FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2128252987> ?p ?o ?g. }

• W2128252987 endingPage "15306" @default.
• W2128252987 startingPage "15299" @default.
• W2128252987 abstract "During part of its life cycle, the protozoan parasite Plasmodium falciparum lives within the human red blood cell and modifies both the structural and functional properties of the red cell. It does this by synthesizing a number of polypeptides that it transports into the red cell cytoplasm and to the red cell membrane. One of these transported proteins, MESA (mature parasite-infected erythrocyte surfaceantigen), is anchored to the red cell membrane by noncovalent interaction with erythrocyte protein 4.1. We have utilized a combination of in vitro transcription and translation and a membrane binding assay to identify the protein sequence involved in anchoring MESA to the membrane. Labeled fragments of different regions of the MESA protein were evaluated for their ability to bind to inside-out vesicle membrane preparations of human red cells. Binding was dependent on the presence of red cell membrane proteins and was abolished either by trypsin treatment or by selective depletion of membrane proteins. Binding was specific and could be inhibited by the addition of competing protein, with an IC50 of (6.3 ± 1.2) × 10−7m, indicative of a moderate affinity interaction. Fractionation studies demonstrated that binding fragments interacted most efficiently with membrane protein fractions that had been enriched in protein 4.1. Binding inhibition experiments using synthetic peptides identified the binding domain of MESA for protein 4.1 as a 19-residue sequence near the amino terminus of MESA, a region capable of forming an amphipathic helix. During part of its life cycle, the protozoan parasite Plasmodium falciparum lives within the human red blood cell and modifies both the structural and functional properties of the red cell. It does this by synthesizing a number of polypeptides that it transports into the red cell cytoplasm and to the red cell membrane. One of these transported proteins, MESA (mature parasite-infected erythrocyte surfaceantigen), is anchored to the red cell membrane by noncovalent interaction with erythrocyte protein 4.1. We have utilized a combination of in vitro transcription and translation and a membrane binding assay to identify the protein sequence involved in anchoring MESA to the membrane. Labeled fragments of different regions of the MESA protein were evaluated for their ability to bind to inside-out vesicle membrane preparations of human red cells. Binding was dependent on the presence of red cell membrane proteins and was abolished either by trypsin treatment or by selective depletion of membrane proteins. Binding was specific and could be inhibited by the addition of competing protein, with an IC50 of (6.3 ± 1.2) × 10−7m, indicative of a moderate affinity interaction. Fractionation studies demonstrated that binding fragments interacted most efficiently with membrane protein fractions that had been enriched in protein 4.1. Binding inhibition experiments using synthetic peptides identified the binding domain of MESA for protein 4.1 as a 19-residue sequence near the amino terminus of MESA, a region capable of forming an amphipathic helix. The red blood cell has become one of the pre-eminent systems for the analysis of structure-function relationships in the membrane skeleton. It is probably the best understood eukaryotic cell, particularly in regard to the structural organization of the membrane skeleton and its role in regulating the mechanical properties of the cell (1Mohandas N. Lie-Injo L.E. Friedman M. Mak J.W. Blood. 1984; 63: 1385-1392Crossref PubMed Google Scholar, 2Mohandas N. Biochem. Soc. Trans. 1992; 20: 776-782Crossref PubMed Scopus (19) Google Scholar, 3Mohandas N. Chasis J.A. Semin. Hematol. 1993; 30: 171-192PubMed Google Scholar). The ordered arrangement of spectrin tetramers, their interconnection at the ternary complex (with actin and protein 4.1), and the linkages to the overlying cell membrane via band 3 and glycophorin C provide the basis for the cell's ability to deform during passage through the microcirculation (4Gardner K. Bennett G.V. Agre P. Parker J.C. Red Blood Cell Membranes. Marcel Dekker, New York1989: 1-29Google Scholar, 5Bennett V. Methods Enzymol. 1983; 96: 313-323Crossref PubMed Scopus (157) Google Scholar). The stability of the spectrin network is influenced by factors such as the primary sequence of the component proteins and levels of protein phosphorylation (6Ling E. Danilov Y.N. Cohen C.M. J. Biol. Chem. 1988; 263: 2209-2216Abstract Full Text PDF PubMed Google Scholar, 7Manno S. Takakuwa Y. Nagao K. Mohandas N. J. Biol. Chem. 1995; 270: 5659-5665Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar). This understanding of the relationship of the protein network to properties of the whole cell has been advanced by the study of pathological states of red cells in which specific protein interactions have been altered. These include inherited disorders of red cells such as hemoglobinopathies, hereditary spherocytosis, elliptocytosis, and ovalocytosis. We now recognize that the maturation of the intracellular malaria parasite also results in a series of dramatic and extensive changes in the structural and functional properties of the red cell (reviewed in Refs. 8Sherman I.W. Parasitology. 1985; 91: 609-645Crossref PubMed Scopus (91) Google Scholar, 9Cabantchik Z.I. Blood. 1989; 74: 1464-1471Crossref PubMed Google Scholar, 10Sherman I. Crandall I. Smith H. Biol. Cell. 1992; 74: 161-178Crossref PubMed Scopus (39) Google Scholar, 11Howard R.J. Prog. Allergy. 1988; 41: 98-147PubMed Google Scholar, 12Haldar K. Parasitol. Today. 1994; 10: 393-395Abstract Full Text PDF PubMed Scopus (26) Google Scholar, 13Pasloske B.L. Howard R.J. Annu. Rev. Med. 1994; 45: 283-295Crossref PubMed Scopus (81) Google Scholar, 14Roberts D.J. Biggs B.A. Brown G. Newbold C.I. Parasitol. Today. 1993; 9: 281-286Abstract Full Text PDF PubMed Scopus (50) Google Scholar, 15Foley M. Tilley L. Parasitol. Today. 1995; 11: 436-439Abstract Full Text PDF PubMed Scopus (15) Google Scholar). These changes include loss of the normal discoid shape as the infected cell becomes spherocytic and its surface is punctuated by 5,000–10,000 localized, electron-dense elevations of the red cell membrane called knobs (16Aikawa M. Hsieh C.L. Miller L.H. J. Parasitol. 1977; 63: 152-154Crossref PubMed Scopus (16) Google Scholar, 17Aikawa M. Miller L.H. CIBA Found. Symp. 1983; 94: 45-63PubMed Google Scholar, 18Gruenberg J. Allred D. Sherman I. J. Cell Biol. 1983; 97: 795-802Crossref PubMed Scopus (81) Google Scholar). There is increased permeability of the infected red cell to a wide variety of substrates including essential amino acids, phospholipid precursors (19Ancelin M.L. Parant M. Thuet M.J. Philippot J.R. Vial H.J. Biochem. J. 1991; 273: 701-709Crossref PubMed Scopus (44) Google Scholar, 20Vial H.J. Ancelin M.L. Philippot J.R. Thuet M.J. Blood Cells ( N. Y. ). 1990; 16: 559-561Google Scholar), nucleotides (21Gero A.M. Wood A.M. Adv. Exp. Med. Biol. 1991; 309: 169-172Crossref Scopus (15) Google Scholar, 22Gero A.M. Kirk K. Parasitol. Today. 1994; 10: 395-399Abstract Full Text PDF PubMed Scopus (32) Google Scholar), and lactate and iron (23Pollack S. Fleming J. Br. J. Haematol. 1984; 58: 289-293Crossref PubMed Scopus (42) Google Scholar). There are changes in the membrane mechanical properties of the cell with a marked increase in rigidity in red cells infected with mature parasites, and the state of phosphorylation of membrane skeletal proteins is also changed. Strikingly, the infected cells become adhesive for a number of other cells including endothelial cells, normal red cells, and lymphocytes. These changes are important for the survival of the parasite, and in their absence, the parasite dies, or parasitized red cells are rapidly eliminated (11Howard R.J. Prog. Allergy. 1988; 41: 98-147PubMed Google Scholar, 24Hommel M. David P.H. Oligino L.D. J. Exp. Med. 1983; 157: 1137-1148Crossref PubMed Scopus (194) Google Scholar, 25David P.H. Hommel M. Miller L.H. Udeinya I.J. Oligino L.D. Proc. Natl. Acad. Sci. U. S. A. 1983; 80: 5075-5079Crossref PubMed Scopus (276) Google Scholar). Crucial to these changes are the export of a group of proteins of parasite origin into the red cell cytoplasm and to the red cell membrane. This latter group of parasite proteins associates with the red cell membrane skeleton either by deposition on the inner aspect of the membrane or by transient or more permanent insertion into the membrane. One such exported protein is MESA (mature parasite-infected erythrocyte surfaceantigen), a 250–300-kDa phosphoprotein produced early in the trophozoite stage and found in association with the red cell membrane skeleton (26Coppel R.L. Culvenor J.G. Bianco A.E. Crewther P.E. Stahl H.D. Brown G.V. Anders R.F. Kemp D.J. Mol. Biochem. Parasitol. 1986; 20: 265-277Crossref PubMed Scopus (78) Google Scholar, 27Howard R.F. Stanley H.A. Reese R.T. Gene ( Amst. ). 1988; 64: 65-75Crossref PubMed Scopus (24) Google Scholar, 28Howard R.J. Barnwell J.W. Rock E.P. Neequaye J. Ofori A.D. Maloy W.L. Lyon J.A. Saul A. Mol. Biochem. Parasitol. 1988; 27: 207-224Crossref PubMed Scopus (101) Google Scholar). MESA interacts with the internal aspect of the host erythrocyte membrane and is not exposed on the external surface, although in late stage schizonts, it becomes accessible to external surface-labeling agents such as lactoperoxidase (28Howard R.J. Barnwell J.W. Rock E.P. Neequaye J. Ofori A.D. Maloy W.L. Lyon J.A. Saul A. Mol. Biochem. Parasitol. 1988; 27: 207-224Crossref PubMed Scopus (101) Google Scholar, 29Coppel R.L. Lustigman S. Murray L. Anders R.F. Mol. Biochem. Parasitol. 1988; 31: 223-231Crossref PubMed Scopus (56) Google Scholar). The nucleotide sequence of MESA has been reported, and MESA is composed of sets of extensive repeat regions interspersed with nonrepetitive sequences. Lustigman et al. (30Lustigman S. Anders R.F. Brown G.V. Coppel R.L. Mol. Biochem. Parasitol. 1990; 38: 261-270Crossref PubMed Scopus (88) Google Scholar) showed that MESA was coprecipitated with the functionally important erythrocyte skeletal component protein 4.1, suggesting that it was anchored in the membrane skeleton by noncovalent linkage to protein 4.1. Further evidence for this association was provided by studies of malaria infection in mutant red cells with complete deficiency of protein 4.1. In such cells, the distribution of MESA was altered in that it was no longer membrane-bound, but was randomly distributed throughout the red cell cytoplasm (31Magowan C. Coppel R.L. Lau A. Moronne M.M. Tchernia G. Mohandas N. Blood. 1995; 86: 3196-3204Crossref PubMed Google Scholar). Protein 4.1 plays a critical role in maintaining the mechanical integrity of the red cell membrane through its interaction with spectrin and actin (32Bennett V. Annu. Rev. Biochem. 1985; 54: 273-304Crossref PubMed Google Scholar, 33Marchesi V.T. Annu. Rev. Cell Biol. 1985; 1: 531-561Crossref PubMed Scopus (185) Google Scholar, 34Conboy J.G. Semin. Haematol. 1993; 30: 58-73PubMed Google Scholar). Protein 4.1 also plays a role in attachment of the skeleton to the membrane by anchoring the spectrin network to the integral protein glycophorin C (35Chasis J.A. Mohandas N. Blood. 1992; 80: 1869-1879Crossref PubMed Google Scholar). The role of the MESA-protein 4.1 interaction in parasite biology has not been clearly delineated, although it appears to be essential for the survival of the parasite in that malaria parasites cannot survive if MESA is unable to bind protein 4.1 and remains free in the red cell cytoplasm (31Magowan C. Coppel R.L. Lau A. Moronne M.M. Tchernia G. Mohandas N. Blood. 1995; 86: 3196-3204Crossref PubMed Google Scholar). To further our understanding of the interaction between protein 4.1 and MESA, we set out to determine the precise molecular domains involved in this interaction. In this paper, we describe the identification of a sequence in MESA that interacts strongly with the red cell membrane skeleton. We mapped the binding domain of MESA to a 19-residue sequence near the amino terminus of the protein, which appears to form an amphipathic α-helix. Protein fractionation studies demonstrate that this sequence binds most strongly to red cell membrane proteins enriched in protein 4.1. P. falciparum asexual stage parasites were grown in vitroas described by Trager and Jensen (36Trager W. Jensen J. Science. 1976; 193: 673-675Crossref PubMed Scopus (6185) Google Scholar). P. falciparum-infected erythrocytes were grown in a 2–5% hematocrit to a maximum parasitemia of 20%. Cultured parasites were metabolically labeled with [32P]orthophosphate, harvested, and immunoprecipitated as described (30Lustigman S. Anders R.F. Brown G.V. Coppel R.L. Mol. Biochem. Parasitol. 1990; 38: 261-270Crossref PubMed Scopus (88) Google Scholar). Rabbit antibodies against the hexapeptide amino-terminal repeat of the MESA sequence were generated as described (26Coppel R.L. Culvenor J.G. Bianco A.E. Crewther P.E. Stahl H.D. Brown G.V. Anders R.F. Kemp D.J. Mol. Biochem. Parasitol. 1986; 20: 265-277Crossref PubMed Scopus (78) Google Scholar). Erythrocyte cell pellets were incubated for 30 min at 4 °C with a 10-pellet volume of TNET (50 mm Tris-HCl, pH 8.0, 150 mm NaCl, 5 mm EDTA, and 0.05% Triton X-100) containing protease inhibitors (10 mmphenylmethylsulfonyl fluoride, 25 μg/ml chymostatin, and 2 μg/ml leupeptin). Triton X-100-insoluble material was pelleted by centrifugation at 15,000 × g for 10 min at 4 °C, and the supernatant was kept as the Triton X-100-soluble material. The Triton X-100-insoluble pellet was solubilized in 50 μl of 2% SDS in PBS 1The abbreviations used are: PBS, phosphate-buffered saline; IOV, inside-out vesicle; BSA, bovine serum albumin; PCR, polymerase chain reaction; PAGE, polyacrylamide gel electrophoresis. and incubated at room temperature for 30 min. Afterward, 50 μl of 2% Triton X-100 and 400 μl of TNET were added (final concentrations of 0.2% SDS and 0.7% Triton X-100). Immunoprecipitations were performed as described (30Lustigman S. Anders R.F. Brown G.V. Coppel R.L. Mol. Biochem. Parasitol. 1990; 38: 261-270Crossref PubMed Scopus (88) Google Scholar). To ∼1 ml of fresh washed red blood cells, 25 ml of ice-cold 5 mm phosphate buffer, pH 8.0, was added and mixed by inversion. The cells were spun in a Sorvall centrifuge at 8,000 × g for 10 min. This procedure was repeated until the supernatant was free of hemoglobin (two to three times). The cell pellet, composed of red cell ghosts, was resuspended in 1.5 ml of incubation buffer (138 mm NaCl, 5 mm KCl, 6.1 mm Na2HPO4, 1.4 mm NaH2PO4, and 5 mm glucose). To make inside-out vesicles, 20 ml of 0.5 mm phosphate buffer, pH 8.0, was mixed with the cell ghosts, incubated on ice for 30 min, and pelleted by centrifugation at 8,000 × g. 500 μl of 0.5 mm phosphate buffer, pH 8.0, was added to the pellet, and the suspension was passed through a 26-gauge needle seven times. The vesicles were resuspended in 10 ml of 0.5 mm phosphate buffer, pH 8.0, and the mixture was centrifuged in a Sorvall centrifuge at 8,000 × g. The vesicles were resuspended in 1.5 ml of incubation buffer and stored at 4 °C until used. The binding assay involved coating the wells of a polyvinyl chloride tray with IOVs by loading the IOV preparation into individual wells and incubating the tray at 4 °C overnight, followed by a 2-h incubation with 1% BSA in phosphate-buffered saline at 4 °C. An aliquot of TnT 35S-labeled MESA fragment in 50 μl of incubation buffer supplemented with 10 mm l-methionine was added to each well and incubated overnight at 4 °C. The wells were then washed three times with incubation buffer, and the bound MESA fragments were removed using heated (>70 °C) SDS sample buffer. MESA DNA fragments were amplified by PCR amplification methods and directly cloned in frame into the PvuII site of the pRSET vectors. Conditions were used to maximize fidelity of amplification, including low numbers of cycles and a low concentration of enzyme and deoxyoligonucleotides. The oligonucleotide primers used in each reaction are listed in Table I. Orientation of the clone was determined by PCR DNA amplification and restriction enzyme digestion of DNA and was confirmed by automated double-stranded DNA sequencing. pRSET/MESA constructs were sequenced using the PRISM Ready Reaction Dye Deoxy Terminator Cycle sequencing kit (Applied Biosystems, Inc., Foster City, CA) and the ABI Model 373A DNA sequencing system (Applied Biosystems, Inc.) according to the manufacturer's instructions. Sequencing studies on the recombinant clones did not reveal any PCR-generated changes in nucleotide sequence. Positive recombinants were purified by alkaline lysis and CsCl2 gradient centrifugation.Table IOligonucleotide primers used to construct fragments of the mesa geneFragmentPrimersBoundaries of fragment, nucleotides (residues)F1M5, ATGGATATCTATACGAATTGTGAA502 –1399M9, CTGTTATCTTCAGGTTTTTCTG(51 –349)F2M10, CCAAAAAATTAACAGAACAA1574 –1837M11, CATTTTTTTCAGTATTAGC(408 –495)F3M5, ATGGATATCTATACGAATTGTGAA502 –1837M11, CATTTTTTTCAGTATTAGC(51 –495)F3.3M7, GGGGTTCGGTTGTTACAG707 –1399M9, CTGTTATCTTCAGGTTTTTCTG(119 –349)F3.4M8, GAATCCGATGTAGAAAAGGCA880 –1399M9, CTGTTATCTTCAGGTTTTTCTG(176 –349)F3.5M7, GGGGTTCGGTTGTTACAG707 –1837M11, CATTTTTTTCAGTATTAGC(119 –495)F3.7M5, ATGGATATCTATACGAATTGTGAA502 –781M6, TTTCGGATTCTTGCATTT(51 –143)F4M12, ATGGCTAATACTGAAAAAAATGAT1819 –2937M13, TACTTTTTCCTGTTTTGTCAC(490 –862)F5M14, ATGGTGACAAAACAGGAAAAAGTA2917 –4465M15, GTACCAAACCTGATGTAT(856 –1371)F6M16, ATACATCAGGTTTGGTAC4448 –4995M17, CAGTTGAAATCAAATAA(1366 –1526)MESA fragment boundaries are defined by nucleotide and residue positions using the numbering given by Coppel (38Coppel R.L. Mol. Biochem. Parasitol. 1992; 50: 335-347Crossref PubMed Scopus (45) Google Scholar). Open table in a new tab MESA fragment boundaries are defined by nucleotide and residue positions using the numbering given by Coppel (38Coppel R.L. Mol. Biochem. Parasitol. 1992; 50: 335-347Crossref PubMed Scopus (45) Google Scholar). In vitro transcription and translation were performed in a TnT rabbit reticulocyte lysate expression system (Promega, Madison, WI) according to the manufacturer's protocols. A typical reaction mixture included 25 μl of rabbit reticulocyte lysate, 2 μl of TnT reaction buffer, 1 μl of T7 RNA polymerase, 1 μl of amino acid mixture minus methionine, 4 μl of Tran35S-label (1,000 mCi/mmol at 10 mCi/ml; ICN Amersham, Buckinghamshire, United Kingdom), 1 μl of RNasin ribonuclease inhibitor (40 units/μl), and 0.2–2 μg of DNA template, to a final volume of 50 μl in nuclease-free water. The mixture was incubated for 120 min at 30 °C, and the translation products were analyzed by SDS-PAGE. Overnight cultures (60 ml) of Escherichia coli (JM109) transformed with recombinant pGEX plasmids were diluted 1:10 in fresh Luria broth containing 200 μg/ml ampicillin and grown for 1 h at 37 °C. Isopropyl-1-thio-β-d-galactopyranoside was added to 1 mm, and the culture was grown for a further 3–4 h. After centrifugation, the cell pellet was resuspended in PBS, lysed by sonication, and centrifuged at 10,000 × g for 5 min at 4 °C. The supernatant was then passed through a column containing 2 ml of preswollen glutathione-agarose beads equilibrated with PBS. The column was washed with 100 ml of PBS. Fusion protein was eluted by competition with 5 mm reduced glutathione (Sigma) in 50 mm Tris-HCl, pH 8.0. Overnight cultures (60 ml) of E. coli (JM109DE3) transformed with the recombinant pRSET construct were diluted 1:10 in fresh Luria broth containing 200 μg/ml ampicillin and grown at 37 °C toA 560 nm = 0.6–0.8. Isopropyl-1-thio-β-d-galactopyranoside was added to a final concentration of 1 mm and further incubated with shaking for 3–8 h at 37 °C. After centrifugation, the cell culture was pelleted, snap-frozen in dry ice, and stored at −70 °C until purification. The pellet was thawed at room temperature, resuspended in 20 ml of guanidine lysis buffer (6 m guanidine HCl and 0.1m KPO4, pH 7.4), and mixed by rotation for 1–2 h at room temperature. The lysate was sonicated and transferred to a 30-ml Corex tube and pelleted (8,000 × g, 10 min, 4 °C). The supernatant was carefully transferred to a small 40-ml tube and repelleted (12,000 × g, 15 min, 4 °C). The supernatant was transferred to a 50-ml tube and stored at −70 °C or used immediately for affinity purification of the recombinant peptides. A 2-ml bed volume column of Ni2+/nitrilotriacetic acid absorbent was prepared and equilibrated with guanidine lysis buffer. A 20-ml supernatant sample was diluted to 100 ml with guanidine lysis buffer and passed twice over the column. Four washes followed: 50 ml of guanidine lysis buffer; 50 ml of 1 m guanidine HCl, 1m NaCl, and 50 mm KPO4, pH 7.4; 50 ml of 1 m NaCl and 50 mm KPO4, pH 7.4; and 100 ml of low salt buffer (30 mm NaCl and 50 mm KPO4, pH 7.4). The column was washed with additional low salt buffer until the A 280 nm of the wash was <0.005. To elute the bound recombinant protein from the column, 5 ml of 100 mm EDTA, pH 8.0, was added; 1-ml fractions were collected; and the A 280 nmreading was measured. The Ni2+ was removed by extensive dialysis against PBS. The proteins were then analyzed by SDS-PAGE and Coomassie Blue staining. Fresh blood (50 ml) was used to make IOVs as described above, and equal amounts of IOVs were treated with high ionic strength buffer (5 mm phosphate buffer, pH 8.0, and 1m KCl) to elute the peripheral proteins from the vesicle membrane. The eluate was dialyzed to 20 mm KCl and 5 mm phosphate buffer and passed over a DEAE-Sephadex column (Pharmacia, Uppsala). Increasingly higher ionic strength KCl solutions (50, 80, and 165 mm KCl) in 5 mm phosphate buffer were used to elute bound protein fractions from the column. Each of the fractions was dialyzed against PBS over 2 days and stored at −70 °C. Samples were separated by denaturing SDS-PAGE, and the gels were stained with silver nitrate (37Morrissey J.H. Anal. Biochem. 1981; 117: 307-310Crossref PubMed Scopus (2940) Google Scholar). Overlapping synthetic peptides of the MESA F3.7 region were purchased from Chiron Mimotopes (Clayton, Australia). Peptides were >95% pure and of the correct sequence as measured by reverse-phase high pressure liquid chromatography and ion-spray mass spectroscopy. Peptides were solubilized prior to use in the binding assays. Previous work demonstrated that rabbit antibodies raised against the repeat region of MESA were capable of immunoprecipitating two proteins from infected red cells that had been biosynthetically labeled with [32P]orthophosphate (30Lustigman S. Anders R.F. Brown G.V. Coppel R.L. Mol. Biochem. Parasitol. 1990; 38: 261-270Crossref PubMed Scopus (88) Google Scholar). The two coprecipitated proteins were identified as MESA and the red cell membrane skeletal protein protein 4.1 on the basis of molecular mass determination and characteristic peptide mapping profiles (30Lustigman S. Anders R.F. Brown G.V. Coppel R.L. Mol. Biochem. Parasitol. 1990; 38: 261-270Crossref PubMed Scopus (88) Google Scholar). We set out to determine whether MESA would be coprecipitated from labeled lysates of infected cells by an antiserum to protein 4.1. P. falciparum lines D6-1, D6--3, and D10 and uninfected red blood cells were labeled with [32P]orthophosphate. Both D6-3 and D10 express MESA; however, D6-1 is a laboratory-derived, mutant parasite line that has undergone a spontaneous deletion of a region of chromosome 5 that encompasses the MESA-coding sequence and consequently does not express MESA. Parasite lysates were successively solubilized in Triton X-100 and SDS to yield fractions of Triton X-100-soluble and Triton X-100-insoluble proteins. These fractions were then immunoprecipitated with various antisera, including a polyclonal rabbit anti-MESA antiserum, a polyclonal rabbit anti-protein 4.1 antiserum, and normal rabbit serum. The MESA antiserum was raised against the hexapeptide sequence GESKET, a highly conserved repeating unit found in the most NH2-terminal repeat domain of MESA (38Coppel R.L. Mol. Biochem. Parasitol. 1992; 50: 335-347Crossref PubMed Scopus (45) Google Scholar). MESA in isolates D10 and D6-3 was found predominantly in the Triton X-100-insoluble phase, due to its association with the erythrocyte membrane (Fig.1 A). No phosphorylated proteins in uninfected red blood cells or D6-1 were immunoprecipitable with the polyclonal rabbit anti-GESKET antiserum. Phosphorylated protein 4.1 was coprecipitated with MESA in D10 and, to a lesser extent, in D6-3, but not in D6-1 (Fig. 1 A). In parallel experiments, lysates of32P-labeled D6-1 (−MESA) and D6-3 (+MESA) cultures were solubilized in Triton X-100 and immunoprecipitated with anti-protein 4.1 antibodies. A number of proteins of varying molecular mass were coprecipitated. These included the red cell proteins spectrin (240 and 220 kDa), actin (43 kDa), and protein 4.1 (80 kDa). In addition, there was a phosphoprotein of >250 kDa precipitated in D6-3 (+MESA) parasites, but not in D6-1 (−MESA) parasites, that comigrated with MESA (Fig. 1 B). We conclude that there is an association between MESA and protein 4.1 in infected red cells that results in coprecipitation of the two proteins by antiserum to either MESA or protein 4.1. We set out to identify sequences in MESA responsible for its association with the red cell membrane skeleton. The pRSET expression system (Invitrogen, San Diego, CA) was chosen because it offered several advantages including easy purification of the fusion protein under native or denaturing conditions and in vitro labeling and expression of the very same construct. The coupled transcription/translation TnT rabbit reticulocyte lysate system from Promega was used to express MESA constructs termed IVTT (i n vitro transcription and translation). This system provided us with a simple and reliable cell-free transcription and translation system for the expression of MESA polypeptides. Certain experimental approaches were not available to us due to peculiarities of the MESA protein. It was not feasible to purify native MESA from infected red cells due to the relatively low amounts of this protein in infected cells. Furthermore, the insolubility of membrane-bound MESA in non-ionic detergents precluded the use of lysates of infected cells in direct binding assays. The full-length mesa gene is extremely unstable in prokaryotic cloning vectors, and we were therefore unable to undertake studies in which the full-length protein could be used in binding studies. Accordingly, we adopted an approach in which stable fragments of the MESA protein were cloned into the RNA transcription vector pRSET. RNA produced in this manner was translated in an in vitrotranslation system in the presence of [35S]methionine, and the labeled protein was used for binding assays. Although there was some variability in the yield of any particular MESA fragment, all fragments gave readily detectable amounts of radiolabeled product (data not shown). Variation in strength of labeling between fragments appears to be due both to differences in the number of methionine residues in particular sequences and to intrinsic differences in the efficiency of transcription and translation of individual constructs. Translation products consisted of the full-length product and, in some constructs, a series of bands of lower molecular mass (data not shown), which we interpret to be fragments that resulted from premature termination, internal initiation, or perhaps proteolytic degradation. All translated fragments exhibited a lower mobility than expected for their molecular mass, presumably reflecting their highly charged sequences, a finding that is very common for malaria proteins as a group (39Anders R.F. Coppel R.L. Brown G.V. Kemp D.J. Prog. Allergy. 1988; 41: 148-172PubMed Google Scholar). For the binding assay, we chose to vary the amount of added translation products so that approximately equal amounts of labeled material (as judged from autoradiographs of gels of electrophoretically separated translation products) were added to each aliquot of red cell membrane preparation (data not shown). We elected to study the binding of MESA to the red cell membrane skeleton by examining the interaction of labeled fragments with IOVs prepared from uninfected red cells. We chose IOVs as they provide a convenient and accessible preparation of erythrocyte membrane and skeletal proteins that are present in combinations that approximate those found in vivo. Thus, there may be particular constraints on the conformation or accessibility of regions of the skeletal proteins that are better approximated in IOV preparations than in isolated proteins, and these would provide a more suitable binding target for our initial studies. To assess which part of the MESA protein contained a binding domain for IOVs, six pRSET/MESA polypeptide constructs encompassing the whole second exon of the mesa gene sequence were radiolabeled by IVTT and added to aliquots of IOVs. The first exon, which encodes 50 residues, is believed to contain a signal sequence that is removed from the mature MESA polypeptide (38Coppel R.L. Mol. Biochem. Parasitol. 1992; 50: 335-347Crossref PubMed Scopus (45) Google Scholar). Bound fragments (F1–F6) from parallel reactions were eluted, pooled, and subjected to SDS-PAGE (Fig. 2). Autoradiographs of the recovered products revealed that MESA F3 (residues 51–496) and its subfragment F1 showed specific affinity for IOVs (Fig. 2, lanes 1 and3). This suggested that the MESA F1 polypeptide contained a domain that mediates the interaction of MESA with the erythrocyte membrane or skeleton. No MESA fragments that lacked MESA F1 sequence (i.e. MESA F2 and F4–F6) showed detectable binding, suggesting that at least by this assay, the only membra" @default.
• W2128252987 created "2016-06-24" @default.
• W2128252987 creator A5034746599 @default.
• W2128252987 creator A5035953102 @default.
• W2128252987 creator A5052629029 @default.
• W2128252987 date "1997-06-01" @default.
• W2128252987 modified "2023-09-30" @default.
• W2128252987 title "Defining the Minimal Domain of the Plasmodium falciparum Protein MESA Involved in the Interaction with the Red Cell Membrane Skeletal Protein 4.1" @default.
• W2128252987 cites W1024307064 @default.
• W2128252987 cites W135518686 @default.
• W2128252987 cites W142658558 @default.
• W2128252987 cites W1503697962 @default.
• W2128252987 cites W1530102523 @default.
• W2128252987 cites W1743273457 @default.
• W2128252987 cites W1966943311 @default.
• W2128252987 cites W1969503178 @default.
• W2128252987 cites W1971185878 @default.
• W2128252987 cites W1987185807 @default.
• W2128252987 cites W2005945696 @default.
• W2128252987 cites W2008664969 @default.
• W2128252987 cites W2009448974 @default.
• W2128252987 cites W2011387292 @default.
• W2128252987 cites W2011516987 @default.
• W2128252987 cites W2014403739 @default.
• W2128252987 cites W2016667536 @default.
• W2128252987 cites W2031572817 @default.
• W2128252987 cites W2033794360 @default.
• W2128252987 cites W2034959242 @default.
• W2128252987 cites W2036654158 @default.
• W2128252987 cites W2036887760 @default.
• W2128252987 cites W2037042354 @default.
• W2128252987 cites W2038724931 @default.
• W2128252987 cites W2061258811 @default.
• W2128252987 cites W2063384989 @default.
• W2128252987 cites W2068058223 @default.
• W2128252987 cites W2069670229 @default.
• W2128252987 cites W2070999559 @default.
• W2128252987 cites W2076471618 @default.
• W2128252987 cites W2090066598 @default.
• W2128252987 cites W2103643451 @default.
• W2128252987 cites W2118449156 @default.
• W2128252987 cites W2119460480 @default.
• W2128252987 cites W2121473123 @default.
• W2128252987 cites W2131838812 @default.
• W2128252987 cites W2137385090 @default.
• W2128252987 cites W2158875508 @default.
• W2128252987 cites W2168670823 @default.
• W2128252987 cites W2209355206 @default.
• W2128252987 cites W2302876124 @default.
• W2128252987 cites W2401829918 @default.
• W2128252987 cites W2411533701 @default.
• W2128252987 cites W2416173973 @default.
• W2128252987 cites W4234687185 @default.
• W2128252987 cites W4253038916 @default.
• W2128252987 doi "https://doi.org/10.1074/jbc.272.24.15299" @default.
• W2128252987 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9182557" @default.
• W2128252987 hasPublicationYear "1997" @default.
• W2128252987 type Work @default.
• W2128252987 sameAs 2128252987 @default.
• W2128252987 citedByCount "50" @default.
• W2128252987 countsByYear W21282529872012 @default.
• W2128252987 countsByYear W21282529872013 @default.
• W2128252987 countsByYear W21282529872014 @default.
• W2128252987 countsByYear W21282529872015 @default.
• W2128252987 countsByYear W21282529872016 @default.
• W2128252987 countsByYear W21282529872017 @default.
• W2128252987 countsByYear W21282529872018 @default.
• W2128252987 countsByYear W21282529872019 @default.
• W2128252987 countsByYear W21282529872020 @default.
• W2128252987 countsByYear W21282529872021 @default.
• W2128252987 countsByYear W21282529872022 @default.
• W2128252987 crossrefType "journal-article" @default.
• W2128252987 hasAuthorship W2128252987A5034746599 @default.
• W2128252987 hasAuthorship W2128252987A5035953102 @default.
• W2128252987 hasAuthorship W2128252987A5052629029 @default.
• W2128252987 hasBestOaLocation W21282529871 @default.
• W2128252987 hasConcept C134306372 @default.
• W2128252987 hasConcept C144647389 @default.
• W2128252987 hasConcept C159047783 @default.
• W2128252987 hasConcept C185592680 @default.
• W2128252987 hasConcept C199360897 @default.
• W2128252987 hasConcept C203014093 @default.
• W2128252987 hasConcept C2778048844 @default.
• W2128252987 hasConcept C2778371730 @default.
• W2128252987 hasConcept C2780940541 @default.
• W2128252987 hasConcept C2993443003 @default.
• W2128252987 hasConcept C33923547 @default.
• W2128252987 hasConcept C36503486 @default.
• W2128252987 hasConcept C41008148 @default.
• W2128252987 hasConcept C41625074 @default.
• W2128252987 hasConcept C55493867 @default.
• W2128252987 hasConcept C86803240 @default.
• W2128252987 hasConcept C95444343 @default.
• W2128252987 hasConceptScore W2128252987C134306372 @default.
• W2128252987 hasConceptScore W2128252987C144647389 @default.
• W2128252987 hasConceptScore W2128252987C159047783 @default.
• W2128252987 hasConceptScore W2128252987C185592680 @default.
• W2128252987 hasConceptScore W2128252987C199360897 @default.

• next