FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2127893782> ?p ?o ?g. }

• W2127893782 endingPage "11932" @default.
• W2127893782 startingPage "11923" @default.
• W2127893782 abstract "PS-341 (bortezomib) is a potent and reversible proteosome inhibitor that functions to degrade intracellular polyubiquitinated proteins. PS-341 induces apoptosis and has shown broad antitumor activity with selectivity for transformed cells. We studied the effect of PS-341 on lysosomal and mitochondrial permeabilization, including the role of caspase-2 activation in apoptosis induction in the BxPC-3 human pancreatic carcinoma cell line. PS-341 induced a dose-dependent apoptosis in association with reactive oxygen species generation and cleavage of caspase-2 to its 33- and 14-kDa fragments. PS-341 disrupted lysosomes with redistribution of cathepsin B to the cytosol, as shown using fluorescence confocal microscopy, that was blocked by the free radical scavenger tiron but not by a caspase-2 inhibitor (benzyloxycarbonyl (Z)-VDVAD-fluoromethyl ketone (FMK)). PS-341-induced caspase-2 activation was attenuated by a selective pharmacological inhibitor of cathepsin B (R-3032), suggesting that cathepsin B release occurs upstream of caspase-2. PS-341-induced mitochondrial depolarization was attenuated by Z-VDVAD-FMK, tiron, and an inhibitor of the mitochondrial permeability transition pore (bongkrekic acid). Regulation of mitochondrial permeability by caspase-2 was confirmed using caspase-2 small interfering RNA. PS-341-induced cytochrome c release and phosphatidylserine externalization were attenuated by Z-VDVAD-FMK and partially by R-3032. PS-341 activated the BH3-only proteins Bik and Bim and down-regulated Bcl-2 and Bcl-xL mRNA and protein expression. Taken together, PS-341 induces lysosomal cathepsin B redistribution upstream of caspase-2. Caspase-2 activation regulates PS-341-induced mitochondrial depolarization and apoptosis, suggesting that caspase-2 can serve as a link between lysosomal and mitochondrial permeabilization. PS-341 (bortezomib) is a potent and reversible proteosome inhibitor that functions to degrade intracellular polyubiquitinated proteins. PS-341 induces apoptosis and has shown broad antitumor activity with selectivity for transformed cells. We studied the effect of PS-341 on lysosomal and mitochondrial permeabilization, including the role of caspase-2 activation in apoptosis induction in the BxPC-3 human pancreatic carcinoma cell line. PS-341 induced a dose-dependent apoptosis in association with reactive oxygen species generation and cleavage of caspase-2 to its 33- and 14-kDa fragments. PS-341 disrupted lysosomes with redistribution of cathepsin B to the cytosol, as shown using fluorescence confocal microscopy, that was blocked by the free radical scavenger tiron but not by a caspase-2 inhibitor (benzyloxycarbonyl (Z)-VDVAD-fluoromethyl ketone (FMK)). PS-341-induced caspase-2 activation was attenuated by a selective pharmacological inhibitor of cathepsin B (R-3032), suggesting that cathepsin B release occurs upstream of caspase-2. PS-341-induced mitochondrial depolarization was attenuated by Z-VDVAD-FMK, tiron, and an inhibitor of the mitochondrial permeability transition pore (bongkrekic acid). Regulation of mitochondrial permeability by caspase-2 was confirmed using caspase-2 small interfering RNA. PS-341-induced cytochrome c release and phosphatidylserine externalization were attenuated by Z-VDVAD-FMK and partially by R-3032. PS-341 activated the BH3-only proteins Bik and Bim and down-regulated Bcl-2 and Bcl-xL mRNA and protein expression. Taken together, PS-341 induces lysosomal cathepsin B redistribution upstream of caspase-2. Caspase-2 activation regulates PS-341-induced mitochondrial depolarization and apoptosis, suggesting that caspase-2 can serve as a link between lysosomal and mitochondrial permeabilization. Adenocarcinoma of the pancreas is the fifth most incident cancer in the United States (1Jemal A. Tiwari R.C. Murray T. Ghafoor A. Samuels A. Ward E. Feuer E.J. Thun M.J. Society A.C. CA-Cancer J. Clin. 2004; 54: 8-29Crossref PubMed Scopus (3914) Google Scholar), and fewer than 5% of affected patients survive 5 years after diagnosis. Pancreatic cancers are among the most intrinsically resistant tumors to chemotherapeutic drugs and irradiation. A novel agent targeting the proteosome has recently been developed and shown to display broad antitumor activity (2Adams J. Palombella V.J. Sausville E.A. Johnson J. Destree A. Lazarus D.D. Maas J. Pien C.S. Prakash S. Elliott P.J. Cancer Res. 1999; 59: 2615-2622PubMed Google Scholar) and to overcome resistance to chemotherapy (3Mitsiades N. Mitsiades C.S. Richardson P.G. Poulaki V. Tai Y.T. Chauhan D. Fanourakis G. Gu X. Bailey C. Joseph M. Libermann T.A. Schlossman R. Munshi N.C. Hideshima T. Anderson K.C. Blood. 2003; 101: 2377-2380Crossref PubMed Scopus (636) Google Scholar). Based upon highly favorable results in patients with refractory or relapsed multiple myeloma (4Richardson P.G. Barlogie B. Berenson J. Singhal S. Jagannath S. Irwin D. Rajkumar S.V. Srkalovic G. Alsina M. Alexanian R. Siegel D. Orlowski R.Z. Kuter D. Limentani S.A. Lee S. Hideshima T. Esseltine D.L. Kauffman M. Adams J. Schenkein D.P. Anderson K.C. N. Engl. J. Med. 2003; 348: 2609-2617Crossref PubMed Scopus (2435) Google Scholar), PS-341 (bortezomib or Velcade®) was approved by the United States Food and Drug Administration for this indication, and this drug is currently undergoing evaluation in several other cancers. PS-341, a dipeptidyl boronic acid, is a highly selective and reversible inhibitor of the 26 S proteosome, which is a multicatalytic enzyme that degrades damaged or misfolded/unfolded cellular proteins targeted by ubiquitin conjugation (5Voorhees P.M. Dees E.C. O'Neil B. Orlowski R.Z. Clin. Cancer Res. 2003; 9: 6316-6325PubMed Google Scholar). The proteosome contributes to cellular homeostasis by directly or indirectly regulating intracellular protein levels, including those regulating cell cycle progression, apoptosis, and transcription factor activation (5Voorhees P.M. Dees E.C. O'Neil B. Orlowski R.Z. Clin. Cancer Res. 2003; 9: 6316-6325PubMed Google Scholar, 6Mitsiades N. Mitsiades C.S. Poulaki V. Chauhan D. Fanourakis G. Gu X. Bailey C. Joseph M. Libermann T.A. Treon S.P. Richardson P.G. Hideshima T. Anderson K.C. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 14374-14379Crossref PubMed Scopus (683) Google Scholar). PS-341 has shown activity against several malignant cell types with selectivity for transformed cells compared with normal cells (5Voorhees P.M. Dees E.C. O'Neil B. Orlowski R.Z. Clin. Cancer Res. 2003; 9: 6316-6325PubMed Google Scholar). PS-341 has been shown to promote apoptosis by diverse mechanisms, including the membrane death receptor pathway, as evidenced by the ability of PS-341 to act cooperatively with tumor necrosis factor-related apoptosis-inducing ligand (e.g. TRAIL) to induce apoptosis (7Johnson T.R. Stone K. Nikrad M. Yeh T. Zong W.X. Thompson C.B. Nesterov A. Kraft A.S. Oncogene. 2003; 22: 4953-4963Crossref PubMed Scopus (171) Google Scholar). PS-341 can also stabilize proapoptotic Bax by inhibiting its degradation (8Li B. Dou Q.P. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 3850-3855Crossref PubMed Scopus (413) Google Scholar) and engage the mitochondrial apoptotic pathway (9Ling Y.H. Liebes L. Zou Y. Perez-Soler R. J. Biol. Chem. 2003; 278: 33714-33723Abstract Full Text Full Text PDF PubMed Scopus (409) Google Scholar). These findings suggest that PS-341-induced apoptosis may, in part, be regulated by the Bcl-2 family (6Mitsiades N. Mitsiades C.S. Poulaki V. Chauhan D. Fanourakis G. Gu X. Bailey C. Joseph M. Libermann T.A. Treon S.P. Richardson P.G. Hideshima T. Anderson K.C. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 14374-14379Crossref PubMed Scopus (683) Google Scholar, 8Li B. Dou Q.P. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 3850-3855Crossref PubMed Scopus (413) Google Scholar). The Bcl-2 family includes the BH3-only proteins, so-called because they contain a BH3 protein interaction domain (e.g. Bid, Bik, and Bim) and serve as triggers for the apoptotic signal, whereas Bax and Bak act downstream to regulate apoptosis purportedly through permeabilization of mitochondria (10Letai A. Bassik M.C. Walensky L.D. Sorcinelli M.D. Weiler S. Korsmeyer S.J. Cancer Cell. 2002; 2: 183-192Abstract Full Text Full Text PDF PubMed Scopus (1371) Google Scholar). Furthermore, PS-341 can stabilize IκB, thereby decreasing the antiapoptotic effects of nuclear factor κB (11Hideshima T. Richardson P. Chauhan D. Palombella V.J. Elliott P.J. Adams J. Anderson K.C. Cancer Res. 2001; 61: 3071-3076PubMed Google Scholar). The membrane death receptor and mitochondrial apoptotic pathways are dependent upon activation of a caspase cascade. Recent data suggest that a caspase-independent mechanism involving lysosomes may function in the initiation of cell death (12Foghsgaard L. Wissing D. Mauch D. Lademann U. Bastholm L. Boes M. Elling F. Leist M. Jaattela M. J. Cell Biol. 2001; 153: 999-1010Crossref PubMed Scopus (565) Google Scholar). Lysosomes release a family of proteases known as cathepsins that translocate to the cytosol in response to signals including oxidative stress, increased sphingosine levels, and Fas and tumor necrosis factor-α ligation (13Guicciardi M.E. Leist M. Gores G.J. Oncogene. 2004; 23: 2881-2890Crossref PubMed Scopus (623) Google Scholar). Of the 11 known cathepsins in mammalian lysosomes, cathepsin B and D are the most prominent and stable at physiological pH, and cathepsin B is ubiquitously expressed (13Guicciardi M.E. Leist M. Gores G.J. Oncogene. 2004; 23: 2881-2890Crossref PubMed Scopus (623) Google Scholar). In hepatocytes treated with tumor necrosis factor-R1, lysosomal permeabilization with release of cathepsin B into the cytosol has been associated with mitochondrial dysfunction and caspase-dependent cell death (14Werneburg N.W. Guicciardi M.E. Bronk S.F. Gores G.J. Am. J. Physiol. 2002; 283: G947-G956Crossref PubMed Scopus (168) Google Scholar). The ability of cathepsin B to induce cell death was shown in a cell-free system whereby cathepsin B produced chromatin condensation and apoptotic morphology (15Vancompernolle K. Van Herreweghe F. Pynaert G. Van de Craen M. De Vos K. Totty N. Sterling A. Fiers W. Vandenabeele P. Grooten J. FEBS Lett. 1998; 438: 150-158Crossref PubMed Scopus (285) Google Scholar). Although cathepsin B has been shown to play a role in apoptosis in vitro and in vivo (14Werneburg N.W. Guicciardi M.E. Bronk S.F. Gores G.J. Am. J. Physiol. 2002; 283: G947-G956Crossref PubMed Scopus (168) Google Scholar, 16Guicciardi M.E. Miyoshi H. Bronk S.F. Gores G.J. Am. J. Pathol. 2001; 159: 2045-2054Abstract Full Text Full Text PDF PubMed Scopus (183) Google Scholar), cellular mechanisms responsible for ligand- or drug-induced lysosomal permeabilization are poorly understood. Whereas evidence supports participation of the mitochondria in transmitting a death signal initiated at the lysosomes (17Paquet C. Sane A.T. Beauchemin M. Bertrand R. Leukemia. 2005; 19: 784-791Crossref PubMed Scopus (67) Google Scholar), the mechanism by which lysosomal disruption leads to mitochondrial permeabilization remains unknown. In this regard, in vitro cleavage experiments have shown that the major human caspases are poor substrates for lysosomal extracts or cathepsins (18Stoka V. Turk B. Schendel S.L. Kim T.H. Cirman T. Snipas S.J. Ellerby L.M. Bredesen D. Freeze H. Abrahamson M. Bromme D. Krajewski S. Reed J.C. Yin X.M. Turk V. Salvesen G.S. J. Biol. Chem. 2001; 276: 3149-3157Abstract Full Text Full Text PDF PubMed Scopus (596) Google Scholar). The placement of caspase-2 within the known apoptotic signaling pathways remains incompletely understood. Recent evidence suggests that caspase-2 can serve as a proximal caspase that can be activated by cytotoxic stress and may be involved in the mitochondria-mediated apoptosis (19Lassus P. Opitz-Araya X. Lazebnik Y. Science. 2002; 297: 1352-1354Crossref PubMed Scopus (660) Google Scholar, 20Lin C.F. Chen C.L. Chang W.T. Jan M.S. Hsu L.J. Wu R.H. Tang M.J. Chang W.C. Lin Y.S. J. Biol. Chem. 2004; 279: 40755-40761Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar). In this regard, sequential caspase-2 and caspase-8 activation were shown to occur upstream of mitochondria during ceramide- and etoposide-induced apoptosis (20Lin C.F. Chen C.L. Chang W.T. Jan M.S. Hsu L.J. Wu R.H. Tang M.J. Chang W.C. Lin Y.S. J. Biol. Chem. 2004; 279: 40755-40761Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar). Chemotherapy-induced apoptosis has been shown to involve oxidative stress (21Simon H.U. Haj-Yehia A. Levi-Schaffer F. Apoptosis. 2000; 5: 415-418Crossref PubMed Scopus (2313) Google Scholar, 22Davis Jr., W. Ronai Z. Tew K.D. J. Pharmacol. Exp. Ther. 2001; 296: 1-6PubMed Google Scholar). Caspase-2 has also been reported to be cleaved by effector caspase-3, indicating that it can function downstream of mitochondria during apoptotic signaling (23O'Reilly L.A. Ekert P. Harvey N. Marsden V. Cullen L. Vaux D.L. Hacker G. Magnusson C. Pakusch M. Cecconi F. Kuida K. Strasser A. Huang D.C. Kumar S. Cell Death Differ. 2002; 9: 832-841Crossref PubMed Scopus (160) Google Scholar). Caspase-2 is recruited to a large protein complex whose formation occurs independently of an Apaf1/apoptosome pathway and is sufficient to mediate its activation (24Read S.H. Baliga B.C. Ekert P.G. Vaux D.L. Kumar S. J. Cell Biol. 2002; 159: 739-745Crossref PubMed Scopus (146) Google Scholar). However, the mechanisms of caspase-2 activation remain unclear. After an apoptotic stimulus, caspase-2 processing occurs by two proteolytic steps. A first cleavage at aspartic acid 316 generates two fragments: one of 32-33 kDa, the large subunit, and a second fragment of 14 kDa, the small subunit. The appearance of the 32-33-kDa fragment has been generally used as marker of caspase-2 activation (25Li H. Bergeron L. Cryns V. Pasternack M.S. Zhu H. Sh I.L. Greenberg A. Yuan J. J. Biol. Chem. 1997; 272: 21010-21017Abstract Full Text Full Text PDF PubMed Scopus (168) Google Scholar, 26Colussi P.A. Harvey N.L. Kumar S. J. Biol. Chem. 1998; 273: 24535-24542Abstract Full Text Full Text PDF PubMed Scopus (138) Google Scholar). Of note, oocytes from caspase-2-deficient mice display resistance to chemotherapy-induced apoptosis (27Bergeron L. Perez G. Macdonald G. Shi L. Sun Y. Jurisicova A. Varmuza S. Latham K.E. Flaws J.A. Salter J.C. Hara H. Moskowitz M.A. Li E. Greenberg A. Tilly J.L. Yuan J. Genes Dev. 1998; 12: 1304-1314Crossref PubMed Scopus (605) Google Scholar). Whereas data suggest that caspase-2 regulates apoptosis, an siRNA 2The abbreviations and trivial name used are: siRNA, small interfering RNA; ROS, reactive oxygen species; PBS, phosphate-buffered saline; HE, dihydroethidium; JC-1, 5,5′,6,6-tetrachloro-1,1′,3,3′-tetraethyl-benzimidazolylcarbocyanine; Z, benzyloxycarbonyl; FMK, fluoromethyl ketone; GFP, green fluorescent protein; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PI, propidium iodide. was shown to inhibit caspase-2 expression but not to suppress apoptosis in transformed cells (19Lassus P. Opitz-Araya X. Lazebnik Y. Science. 2002; 297: 1352-1354Crossref PubMed Scopus (660) Google Scholar, 28Lassus P. Opitz-Araya X. Lazebnik Y. Science. 2004; 306: 1863Google Scholar). Additionally, the absence of severe phenotypic abnormalities in caspase-2-deficient mice has cast doubt as to the importance of this caspase in apoptosis (27Bergeron L. Perez G. Macdonald G. Shi L. Sun Y. Jurisicova A. Varmuza S. Latham K.E. Flaws J.A. Salter J.C. Hara H. Moskowitz M.A. Li E. Greenberg A. Tilly J.L. Yuan J. Genes Dev. 1998; 12: 1304-1314Crossref PubMed Scopus (605) Google Scholar). In this study, we determined the relationship of lysosomal disruption and caspase-2 activation to mitochondrial apoptotic signaling induced by PS-341 in BxPC-3 human pancreatic cancer cells. Our results indicate that PS-341 triggers reactive oxygen species (ROS) generation and lysosomal permeabilization with cathepsin B redistribution to the cytosol. Oxidative stress and cathepsin B activate caspase-2, which is required for mitochondrial permeabilization and apoptosis, suggesting that caspase-2 can serve as a link between the lysosomes and the mitochondria. PS-341 also down-regulates antiapoptotic Bcl-2 family members and activates proapototic BH-3-only proteins. Cell Culture and Reagents—BxPC-3 and CFPAC-1 human pancreatic carcinoma cell lines were obtained from the American Type Culture Collection (Manassas, VA). BxPC-3 cells were grown in RPMI 1640 supplemented with 10% fetal bovine serum, 2 mm glutamine, 1 mm sodium pyruvate, and 10 mm HEPES. CFPAC-1 cells were grown in Iscove's Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, 4 mm glutamine, and for both cell lines, 100 units/ml penicillin and 100 μg/ml streptomycin in an atmosphere of 95% air and 5% CO2 at 37 °C. PS-341 was generously provided by Millennium Pharmaceuticals Inc. (Cambridge, MA). The superoxide scavenger tiron (Sigma) was utilized as outlined below. Caspase-2, Caspase-8, and Cathepsin B Inhibitor—An irreversible caspase-2 inhibitor I, Z-VDVAD-FMK, was purchased from Calbiochem. A cell-permeable and irreversible caspase-8 inhibitor, Z-IETD-FMK, was obtained (R&D Systems Inc., Minneapolis, MN). A selective, reversible cathepsin B inhibitor, R-3032, was obtained from Celera Genomics (South San Francisco, CA) (29Canbay A. Guicciardi M.E. Higuchi H. Feldstein A. Bronk S.F. Rydzewski R. Taniai M. Gores G.J. J. Clin. Invest. 2003; 112: 152-159Crossref PubMed Scopus (184) Google Scholar). The R-3032 dose was based on pharmacokinetic data demonstrating a half-life of 4.2 h and preliminary data demonstrating that extracellular concentrations of 10 μm were required to maximally inhibit tumor necrosis factor-α/actinomycin D-mediated apoptosis in cultured murine hepatocytes (29Canbay A. Guicciardi M.E. Higuchi H. Feldstein A. Bronk S.F. Rydzewski R. Taniai M. Gores G.J. J. Clin. Invest. 2003; 112: 152-159Crossref PubMed Scopus (184) Google Scholar). The KI for cathepsin B is 0.02 μm, and the drug does not inhibit caspases. Antibodies—For Western blotting, membranes were probed with primary antibodies, including rabbit polyclonal antibodies against caspase-9 (Cell Signaling Technology, Beverly, MA) and caspase-3 (BD Biosciences). Murine monoclonal antibodies were obtained against caspase-2 (clone G310-1248), caspase-8, cytochrome c (all from BD Biosciences), Bcl-2 (Ab-3; Calbiochem), and Smac/DIABLO (clone 78-1-118; Upstate Biotechnology, Inc., Charlottesville, VA). Monoclonal antibodies against Bax, Bcl-xL, and β actin were purchased from Sigma. A goat polyclonal anti-BID antibody was obtained from R&D Systems. A goat NBK/Bik antibody and a rabbit-caspase-2L (C-20) antibody were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). A rabbit anti-Bim/BOD antibody was obtained from Stressgen Bioreagents (Victoria, Canada). A goat anti-mouse IgG AP and goat anti-rabbit IgG AP-conjugated antibodies were obtained from Sigma. Annexin V Assay—Cells were seeded at a density of 4 × 105 cells/well in a 6-well plate, grown overnight, and then treated with PS-341. For experiments employing inhibitors, cells were preincubated with 5 mm tiron or 50 μm Z-VDVAD-FMK, both for 3 h, or 20 μm R-3032 for 24 h followed by PS-341 treatment. After treatments, adherent and floating cells were collected by trypsinization and centrifuged at 1300 rpm for 5 min. Cell pellets were resuspended and incubated in complete medium for 10 min. After centrifugation, cell pellets were washed with PBS twice and resuspended in 500 μl of 1× annexin binding buffer (BD Biosciences) with 5 μl of annexin V-fluorescein isothiocyanate (BD Biosciences) and 0.5 μl of propidium iodide (Sigma). The percentage of cells with annexin V+/propidium iodide (PI)- was measured using fluorescence-activated cell sorting. Western Blotting—Cells were seeded at a density of 2 × 106 cells/plate overnight. At the indicated time periods (see figure legends), cells were harvested by RIPA B lysis buffer (20 mm sodium phosphate (pH 7.4), 150 mm NaCl, 1% Triton X-100, 5 mm EDTA, 5 mm phenylmethylsulfonyl fluoride, 10 μg/ml aprotinin, 10 μg/ml leupeptin, and 250 μg/ml sodium vanadate) on ice for 15 min. Total cellular proteins were collected and centrifuged at 10,000 × g for 15 min at 4 °C to remove cellular debris, and the supernatant was collected. Protein concentration was measured by the DC protein assay kit (Bio-Rad). Total cell lysates (50 μg) were subjected to 10% SDS-PAGE, and following electrophoresis, proteins were electroblotted onto Immobilon-P Transfer Membrane (Millipore, Bedford, MA). After blocking nonspecific binding sites with I-Block (Tropix, Foster City, CA) at room temperature for 1 h, membranes were incubated with the primary antibodies overnight at 4 °C. After washes in PBST (PBS with 0.1% Tween 20), membranes were incubated with the corresponding alkaline phosphatase-conjugated secondary antibodies for 1 h at room temperature. Signal was detected by chemiluminescence using CDP-Star reagent (PerkinElmer Life Sciences). Subcellular Fractionation—Cells (2.0 × 106) were preincubated with 5 mm tiron for 3 h, followed by PS-341 treatment. After drug exposure, cells were collected in 1× PBS and lysed in a permeabilization buffer (210 mmol/liter d-mannitol, 70 mmol/liter sucrose, 10 mmol/liter HEPES, 5 mmol/liter sodium succinate, 200 μmol/liter EGTA, 0.15% bovine serum albumin, and 80 μg/ml digitonin) on ice, as described previously (30Leist M. Volbracht C. Fava E. Nicotera P. Mol. Pharmacol. 1998; 54: 789-801Crossref PubMed Scopus (129) Google Scholar). The lysate was centrifuged at 13,000 × g, and the supernatant (i.e. cytosolic enriched fraction) was collected. Protein from the subcellular fractionation was quantified, separated on SDS-PAGE, and immunoblotted. Detection of ROS Generation—Dihydroethidium (HE) (Molecular Probes, Inc., Eugene, OR) was utilized to measure ROS generation in BxPC-3 cells. Cells (2.0 × 106) were preincubated with 5 mm tiron or 50 μm Z-VDVAD-FMK for 3 h or with 20 μm R-3032 for 24 h, followed by PS-341 treatment. After drug exposure, cells were collected by trypsinization and incubated in complete medium for 10 min. Then cells were incubated in 2 μm of HE (excitation wavelength 488 nm; emission 605 nm) at 37 °C for 15 min and washed with PBS. Finally, cells were resuspended in 400 μl of PBS and then subjected to fluorescence-activated cell sorting analysis. Analysis of Mitochondrial Depolarization—5,5′,6,6-Tetrachloro-1,1′,3,3′-tetraethyl-benzimidazolylcarbocyanine (JC-1) (Sigma) was employed to measure mitochondrial depolarization in BxPC-3 cells. Cells (2.0 × 106) were preincubated with 5 mm tiron, 50 μm Z-VDVAD-FMK, or 50 μm bongkrekic acid (Calbiochem), an inhibitor of the mitochondrial permeability transition pore, for 3 h, followed by the addition of PS-341. After incubation for the designated time, cells were collected by trypsinization and incubated in complete medium for 10 min. Then cells were incubated in 5 μg/ml JC-1 at 37 °C for 15 min and washed with PBS. Both red (λem, 590 nm for FL2-H) and green (λem, 527 nm for FL1-H) fluorescence emissions were analyzed by fluorescence-activated cell sorting at an excitation wavelength of 488 nm. RNA Interference—BxPC-3 cells (1.7 × 106 cells/plate) were mock-transfected or transfected with 10 nm siCONTROL® nontargeting siRNA duplex or transfected with human caspase-2-specific siRNA duplex (Dharmacon, Lafayette, CO) using siLectFect™, according to the manufacturer's instructions (Bio-Rad). Twenty-four hours after cells were transfected, media were replaced with fresh media with or without 100 nm PS-341 and incubated for 24 h. The cells were then analyzed for mitochondrial depolarization using JC-1 staining as described above. Transfection of Cathepsin B-Green Fluorescent Protein—The rat cathepsin B-green fluorescent protein (GFP) expression plasmid was a generous gift of Dr. Gregory Gores (Mayo Clinic). Cells (0.4 × 106) were seeded overnight before transfection. Transfection was performed with 1 ml of Opti-MEM I containing 6 μl of Plus reagent, 1 μg of plasmid, and 4 μl of Lipofectamine reagent (Invitrogen). After a 24-h transfection, cells were preincubated with 5 mm tiron or 50 μm Z-VDVAD-FMK for 3 h with 20 μm R-3032 for 24 h, followed by PS-341 treatment for 24 h. Confocal microscopy was performed with an inverted Zeiss laser-scanning confocal microscope (Zeiss LSM S10) using excitation of 488 nm and emission of 507 nm. Measurement of Caspase-2 Activity—ICH-1/caspase-2 protease activity was measured in cell lysates obtained from cultured cells with colorimetric substrates (Chemicon, Temecula, CA). Cells (1.0 × 106) were preincubated with 20 or 50 μm R-3032 for 24 h, followed by PS-341 treatment. After drug exposure, cells were collected by trypsinization. 2-5 × 106 cells were pelleted, and lysed in 50 μl of lysis buffer on ice for 10 min. The cytosolic extract was obtained by centrifugation at 10,000 × g for 1 min, and protein concentration was assayed. Protease activity was measured by adding 50 μl of cytosolic extract (200 μg), 50 μl of 2× reaction buffer, and 200 μm VDVAD-p-nitroanilide substrate and then incubated at 37 °C for 1 h. The colorimetric signal was detected using a VERSAmax Tunable Microplate Reader (Molecular Devices, Inc., Sunnyvale, CA) at wavelength of 405 nm. -Fold increase in caspase-2 activity was then determined relative to untreated control. Reverse Transcription-PCR—Cells were seeded at a density of 4 × 105 cells/well of a 6-well plate overnight. After drug treatments, cells were harvested and dissolved in 1 ml of TRIZOL reagent (Invitrogen). Total RNA was extracted according to the manufacturer's instruction. The RNA A260/A280 ratios were between 1.6 and 1.8. cDNA was made from 1 μg of total RNA with the iScript cDNA Synthesis Kit (Bio-Rad) according to the manufacturer's instructions. mRNA expression level was detected by real time PCR using the iQ SYBR Green Supermix (Bio-Rad). Gene expression level was quantified using the threshold PCR cycle number (Ct) method. In brief, the relative expression level of the target gene compared with that of the housekeeping gene, GAPDH, was calculated as 2-ΔCt, where ΔCt = Cttarget gene - CtGAPDH. The ratio of relative expression of the target gene to that of untreated cells was then calculated as 2-DΔCt, where ΔCt = ΔCttreated - ΔCtuntreated (31Livak K.J. Schmittgen T.D. Methods. 2001; 25: 402-408Crossref PubMed Scopus (127155) Google Scholar). The primers were as follows: sequence of GAPDH (GAGTCAACGGATTTGGTCGT (forward) and TTGATTTTGGAGGGATCTCG (reverse)), Bcl-2 (GGATGCCTTTGTGGAACTGT (forward) and AGCCTGCAGCTTTGTTTCAT (reverse)), and Bcl-xL (GGAGCTGGTGGTTGACTTTC (forward) and CTCCGATTCAGTCCCTTCTG (reverse)). The PCR was run for 35 cycles with a 58 °C annealing cycle (30 s), a 72 °C extension cycle (30 s), and a 95 °C denaturing cycle (50 s) plus final incubation at 72 °C for 10 min. Statistical Analysis—All experiments, except immunoblots, were performed in triplicate, and the results were expressed as the mean ± S.D. values. Statistical significance was determined utilizing the Student's t test or a one-way analysis of variance. Statistical significance was defined as p value of <0.05. PS-341 Induces Cytotoxic Stress and Activates Caspase-2-mediated Apoptosis—Induction of oxidative stress by cytotoxic drugs has been shown to directly engage the mitochondrial apoptotic pathway (22Davis Jr., W. Ronai Z. Tew K.D. J. Pharmacol. Exp. Ther. 2001; 296: 1-6PubMed Google Scholar). We determined the potential for PS-341 to generate ROS in BxPC-3 cells. Cells were incubated in dihydroethidium (HE), and the fluorescence signal was detected by flow cytometry. PS-341 treatment produced a 5-6-fold increase in ROS generation relative to control that was significantly attenuated by preincubation of cells with the superoxide scavenger, tiron (Fig. 1A). Induction of oxidative stress by PS-341 was confirmed by measuring γ-glutamylcysteine synthase mRNA levels. γ-Glutamylcysteine synthase catalyzes the rate-limiting step in the de novo biosynthesis of GSH, an abundant physiological antioxidant (32Tatebe S. Unate H. Sinicrope F.A. Sakatani T. Sugamura K. Makino M. Ito H. Savaraj N. Kaibara N. Kuo M.T. Int. J. Cancer. 2002; 97: 21-27Crossref PubMed Scopus (24) Google Scholar). PS-341 (50 and 100 nm doses at 24 h) produced a 1.8-fold induction in γ-glutamylcysteine synthase mRNA expression compared with control (data not shown). PS-341 treatment of BxPC-3 cells produced a dose-dependent induction of apoptosis, as detected by phosphatidylserine externalization using an annexin V binding assay (Fig. 1B). PS-341 treatment cleaved caspase-8 to its active 43- and 18-kDa fragments and reduced the level of full-length Bid (Fig. 1C). To confirm that PS-341 can activate caspase-8 and engage the extrinsic apoptotic pathway, we utilized a specific inhibitor of caspase-8 (Z-IEHD-FMK). Z-IETD-FMK was found to block PS-341-induced cleavage of caspase-8 and to attenuate PS-341-induced apoptosis (Fig. 1D). After Bid cleavage, its truncated form is translocated to the mitochondria, where it mediates cross-talk with the mitochondrial pathway (33Gross A. Yin X.M. Wang K. Wei M.C. Jockel J. Milliman C. Erdjument-Bromage H. Tempst P. Korsmeyer S.J. J. Biol. Chem. 1999; 274: 1156-1163Abstract Full Text Full Text PDF PubMed Scopus (932) Google Scholar). PS-341 cleaved downstream effector caspase-9 and caspase-3 and triggered the release of mitochondrial cytochrome c and Smac (second mitochondria-derived caspase activator) proteins (Fig. 1C). Smac has been shown to promote caspase-9 activation via Apaf-1 and to antagonize the inhibitory effect of XIAP on caspase-9 (34Chauhan D. Hideshima T. Rosen S. Reed J.C. Kharbanda S. Anderson K.C. J. Biol. Chem. 2001; 276: 24453-24456Abstract Full Text Full Text PDF Pu" @default.
• W2127893782 created "2016-06-24" @default.
• W2127893782 creator A5021630861 @default.
• W2127893782 creator A5048920027 @default.
• W2127893782 creator A5069073626 @default.
• W2127893782 date "2006-04-01" @default.
• W2127893782 modified "2023-09-27" @default.
• W2127893782 title "PS-341 (Bortezomib) Induces Lysosomal Cathepsin B Release and a Caspase-2-dependent Mitochondrial Permeabilization and Apoptosis in Human Pancreatic Cancer Cells" @default.
• W2127893782 cites W1890027265 @default.
• W2127893782 cites W1911504906 @default.
• W2127893782 cites W1971256455 @default.
• W2127893782 cites W1976720365 @default.
• W2127893782 cites W1980471295 @default.
• W2127893782 cites W1980608195 @default.
• W2127893782 cites W1984145308 @default.
• W2127893782 cites W1997121321 @default.
• W2127893782 cites W1997879915 @default.
• W2127893782 cites W2006233042 @default.
• W2127893782 cites W2015015357 @default.
• W2127893782 cites W2019631673 @default.
• W2127893782 cites W2023279835 @default.
• W2127893782 cites W2024846074 @default.
• W2127893782 cites W2039767353 @default.
• W2127893782 cites W2039973219 @default.
• W2127893782 cites W2041172149 @default.
• W2127893782 cites W2053815296 @default.
• W2127893782 cites W2054820743 @default.
• W2127893782 cites W2058680827 @default.
• W2127893782 cites W2068779347 @default.
• W2127893782 cites W2072894284 @default.
• W2127893782 cites W2075477970 @default.
• W2127893782 cites W2079825767 @default.
• W2127893782 cites W2083542782 @default.
• W2127893782 cites W2084925682 @default.
• W2127893782 cites W2095279010 @default.
• W2127893782 cites W2098676615 @default.
• W2127893782 cites W2103911973 @default.
• W2127893782 cites W2107277218 @default.
• W2127893782 cites W2108235071 @default.
• W2127893782 cites W2127915152 @default.
• W2127893782 cites W2134388096 @default.
• W2127893782 cites W2135233980 @default.
• W2127893782 cites W2139232922 @default.
• W2127893782 cites W2142120946 @default.
• W2127893782 cites W2148125367 @default.
• W2127893782 cites W2152065071 @default.
• W2127893782 cites W2154513981 @default.
• W2127893782 cites W2156483686 @default.
• W2127893782 cites W2157740207 @default.
• W2127893782 cites W2163679078 @default.
• W2127893782 cites W4244029562 @default.
• W2127893782 doi "https://doi.org/10.1074/jbc.m508533200" @default.
• W2127893782 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16446371" @default.
• W2127893782 hasPublicationYear "2006" @default.
• W2127893782 type Work @default.
• W2127893782 sameAs 2127893782 @default.
• W2127893782 citedByCount "76" @default.
• W2127893782 countsByYear W21278937822012 @default.
• W2127893782 countsByYear W21278937822013 @default.
• W2127893782 countsByYear W21278937822014 @default.
• W2127893782 countsByYear W21278937822015 @default.
• W2127893782 countsByYear W21278937822016 @default.
• W2127893782 countsByYear W21278937822017 @default.
• W2127893782 countsByYear W21278937822018 @default.
• W2127893782 countsByYear W21278937822019 @default.
• W2127893782 countsByYear W21278937822020 @default.
• W2127893782 countsByYear W21278937822022 @default.
• W2127893782 countsByYear W21278937822023 @default.
• W2127893782 crossrefType "journal-article" @default.
• W2127893782 hasAuthorship W2127893782A5021630861 @default.
• W2127893782 hasAuthorship W2127893782A5048920027 @default.
• W2127893782 hasAuthorship W2127893782A5069073626 @default.
• W2127893782 hasBestOaLocation W21278937821 @default.
• W2127893782 hasConcept C121608353 @default.
• W2127893782 hasConcept C153911025 @default.
• W2127893782 hasConcept C167844969 @default.
• W2127893782 hasConcept C181199279 @default.
• W2127893782 hasConcept C185592680 @default.
• W2127893782 hasConcept C190283241 @default.
• W2127893782 hasConcept C203014093 @default.
• W2127893782 hasConcept C2775998712 @default.
• W2127893782 hasConcept C2776364478 @default.
• W2127893782 hasConcept C2777478702 @default.
• W2127893782 hasConcept C2780034444 @default.
• W2127893782 hasConcept C2780210213 @default.
• W2127893782 hasConcept C28021979 @default.
• W2127893782 hasConcept C31573885 @default.
• W2127893782 hasConcept C48297814 @default.
• W2127893782 hasConcept C502942594 @default.
• W2127893782 hasConcept C54355233 @default.
• W2127893782 hasConcept C55493867 @default.
• W2127893782 hasConcept C86803240 @default.
• W2127893782 hasConcept C95444343 @default.
• W2127893782 hasConcept C96232424 @default.
• W2127893782 hasConcept C98424977 @default.
• W2127893782 hasConceptScore W2127893782C121608353 @default.
• W2127893782 hasConceptScore W2127893782C153911025 @default.
• W2127893782 hasConceptScore W2127893782C167844969 @default.

• next