceptScore W2127114313C86803240 @default.

• next