FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2129364047> ?p ?o ?g. }

• W2129364047 endingPage "22606" @default.
• W2129364047 startingPage "22600" @default.
• W2129364047 abstract "Fibulin-1 is a modular glycoprotein with amino-terminal anaphylatoxin-like modules followed by nine epidermal growth factor (EGF)-like modules and, depending on alternative splicing, four possible carboxyl termini. Fibulin-1 has been shown to self-associate as well as to bind calcium, fibronectin (FN), laminin, nidogen, and fibrinogen. To map ligand-binding sites within fibulin-1, polypeptides corresponding to various regions of fibulin-1 were expressed recombinantly and evaluated for their capacity to bind calcium, FN, or fibulin-1. A calcium-binding site(s) was mapped to EGF-like modules 5–9. A fibulin-1 self-association site was localized to EGF-like modules 5 and 6 (amino acid residues 356–440), as was a binding site for FN. The self-association interaction mediated by this pair of modules involved calcium since divalent cation chelators reduced the binding affinity of the interaction. By contrast, FN binding to EGF-like modules 5 and 6 was unaffected by the presence of divalent cation chelators. It can be concluded that EGF-like modules 5 and 6 bind calcium and mediate homotypic interaction between EGF-like modules 5 and 6 present in different fibulin-1 molecules and heterotypic interaction between EGF-like modules 5 and 6 and type III repeats 13 and 14 in FN. While additional binding sites for calcium or FN were not detected, another fibulin-1 self-association site was found within amino acid residues 30–173. However, unlike the self-association site in EGF-like modules 5 and 6, which was functional in the native protein, the amino-terminal site was cryptic and revealed only after the protein was denatured. Fibulin-1 is a modular glycoprotein with amino-terminal anaphylatoxin-like modules followed by nine epidermal growth factor (EGF)-like modules and, depending on alternative splicing, four possible carboxyl termini. Fibulin-1 has been shown to self-associate as well as to bind calcium, fibronectin (FN), laminin, nidogen, and fibrinogen. To map ligand-binding sites within fibulin-1, polypeptides corresponding to various regions of fibulin-1 were expressed recombinantly and evaluated for their capacity to bind calcium, FN, or fibulin-1. A calcium-binding site(s) was mapped to EGF-like modules 5–9. A fibulin-1 self-association site was localized to EGF-like modules 5 and 6 (amino acid residues 356–440), as was a binding site for FN. The self-association interaction mediated by this pair of modules involved calcium since divalent cation chelators reduced the binding affinity of the interaction. By contrast, FN binding to EGF-like modules 5 and 6 was unaffected by the presence of divalent cation chelators. It can be concluded that EGF-like modules 5 and 6 bind calcium and mediate homotypic interaction between EGF-like modules 5 and 6 present in different fibulin-1 molecules and heterotypic interaction between EGF-like modules 5 and 6 and type III repeats 13 and 14 in FN. While additional binding sites for calcium or FN were not detected, another fibulin-1 self-association site was found within amino acid residues 30–173. However, unlike the self-association site in EGF-like modules 5 and 6, which was functional in the native protein, the amino-terminal site was cryptic and revealed only after the protein was denatured. Fibulin-1 is an extracellular matrix and plasma glycoprotein that belongs to an emerging gene family with three members designated fibulin-1–3 (1Argraves W.S. Tran H. Burgess W.H. Dickerson K. J. Cell Biol. 1990; 111: 3155-3164Crossref PubMed Scopus (180) Google Scholar, 2Pan T.C. Sasaki T. Zhang R.Z. Fassler R. Timpl R. Chu M.L. J. Cell Biol. 1993; 123: 1269-1277Crossref PubMed Scopus (145) Google Scholar, 3Tran H. Mattei M. Godyna S. Argraves W.S. Matrix Biol. 1997; 15: 479-493Crossref PubMed Scopus (56) Google Scholar). While the function(s) of fibulin-1 is not known, fibulin-1 has been shown to bind calcium (4Argraves W.S. Dickerson K. Burgess W.H. Ruoslahti E. Cell. 1989; 58: 623-629Abstract Full Text PDF PubMed Scopus (104) Google Scholar, 5Kluge M. Mann K. Dziadek M. Timpl R. Eur. J. Biochem. 1990; 193: 651-659Crossref PubMed Scopus (59) Google Scholar); the extracellular matrix proteins fibronectin (FN), 1The abbreviations used are: FN, fibronectin; EGF, epidermal growth factor; FITC, fluorescein isothiocyanate; PCR, polymerase chain reaction; PAGE, polyacrylamide gel electrophoresis; ELISA, enzyme-linked immunosorbent assay(s); HPLC, high pressure liquid chromatography.1The abbreviations used are: FN, fibronectin; EGF, epidermal growth factor; FITC, fluorescein isothiocyanate; PCR, polymerase chain reaction; PAGE, polyacrylamide gel electrophoresis; ELISA, enzyme-linked immunosorbent assay(s); HPLC, high pressure liquid chromatography. nidogen, and laminin (6Balbona K. Tran H. Godyna S. Ingham K.C. Strickland D.K. Argraves W.S. J. Biol. Chem. 1992; 267: 20120-20125Abstract Full Text PDF PubMed Google Scholar, 7Pan T.C. Kluge M. Zhang R.Z. Mayer U. Timpl R. Chu M.L. Eur. J. Biochem. 1993; 215: 733-740Crossref PubMed Scopus (96) Google Scholar); and the coagulation protein fibrinogen (8Tran H. Tanaka A. Litvinovich S.V. Medved L.V. Haudenschild C.C. Argraves W.S. J. Biol. Chem. 1995; 270: 19458-19464Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). In addition, fibulin-1 is capable of self-association (6Balbona K. Tran H. Godyna S. Ingham K.C. Strickland D.K. Argraves W.S. J. Biol. Chem. 1992; 267: 20120-20125Abstract Full Text PDF PubMed Google Scholar, 7Pan T.C. Kluge M. Zhang R.Z. Mayer U. Timpl R. Chu M.L. Eur. J. Biochem. 1993; 215: 733-740Crossref PubMed Scopus (96) Google Scholar). These interactions, individually or in combination, may account for the observed association of fibulin-1 with basement membranes (5Kluge M. Mann K. Dziadek M. Timpl R. Eur. J. Biochem. 1990; 193: 651-659Crossref PubMed Scopus (59) Google Scholar, 9Spence S.G. Argraves W.S. Walters L. Hungerford J.E. Little C.D. Dev. Biol. 1992; 151: 473-484Crossref PubMed Scopus (78) Google Scholar, 10Zhang H.Y. Kluge M. Timpl R. Chu M.L. Ekblom P. Differentiation. 1993; 52: 211-220Crossref PubMed Scopus (50) Google Scholar, 11Miosge N. Gotz W. Sasaki T. Chu M.L. Timpl R. Herken R. Histochem. J. 1996; 28: 109-116Crossref PubMed Scopus (57) Google Scholar), connective tissue elastic fibers (12Roark E.F. Keene D.R. Haudenschild C.C. Godyna S. Little C.D. Argraves W.S. J. Histochem. Cytochem. 1995; 43: 401-411Crossref PubMed Scopus (161) Google Scholar), and fibrin clots (8Tran H. Tanaka A. Litvinovich S.V. Medved L.V. Haudenschild C.C. Argraves W.S. J. Biol. Chem. 1995; 270: 19458-19464Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). The molecular basis for the protein interactions of fibulin-1 as well as its binding to calcium have not been fully established. It has been determined that fibulin-1 binds to FN within type III repeats 13 and 14 (6Balbona K. Tran H. Godyna S. Ingham K.C. Strickland D.K. Argraves W.S. J. Biol. Chem. 1992; 267: 20120-20125Abstract Full Text PDF PubMed Google Scholar), to a site within the amino-terminal G1-G2 domains of nidogen (7Pan T.C. Kluge M. Zhang R.Z. Mayer U. Timpl R. Chu M.L. Eur. J. Biochem. 1993; 215: 733-740Crossref PubMed Scopus (96) Google Scholar), to a site contained within the carboxyl terminus of the α chain of Engelbreth-Holm-Swarm tumor laminin (α1β1γ1) (7Pan T.C. Kluge M. Zhang R.Z. Mayer U. Timpl R. Chu M.L. Eur. J. Biochem. 1993; 215: 733-740Crossref PubMed Scopus (96) Google Scholar, 13Brown J.C. Wiedemann H. Timpl R. J. Cell Sci. 1994; 107: 329-338Crossref PubMed Google Scholar), and to a site within the carboxyl-terminal region of the fibrinogen Bβ chain (8Tran H. Tanaka A. Litvinovich S.V. Medved L.V. Haudenschild C.C. Argraves W.S. J. Biol. Chem. 1995; 270: 19458-19464Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). However, localization of the binding sites within fibulin-1 for these ligands has not been determined. Similarly, the binding site(s) for calcium has not been localized within fibulin-1, although four of its nine EGF-like modules contain the consensus sequence for post-translational hydroxylation of asparagine, and such hydroxylation has been associated with calcium-binding EGF-like modules in a number of proteins (14Stenflo J. Ohlin A.-K. Owen W.G. Schneider W.J. J. Biol. Chem. 1988; 263: 21-24Abstract Full Text PDF PubMed Google Scholar, 15Sugo T. Bjork I. Holmgren A. Stenflo J. J. Biol. Chem. 1984; 259: 5705-5710Abstract Full Text PDF PubMed Google Scholar). In an effort to determine the location of ligand-binding sites within fibulin-1, we have expressed various portions of fibulin-1 in stably transfected eucaryotic cells, purified the expressed proteins, and used them in solid-phase binding assays to evaluate their capacity to bind calcium, fibulin-1, and FN. The mouse monoclonal fibulin-1 antibodies 3A11 and 5D12 and the rabbit polyclonal fibulin-1 antiserum 1323 have been described previously (1Argraves W.S. Tran H. Burgess W.H. Dickerson K. J. Cell Biol. 1990; 111: 3155-3164Crossref PubMed Scopus (180) Google Scholar, 4Argraves W.S. Dickerson K. Burgess W.H. Ruoslahti E. Cell. 1989; 58: 623-629Abstract Full Text PDF PubMed Scopus (104) Google Scholar). The epitope for the 3A11 antibody maps to the amino-terminal region of fibulin-1 within residues 30–153, whereas the epitope for the 5D12 antibody maps to the carboxyl-terminal region of fibulin-1C within residues 567–683 (data not shown). The 3A11 and 5D12 IgGs were purified by protein G-Sepharose (Pharmacia Biotech Inc.) chromatography. Mouse monoclonal fluorescein isothiocyanate (FITC) antibody (FL-D6) was purchased from Sigma. Fibulin-1 was isolated from human placenta by immunoaffinity chromatography using 3A11 IgG-Sepharose as described previously (1Argraves W.S. Tran H. Burgess W.H. Dickerson K. J. Cell Biol. 1990; 111: 3155-3164Crossref PubMed Scopus (180) Google Scholar). Human FN was purified as described by Miekka et al. (16Miekka S.I. Ingham K.C. Menache D. Thromb. Res. 1982; 27: 1-14Abstract Full Text PDF PubMed Scopus (246) Google Scholar). The 30-kDa heparin-binding fragment of FN (30-kDa FN) that contains type III modules 12–14, also known as the HEP-2 fragment, was provided by Dr. Kenneth Ingham (American Red Cross, Rockville, MD). Ovalbumin was purchased from Sigma. Fibulin-1 (50 μg) was radioiodinated using 20 μg of IODO-GEN (Pierce), 0.5 mCi of Na125I (Amersham Corp.), and 0.25 mm NaI in 100 μl of phosphate-buffered saline. Radiolabeled fibulin-1 was separated from the unincorporated iodine by gel filtration chromatography using a Sephadex G-25M column (Pharmacia Biotech Inc.). The specific activity achieved ranged from 1 to 10 μCi/μg of protein. Proteins (e.g. placental fibulin-1, recombinant fibulin-1 polypeptide Fib5–9C, and 30-kDa FN) were fluorescein-labeled using a method described by Busby and Ingham (42Busby T.F. Ingham K.C. Biochemistry. 1988; 27: 6127-6135Crossref PubMed Scopus (25) Google Scholar). Briefly, each protein was mixed with a 40-fold molar excess of FITC (Molecular Probes, Inc., Eugene, OR) in 0.1 m NaHCO3, pH 9.5. After a 4-h incubation in the dark at room temperature, FITC-labeled protein was separated from unincorporated FITC by gel filtration on a Sephadex G-25M column. The degree of labeling was determined optically as described by Ingham and Brew (17Ingham K.C. Brew S.A. Biochim. Biophys. Acta. 1981; 670: 181-189Crossref PubMed Scopus (37) Google Scholar). A typical labeling efficiency was 4–5 mol of FITC/mol for fibulin-1, 30-kDa FN, and FN and 0.75 for Fib5–9C. Plasmid constructs were designed to express full-length fibulin-1C and six permeations of fibulin-1 that are depicted in Fig.1. The eucaryotic expression vector pcDNA3 (Invitrogen, San Diego, CA) was used to place the fibulin-1 cDNAs under the transcriptional control of the human cytomegalovirus promoter. The design of the full-length fibulin-1C expression construct designated pcDNAINeoFibC and its transfection into human fibrosarcoma HT1080 cells (ATCC CCL-121) have been described previously (3Tran H. Mattei M. Godyna S. Argraves W.S. Matrix Biol. 1997; 15: 479-493Crossref PubMed Scopus (56) Google Scholar). The constructs FibE1–9C, FibE5–9C, and FibE7–9C were generated by ligating a PCR fragment encoding the fibulin-1 signal sequence (PCR fragment 1) (Table I) to PCR fragments 2, 3, and 4, respectively, and subcloning each into pcDNA3. The construct designated FibA1–3C was made by ligating PCR fragments 5 and 6 and subcloning into pcDNA3. FibA1–3E1–4 was made by subcloning a single PCR fragment (fragment 7) into pcDNA3. FibA1–3E1–8 was made using site-directed mutagenesis by overlap extension (18Ho S.N. Hunt H.D. Horton R.M. Pullen J.K. Pease L.R. Gene ( Amst. ). 1989; 77: 51-59Crossref PubMed Scopus (6771) Google Scholar) of two PCR fragments (fragments 8 and 9) to convert Asp525 to a stop codon. All of the PCR fragments described were made using the pairs of primers indicated in Tables I andII and pcDNAINeoFibC (3Tran H. Mattei M. Godyna S. Argraves W.S. Matrix Biol. 1997; 15: 479-493Crossref PubMed Scopus (56) Google Scholar) as template.Table IDescription of PCR-generated fibulin-1 fragments used to create fibulin-1 permeationsFragment designationNucleotide residuesAmino acid residuesUpstream primer1-aThe indicated primer designations refer to those described in Table II.Downstream primer1-aThe indicated primer designations refer to those described in Table II.Construct name1-bThe construct name refers to the plasmid construct into which the indicated fragment, either alone or in combination with another fragment, was incorporated.11–1061-cIn order to generate the AatII cloning site located at the 3′-end of PCR fragment 1, Ala29 (within the signal peptide) was converted to Val.1 –3056FibE1–9C1-dRequired ligation of PCR fragments 1 and 2.FibE5–9C1-aThe indicated primer designations refer to those described in Table II.FibE7–9C1-fRequired ligation of PCR fragments 1 and 4.2518–2200175 –68321FibE1–9C1-dRequired ligation of PCR fragments 1 and 2.31058–2200356 –68331FibE5–9C1-eRequired ligation of PCR fragments 1 and 3.41313–2200441 –68341FibE7–9C1-fRequired ligation of PCR fragments 1 and 4.51–5501 –17457FibA1–3C1-gRequired ligation of PCR fragments 5 and 6.61658–2200555 –68381FibA1–3C1-gRequired ligation of PCR fragments 5 and 6.71–10961 –35559FibA1–3E1–481–15941-hContained a mutation that introduced a stop codon at positions 1583–1585.1 –524511FibA1–3E1–81-iRequired annealing of fragments 8 and 9 and subsequent fill-in according to the overlapping extension PCR procedure described by Ho et al. (18).91571–22001-hContained a mutation that introduced a stop codon at positions 1583–1585.521 –524101FibA1–3E1–81-iRequired annealing of fragments 8 and 9 and subsequent fill-in according to the overlapping extension PCR procedure described by Ho et al. (18).PCR fragments 1–9 were each generated using the indicated primers and pcDNAINeoFibC (3Tran H. Mattei M. Godyna S. Argraves W.S. Matrix Biol. 1997; 15: 479-493Crossref PubMed Scopus (56) Google Scholar) as template.1-a The indicated primer designations refer to those described in Table II.1-b The construct name refers to the plasmid construct into which the indicated fragment, either alone or in combination with another fragment, was incorporated.1-c In order to generate the AatII cloning site located at the 3′-end of PCR fragment 1, Ala29 (within the signal peptide) was converted to Val.1-d Required ligation of PCR fragments 1 and 2.1-e Required ligation of PCR fragments 1 and 3.1-f Required ligation of PCR fragments 1 and 4.1-g Required ligation of PCR fragments 5 and 6.1-h Contained a mutation that introduced a stop codon at positions 1583–1585.1-i Required annealing of fragments 8 and 9 and subsequent fill-in according to the overlapping extension PCR procedure described by Ho et al. (18Ho S.N. Hunt H.D. Horton R.M. Pullen J.K. Pease L.R. Gene ( Amst. ). 1989; 77: 51-59Crossref PubMed Scopus (6771) Google Scholar). Open table in a new tab Table IIOligonucleotide primers used in the generation of fibulin-1 cDNAsPrimer No.Oligonucleotide sequencePositions1TCTAGCATTTAGGTGACACTATAG2308–23312-aThe numbers indicated correspond to residues within pcDNAINeo (Invitrogen).2GAACAAGAGGACgtcTATCTGAAT518–5402-bThe numbers indicated correspond to residues within human within fibulin-1C cDNA (1).AatII3GAGGGAACGCGCgacGtcGATGTGGAC1058–10842-bThe numbers indicated correspond to residues within human within fibulin-1C cDNA (1).AatII4GATGGCAGGTCAgacGtcGACATCAAT1313–13392-bThe numbers indicated correspond to residues within human within fibulin-1C cDNA (1).AatII5TCTGGCTAACTAGAGAACCCACTG2127–21502-aThe numbers indicated correspond to residues within pcDNAINeo (Invitrogen).6GAGGACATCGACGtcCACTCCGGC83–1062-bThe numbers indicated correspond to residues within human within fibulin-1C cDNA (1).AatII7GCAGCGGTCgacgtcATATGGGTCCTC524–5502-bThe numbers indicated correspond to residues within human within fibulin-1C cDNA (1).AatII8CGCTGCCTGGaCgTCGAGTGCCCTGAG1658–16842-bThe numbers indicated correspond to residues within human within fibulin-1C cDNA (1).AatII9TGGCGCGCAtctagaCACtTaAACACAGCG1067–10962-bThe numbers indicated correspond to residues within human within fibulin-1C cDNA (1).XbaI10CGCAACTGCCAAtAaATTGATGAG1571–15942-bThe numbers indicated correspond to residues within human within fibulin-1C cDNA (1).11CTCATCAATtAaTTGGCAGTTGCG1571–15942-bThe numbers indicated correspond to residues within human within fibulin-1C cDNA (1).Mismatches with template sequence are indicated by lower-case letters. Stop codons are shown in boldface. Restriction site recognition sequences are underlined.2-a The numbers indicated correspond to residues within pcDNAINeo (Invitrogen).2-b The numbers indicated correspond to residues within human within fibulin-1C cDNA (1Argraves W.S. Tran H. Burgess W.H. Dickerson K. J. Cell Biol. 1990; 111: 3155-3164Crossref PubMed Scopus (180) Google Scholar). Open table in a new tab PCR fragments 1–9 were each generated using the indicated primers and pcDNAINeoFibC (3Tran H. Mattei M. Godyna S. Argraves W.S. Matrix Biol. 1997; 15: 479-493Crossref PubMed Scopus (56) Google Scholar) as template. Mismatches with template sequence are indicated by lower-case letters. Stop codons are shown in boldface. Restriction site recognition sequences are underlined. Fibulin-1 plasmid constructs were individually introduced into a non-fibulin-1-expressing cell line, human fibrosarcoma HT1080 cells, using calcium phosphate transfection with reagents supplied in a kit (Life Technologies, Inc.). Cells were grown in complete medium (minimal essential medium/Earle's balanced sodium salt (Hyclone Laboratories, Logan, UT), 100 units/ml penicillin, and 100 μg/ml streptomycin (Life Technologies, Inc.)) containing 0.6 mg/ml Geneticin (Life Technologies, Inc.). Colonies of resistant cells were isolated after 4–6 weeks using a sterile cotton swab. For immunological evaluation, the cells were grown in serum-free medium. Aliquots of the conditioned culture medium were screened by immunoblot analysis using fibulin-1 antibody 1323. Those cell lines that were found to express relatively high levels of each of the recombinant forms of fibulin-1 were selected for large-scale protein purification. Stably transfected cell lines were grown to confluence in 2-liter roller bottles (Corning Inc., Corning, NY) in complete medium containing 0.3 mg/ml Geneticin. The medium was replaced with serum-free medium, and the cells were grown for 2 days. The medium was collected and clarified by centrifugation at 5000 × g. The supernatant was supplemented with phenylmethylsulfonyl fluoride (final concentration of 1 mm) and EDTA (final concentration of 5 mm) and preabsorbed on a column of Sepharose CL-4B. The flow-through fraction was applied to one of two types of anti-fibulin-1 IgG-Sepharose affinity columns. 5D12 IgG-Sepharose was used to purify those fibulin-1 polypeptides that contained the carboxyl-terminal fibulin-type module (e.g. FibE1–9C, FibE5–9C, and FibE7–9C fragments), whereas 3A11 IgG-Sepharose was used to purify those fibulin-1 polypeptides that contained the amino-terminal repeated anaphylatoxin domain. Bound protein was eluted with 4 mKSCN. After dialysis against Tris-buffered saline, the fibulin-1 polypeptide preparations were absorbed on heparin-Sepharose and gelatin-Sepharose to remove any contaminating FN, as described previously (19Godyna S. Mann D.M. Argraves W.S. Matrix Biol. 1994; 14: 467-477Crossref Scopus (61) Google Scholar). Recombinant fibulin-1 polypeptides were transferred to nitrocellulose membranes after SDS-PAGE. The membranes were treated with 3% nonfat dry milk in Tris-buffered saline and 5 mm CaCl2 and incubated for 18 h at 4 °C with 125I-labeled fibulin-1 (20 nm) in the same buffer containing 0.05% Tween 20. Following incubation, the filters were washed with Tris-buffered saline and 0.05% Tween 20 and used to expose Kodak X-Omat AR film at −70 °C. Enzyme-linked immunosorbent assays (ELISA) were performed as described previously (6Balbona K. Tran H. Godyna S. Ingham K.C. Strickland D.K. Argraves W.S. J. Biol. Chem. 1992; 267: 20120-20125Abstract Full Text PDF PubMed Google Scholar). Homologous and heterologous ligand displacement assays were carried out in a manner similar to that described before (20Williams S.E. Ashcom J.D. Argraves W.S. Strickland D.K. J. Biol. Chem. 1992; 267: 9035-9040Abstract Full Text PDF PubMed Google Scholar). However, FITC-labeled proteins were used instead of radiolabeled proteins, and binding was measured by ELISA using monoclonal FITC antibody and goat anti-mouse IgG conjugated to alkaline phosphatase (Bio-Rad) and the substratep-nitrophenyl phosphate (disodium; Sigma). The relative efficiency of recombinant fibulin-1 derivatives to bind microtiter plastic was evaluated by ELISA, and based on the results, subsequent coating concentrations were adjusted to achieve equimolar coatings for each protein. Evaluation of the ability of recombinant fibulin-1 subfragments to bind calcium was carried out using the method of Maruyama et al. (21Maruyama K. Mikawa T. Ebashi S. J. Biochem. ( Tokyo ). 1984; 95: 511-519Crossref PubMed Scopus (626) Google Scholar). Recombinant fibulin-1 fragments were separated by electrophoresis on 10% acrylamide gels under nonreducing conditions and transferred to nitrocellulose membranes. The membranes were washed with 60 mm KCl and 10 mm imidazole HCl, pH 6.8, and incubated for 10 min at room temperature with45Ca2+ (1 μCi/ml) in the same buffer. Unbound45Ca2+ was removed by washing the membrane twice (for 5 min each) with 50% ethanol. The membranes were dried and used to expose Kodak X-Omat AR film at −70 °C. Analysis for the presence of hydroxyasparagine and/or hydroxyaspartate in fibulin-1 was carried out as described by Przysiecki et al. (22Przysiecki C.T. Staggers J.E. Ramjit H.G. Musson D.G. Stern A.M. Bennett C.D. Friedman P.A. Proc. Natl. Acad. Sci U. S. A. 1987; 84: 7856-7860Crossref PubMed Scopus (58) Google Scholar). Briefly, 100 μg of fibulin-1 or bovine protein S (Enzyme Research Laboratories, Inc., South Bend, IN) were dried and resuspended in 50 mm Tris, pH 7.5 (2 μg/μl final concentration). Pronase (Calbiochem) was added to a final concentration of 0.16 μg/μl and incubated for 8 h at 37 °C. An additional aliquot of Pronase was added to make the concentration 0.28 μg/μl and incubated for 5 h at 37 °C. Following the Pronase digestion, aminopeptidase M (Calbiochem) was added to a concentration of 0.01 μg/μl and incubated for 10 h at 37 °C. The sample was adjusted to pH 2.0 with 98% formic acid and subjected to cation-exchange HPLC analysis. Chromatography was carried out using a 10 × 0.46 cm (inner diameter) column packed with SS/D-X8.25 resin (Sierra Separations, Reno, NV) and a 3 × 0.32-cm guard column of Aminex A-9 (Bio-Rad). Elution buffers and post-column derivatization conditions were as described by Przysieckiet al. (22Przysiecki C.T. Staggers J.E. Ramjit H.G. Musson D.G. Stern A.M. Bennett C.D. Friedman P.A. Proc. Natl. Acad. Sci U. S. A. 1987; 84: 7856-7860Crossref PubMed Scopus (58) Google Scholar). A series of plasmid constructs were generated so as to permit expression in eucaryotic cells of six permeations of human fibulin-1. Fibulin-1 polypeptides were expressed that contained, either alone or in combination, each of the major structural elements found in fibulin-1, including the amino-terminal anaphylatoxin-like region (designated A), the EGF-like region (designated E), and the carboxyl-terminal fibulin-type module (designated C). The portion of the fibulin-1 protein that each construct encoded is schematically depicted in Fig. 1. Each plasmid was stably transfected into HT1080 cells, and the cDNA insert-encoded protein was isolated by anti-fibulin-1-Sepharose affinity chromatography. Shown in Fig. 2 is the SDS-PAGE analysis of the resulting preparations of recombinant fibulin-1 polypeptides. The typical yields ranged from 0.48 to 1.8 mg of protein/liter of conditioned culture medium. The results indicate that chemical amounts of fibulin-1 polypeptides corresponding to various regions of fibulin-1 could be derived from cell lines stably transfected with the fibulin-1 expression constructs. Previous studies have shown that fibulin-1 is a calcium-binding protein (4Argraves W.S. Dickerson K. Burgess W.H. Ruoslahti E. Cell. 1989; 58: 623-629Abstract Full Text PDF PubMed Scopus (104) Google Scholar, 5Kluge M. Mann K. Dziadek M. Timpl R. Eur. J. Biochem. 1990; 193: 651-659Crossref PubMed Scopus (59) Google Scholar). To localize the region(s) of fibulin-1 involved in calcium binding, purified recombinant fibulin-1 fragments were separated by SDS-PAGE, transferred to nitrocellulose membranes, and probed with45Ca2+. As shown in Fig.3, fibulin-1 polypeptides that contained EGF-like domains 5–9 (FibE1–9C, FibE5–9C, FibE7–9C, and FibA1–3E1–8) bound radioactive calcium. Fibulin-1 polypeptides that lacked these EGF-like domains such as FibA1–3E1–4 and FibA1–3C showed no ability to bind calcium in this assay. These data indicate that the calcium-binding site(s) are contained within EGF-like modules 5–9. Of the nine EGF-like modules present in fibulin-1, four (EGF-like modules 5–8) bear a consensus sequence for asparagine β-hydroxylation. Such hydroxylation has been associated with calcium-binding EGF-like modules in several proteins (14Stenflo J. Ohlin A.-K. Owen W.G. Schneider W.J. J. Biol. Chem. 1988; 263: 21-24Abstract Full Text PDF PubMed Google Scholar, 15Sugo T. Bjork I. Holmgren A. Stenflo J. J. Biol. Chem. 1984; 259: 5705-5710Abstract Full Text PDF PubMed Google Scholar). To determine whether fibulin-1 contains β-hydroxyasparagine, cation-exchange HPLC analysis of proteolytic digests of fibulin-1 was performed. As shown in Fig. 4, the HPLC profile of proteolyzed fibulin-1 contains a peak corresponding to that of the erythro-β-hydroxyasparagine standard (Fig. 4,traces C and A, respectively). Analysis of bovine protein S, which is known to contain hydroxylated asparagine (23Stenflo J. Lundwall A. Dahlback B. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 368-372Crossref PubMed Scopus (116) Google Scholar), produced a similar peak in its HPLC profile (Fig. 4, trace B). Because data from the enzymatic digestion of fibulin-1 could not be used to make quantitative estimates of the amount of β-hydroxyasparagine in fibulin-1, HPLC analysis of acid-hydrolyzed fibulin-1 was performed. The results of this analysis (data not shown) indicated that fibulin-1 contains 3 mol of β-hydroxyaspartate/mol of protein. Since the acid hydrolysis converts asparagine to aspartic acid and each of the consensus β-hydroxylation sites present in EGF-like modules 5–8 contains asparagine, the results can be interpreted to indicate that there are 3 mol of β-hydroxyasparagine in fibulin-1. To localize the regions of fibulin-1 that mediate its self-association, the various recombinantly derived fibulin-1 polypeptides were coated on microtiter wells and tested for their ability to promote binding of solution-phase FITC-labeled fibulin-1. As shown in Fig. 5 A, fibulin-1 polypeptides containing EGF-like modules 1–9, 1–8, and 5–9 (e.g. FibE1–9C, FibE5–9C, and FibA1–3E1–8) promoted binding of FITC-labeled fibulin-1. Fibulin-1 polypeptides that lacked EGF-like modules 5 and 6 (e.g. FibA1–3C, FibA1–3E1–4, and FibE7–9C) showed little or no ability to bind FITC-labeled fibulin-1. Similar binding results were obtained when radioiodinated or digoxygenin-labeled fibulin-1 was used as a probe (data not shown). In addition, when a recombinant fibulin-1 polypeptide that contained EGF-like modules 5–9 (FibE5–9C) was FITC-labeled and used as a probe in the binding assays, it was found to bind to those polypeptides that contained EGF-like modules 5 and 6, but not to the polypeptides that lacked the two modules (Fig. 5 B). Taken together, the binding data indicate that a fibulin-1 self-association site is contained within EGF-like modules 5 and 6. Considering the above-mentioned finding that EGF-like modules 5–8 also bind calcium, we evaluated the effect of divalent cation chelators (EDTA and EGTA) on the fibulin-1/fibulin-1 interaction. As shown in Fig. 5 C, when the binding reactions were done in the presence of EDTA, there was a marked decrease in the binding of FITC-labeled fibulin-1 to fibulin-1 polypeptides bearing EGF-like modules 5–8. A similar magnitude of reduction in binding was obtained when EGTA was used instead of EDTA (data not shown). While the apparent affinity of fibulin-1 binding to polypeptides bearing EGF-like modules 5–8 was significantly reduced by either EDTA or EGTA, complete inhibition of binding was not achieved. The results suggest that calcium bound to EGF-like modules 5–8 plays" @default.
• W2129364047 created "2016-06-24" @default.
• W2129364047 creator A5008424026 @default.
• W2129364047 creator A5039488710 @default.
• W2129364047 creator A5057692069 @default.
• W2129364047 date "1997-09-01" @default.
• W2129364047 modified "2023-10-06" @default.
• W2129364047 title "The Self-association and Fibronectin-binding Sites of Fibulin-1 Map to Calcium-binding Epidermal Growth Factor-like Domains" @default.
• W2129364047 cites W137168614 @default.
• W2129364047 cites W1486108017 @default.
• W2129364047 cites W1495239533 @default.
• W2129364047 cites W1503392039 @default.
• W2129364047 cites W1507420346 @default.
• W2129364047 cites W1539168089 @default.
• W2129364047 cites W1539895365 @default.
• W2129364047 cites W1548920373 @default.
• W2129364047 cites W1567817544 @default.
• W2129364047 cites W1572927059 @default.
• W2129364047 cites W1602657018 @default.
• W2129364047 cites W16659746 @default.
• W2129364047 cites W1865475665 @default.
• W2129364047 cites W1964253980 @default.
• W2129364047 cites W1971156818 @default.
• W2129364047 cites W1975771868 @default.
• W2129364047 cites W1988656749 @default.
• W2129364047 cites W1999801367 @default.
• W2129364047 cites W2013762859 @default.
• W2129364047 cites W2014130516 @default.
• W2129364047 cites W2019130075 @default.
• W2129364047 cites W2019966970 @default.
• W2129364047 cites W2021920236 @default.
• W2129364047 cites W2024410294 @default.
• W2129364047 cites W2026568244 @default.
• W2129364047 cites W2036137501 @default.
• W2129364047 cites W2041754265 @default.
• W2129364047 cites W2046620652 @default.
• W2129364047 cites W2053146170 @default.
• W2129364047 cites W2060913542 @default.
• W2129364047 cites W2061448045 @default.
• W2129364047 cites W2069493740 @default.
• W2129364047 cites W2072289839 @default.
• W2129364047 cites W2085252674 @default.
• W2129364047 cites W2085259673 @default.
• W2129364047 cites W2118305149 @default.
• W2129364047 cites W2122989956 @default.
• W2129364047 cites W2123259277 @default.
• W2129364047 cites W2128647672 @default.
• W2129364047 cites W2135888012 @default.
• W2129364047 cites W2140807560 @default.
• W2129364047 cites W4244423772 @default.
• W2129364047 doi "https://doi.org/10.1074/jbc.272.36.22600" @default.
• W2129364047 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9278415" @default.
• W2129364047 hasPublicationYear "1997" @default.
• W2129364047 type Work @default.
• W2129364047 sameAs 2129364047 @default.
• W2129364047 citedByCount "57" @default.
• W2129364047 countsByYear W21293640472012 @default.
• W2129364047 countsByYear W21293640472013 @default.
• W2129364047 countsByYear W21293640472014 @default.
• W2129364047 countsByYear W21293640472015 @default.
• W2129364047 countsByYear W21293640472016 @default.
• W2129364047 countsByYear W21293640472017 @default.
• W2129364047 countsByYear W21293640472019 @default.
• W2129364047 countsByYear W21293640472020 @default.
• W2129364047 countsByYear W21293640472021 @default.
• W2129364047 countsByYear W21293640472022 @default.
• W2129364047 countsByYear W21293640472023 @default.
• W2129364047 crossrefType "journal-article" @default.
• W2129364047 hasAuthorship W2129364047A5008424026 @default.
• W2129364047 hasAuthorship W2129364047A5039488710 @default.
• W2129364047 hasAuthorship W2129364047A5057692069 @default.
• W2129364047 hasBestOaLocation W21293640471 @default.
• W2129364047 hasConcept C104317684 @default.
• W2129364047 hasConcept C107824862 @default.
• W2129364047 hasConcept C12554922 @default.
• W2129364047 hasConcept C170493617 @default.
• W2129364047 hasConcept C178790620 @default.
• W2129364047 hasConcept C185592680 @default.
• W2129364047 hasConcept C189165786 @default.
• W2129364047 hasConcept C2776362946 @default.
• W2129364047 hasConcept C2778122751 @default.
• W2129364047 hasConcept C519063684 @default.
• W2129364047 hasConcept C55493867 @default.
• W2129364047 hasConcept C86492073 @default.
• W2129364047 hasConcept C86803240 @default.
• W2129364047 hasConcept C95444343 @default.
• W2129364047 hasConceptScore W2129364047C104317684 @default.
• W2129364047 hasConceptScore W2129364047C107824862 @default.
• W2129364047 hasConceptScore W2129364047C12554922 @default.
• W2129364047 hasConceptScore W2129364047C170493617 @default.
• W2129364047 hasConceptScore W2129364047C178790620 @default.
• W2129364047 hasConceptScore W2129364047C185592680 @default.
• W2129364047 hasConceptScore W2129364047C189165786 @default.
• W2129364047 hasConceptScore W2129364047C2776362946 @default.
• W2129364047 hasConceptScore W2129364047C2778122751 @default.
• W2129364047 hasConceptScore W2129364047C519063684 @default.
• W2129364047 hasConceptScore W2129364047C55493867 @default.
• W2129364047 hasConceptScore W2129364047C86492073 @default.

• next