FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2129398220> ?p ?o ?g. }

• W2129398220 endingPage "32848" @default.
• W2129398220 startingPage "32843" @default.
• W2129398220 abstract "The complex between the photoreceptor-specific regulator of G protein signaling (RGS) protein, RGS9-1, and type 5 G protein β-subunit, Gβ5L, regulates the duration of the cellular response to light by stimulating the GTPase activity of G protein, transducin. An important property of RGS9-1·Gβ5L is that it interacts specifically with transducin bound to its effector, cGMP phosphodiesterase, rather than with transducin alone. The minimal structure within the RGS9-1·Gβ5L complex capable of activating transducin GTPase is the catalytic domain of RGS9. This domain itself is also able to discriminate between free and effector-bound transducin but to a lesser degree than RGS9-1·Gβ5L. The goal of this study was to determine whether other, noncatalytic domains of RGS9-1·Gβ5L enhance the intrinsic specificity of the catalytic domain or whether they set the specificity of RGS9-1·Gβ5L regardless of the specificity of its catalytic domain. We found that a double L353E/R360P amino acid substitution reversed the specificity of the recombinant catalytic domain but did not reverse the specificity of RGS9-1·Gβ5L. However, the degree of discrimination between free and effector-bound transducin was reduced. Therefore, noncatalytic domains of RGS9-1·Gβ5L play a decisive role in establishing its substrate specificity, yet the high degree of this specificity observed under physiological conditions requires an additional contribution from the catalytic domain. The complex between the photoreceptor-specific regulator of G protein signaling (RGS) protein, RGS9-1, and type 5 G protein β-subunit, Gβ5L, regulates the duration of the cellular response to light by stimulating the GTPase activity of G protein, transducin. An important property of RGS9-1·Gβ5L is that it interacts specifically with transducin bound to its effector, cGMP phosphodiesterase, rather than with transducin alone. The minimal structure within the RGS9-1·Gβ5L complex capable of activating transducin GTPase is the catalytic domain of RGS9. This domain itself is also able to discriminate between free and effector-bound transducin but to a lesser degree than RGS9-1·Gβ5L. The goal of this study was to determine whether other, noncatalytic domains of RGS9-1·Gβ5L enhance the intrinsic specificity of the catalytic domain or whether they set the specificity of RGS9-1·Gβ5L regardless of the specificity of its catalytic domain. We found that a double L353E/R360P amino acid substitution reversed the specificity of the recombinant catalytic domain but did not reverse the specificity of RGS9-1·Gβ5L. However, the degree of discrimination between free and effector-bound transducin was reduced. Therefore, noncatalytic domains of RGS9-1·Gβ5L play a decisive role in establishing its substrate specificity, yet the high degree of this specificity observed under physiological conditions requires an additional contribution from the catalytic domain. regulators of G protein signaling rod outer segments nickel-nitrilotriacetic acid the ninth member of the RGS protein family the catalytic domain of RGS9 RGS9d mutant bearing L353E/R360P mutations type 5 G protein β-subunit the long splice variant of Gβ5 the α-subunit of transducin RGS1 proteins regulate the duration of signaling in many G protein pathways (1Berman D.M. Gilman A.G. J. Biol. Chem. 1998; 273: 1269-1272Abstract Full Text Full Text PDF PubMed Scopus (444) Google Scholar, 2Burchett S.A. J. Neurochem. 2000; 75: 1335-1351Crossref PubMed Scopus (95) Google Scholar, 3Ross E.M. Wilkie T.M. Annu. Rev. Biochem. 2000; 69: 795-827Crossref PubMed Scopus (913) Google Scholar). They act by stimulating the GTP hydrolysis on G protein α-subunits, which results in termination of signaling events conferred by activated G proteins. All RGS proteins share a conservative catalytic domain of ∼130 amino acid residues capable of accelerating the GTP hydrolysis on G protein α-subunits (2Burchett S.A. J. Neurochem. 2000; 75: 1335-1351Crossref PubMed Scopus (95) Google Scholar). Many RGS proteins are also equipped with other, noncatalytic domains (3Ross E.M. Wilkie T.M. Annu. Rev. Biochem. 2000; 69: 795-827Crossref PubMed Scopus (913) Google Scholar). There are indications that these noncatalytic domains may participate in modulation of the RGS catalytic activity or may allow RGS proteins to interact with components of other intracellular pathways (reviewed in Ref. 4Siderovski D.P. Strockbine B. Behe C.I. Crit. Rev. Biochem. Mol. Biol. 1999; 34: 215-251Crossref PubMed Scopus (96) Google Scholar). Another putative role for the noncatalytic domains of RGS proteins is to contribute to the recognition of their specific G protein α-subunit targets. The idea that noncatalytic domains of RGS proteins may contribute to establishing the specificity in the RGS-G protein interactions is supported by several recent observations (5Posner B.A. Gilman A.G. Harris B.A. J. Biol. Chem. 1999; 274: 31087-31093Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar, 6He W., Lu, L.S. Zhang X., El Hodiri H.M. Chen C.K. Slep K.C. Simon M.I. Jamrich M. Wensel T.G. J. Biol. Chem. 2000; 275: 37093-37100Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar, 7Skiba N.P. Martemyanov K.A. Elfenbein A. Hopp J.A. Bohm A. Simonds W.F. Arshavsky V.Y. J. Biol. Chem. 2001; 276: 37365-37372Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). Understanding the molecular mechanisms conferring this specificity has been complicated by many reports that RGS proteins and especially their catalytic domains can stimulate the GTPase activity of a broad spectrum of G protein α-subunits in vitro. The phototransduction cascade from vertebrate photoreceptors provides a useful model for studying substrate specificity in RGS proteins. In this cascade, the complex between the short splice isoform of RGS9 (RGS9-1) and the long splice isoform of type 5 G protein β-subunit (Gβ5L) stimulates the GTPase activity of G protein, transducin (Gt). An important property of RGS9-1·Gβ5L is its selective interaction with activated Gαt bound to its effector, the γ-subunit of cGMP phosphodiesterase (PDEγ), rather than with free Gαt. The specific RGS9-1·Gβ5L interaction with the Gαt·PDEγ complex is possible, because the RGS9-1·Gβ5L affinity for Gαt·PDEγ is much higher than the affinity for free activated Gαt(8Skiba N.P. Hopp J.A. Arshavsky V.Y. J. Biol. Chem. 2000; 275: 32716-32720Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar). The ability to discriminate between Gαt and Gαt·PDEγ is documented not only for the full-length RGS9-1·Gβ5L but also for its catalytic domain (RGS9d) alone (6He W., Lu, L.S. Zhang X., El Hodiri H.M. Chen C.K. Slep K.C. Simon M.I. Jamrich M. Wensel T.G. J. Biol. Chem. 2000; 275: 37093-37100Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar, 7Skiba N.P. Martemyanov K.A. Elfenbein A. Hopp J.A. Bohm A. Simonds W.F. Arshavsky V.Y. J. Biol. Chem. 2001; 276: 37365-37372Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar,9He W. Cowan C.W. Wensel T.G. Neuron. 1998; 20: 95-102Abstract Full Text Full Text PDF PubMed Scopus (302) Google Scholar, 10Sowa M.E., He, W. Slep K.C. Kercher M.A. Lichtarge O. Wensel T.G. Nat. Struct. Biol. 2001; 8: 234-237Crossref PubMed Scopus (113) Google Scholar). This makes RGS9d unique among all other characterized RGS homology domains that show an opposite pattern of substrate discrimination interacting preferentially with free Gαt(10Sowa M.E., He, W. Slep K.C. Kercher M.A. Lichtarge O. Wensel T.G. Nat. Struct. Biol. 2001; 8: 234-237Crossref PubMed Scopus (113) Google Scholar, 11Nekrasova E.R. Berman D.M. Rustandi R.R. Hamm H.E. Gilman A.G. Arshavsky V.Y. Biochemistry. 1997; 36: 7638-7643Crossref PubMed Scopus (52) Google Scholar, 12McEntaffer R.L. Natochin M. Artemyev N.O. Biochemistry. 1999; 38: 4931-4937Crossref PubMed Scopus (25) Google Scholar). However, the degree of discrimination between Gαt and Gαt·PDEγ observed with RGS9d is much lower than that with the full-length RGS9-1·Gβ5L (∼2-foldversus ∼20-fold; see Ref. 7Skiba N.P. Martemyanov K.A. Elfenbein A. Hopp J.A. Bohm A. Simonds W.F. Arshavsky V.Y. J. Biol. Chem. 2001; 276: 37365-37372Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). This suggests that both catalytic and noncatalytic domains contribute to this important property of RGS9-1·Gβ5L. The interrelation between the catalytic and noncatalytic domains conferring RGS9-1·Gβ5L specificity could be explained by two alternative hypotheses. First, the specificity may be conferred exclusively by RGS9d with noncatalytic domains enhancing the degree of the specificity of the domain. Second, catalytic and noncatalytic domains may contribute to this specificity independently of one another so that the major contributor determines the specificity of the entire RGS9-1·Gβ5L complex. The goal of this study was to test these hypotheses. Our approach was to construct an RGS9d mutant that interacted preferentially with Gαt instead of Gαt·PDEγ and then to study the effects of the same mutations introduced into the full-length RGS9-1·Gβ5L. We found that the substrate specificity of mutant RGS9-1·Gβ5L was the same as that of the wild type protein. Yet mutant RGS9-1·Gβ5L discriminated between Gαt and Gαt·PDEγ to a lower degree than did the wild type. These data indicate that noncatalytic domains of RGS9-1·Gβ5L play a decisive role in establishing its substrate specificity, but the physiologically high degree of this specificity requires contributions from both catalytic and noncatalytic domains. ROS were isolated from frozen bovine retinas (TA & WL Lawson Co., Lincoln, NE) under infrared illumination as described (13McDowell J.H. Methods Neurosci. 1993; 15: 123-130Crossref Scopus (55) Google Scholar). Urea-treated ROS membranes lacking the activity of RGS9 were prepared using a two-step protocol (11Nekrasova E.R. Berman D.M. Rustandi R.R. Hamm H.E. Gilman A.G. Arshavsky V.Y. Biochemistry. 1997; 36: 7638-7643Crossref PubMed Scopus (52) Google Scholar). First, photoreceptor discs were purified from the ROS in the dark (14Smith H.G. Stubbs G.W. Litman B.J. Exp. Eye Res. 1975; 20: 211-217Crossref PubMed Scopus (202) Google Scholar). Second, the residual activity of RGS9 was inactivated by treating discs with 6 m urea for 30 min on ice (15Angleson J.K. Wensel T.G. J. Biol. Chem. 1994; 269: 16290-16296Abstract Full Text PDF PubMed Google Scholar). Urea was then removed by five consecutive washes of the discs with an isotonic buffer. Rhodopsin concentration in all ROS preparations was determined spectrophotometrically from the difference in absorbance at 500 nm before and after rhodopsin bleaching, using the molar extinction coefficient of 40,000 (16Bownds D. Gordon-Walker A. Gaide-Huguenin A.-C. Robinson W. J. Gen. Physiol. 1971; 58: 225-237Crossref PubMed Scopus (137) Google Scholar). Transducin was purified from bovine ROS as described (17Ting T.D. Goldin S.B. Ho Y.-K. Methods Neurosci. 1993; 15: 180-195Crossref Scopus (27) Google Scholar). Transducin concentration used in all calculations was determined based on the maximum amount of rhodopsin-catalyzed guanosine 5′-3-O-(thio)triphosphate binding performed as described (18Fung B.B.K. Hurley J.B. Stryer L. Proc. Natl. Acad. Sci. U. S. A. 1981; 78: 152-156Crossref PubMed Scopus (507) Google Scholar). PDEγ was prepared as described previously (19Slepak V.Z. Artemyev N.O. Zhu Y. Dumke C.L. Sabacan L. Sondek J. Hamm H.E. Bownds M.D. Arshavsky V.Y. J. Biol. Chem. 1995; 270: 14319-14324Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar). The PDEγ-(63–87) peptide was synthesized by the solid-phase Merrifield method on an automated peptide synthesizer and purified to homogeneity by reversed-phase high pressure liquid chromatography. Purity and chemical formula of the peptide were confirmed by mass spectrometry and analytical high pressure liquid chromatography. The mammalian expression vector pcDNA3 containing mouse RGS9-1 cDNA (20Makino E.R. Handy J.W., Li, T.S. Arshavsky V.Y. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 1947-1952Crossref PubMed Scopus (190) Google Scholar) was used as a template for PCR amplification of RGS9 cDNA. Mutations were introduced into the RGS9-1 gene using splicing by overlap extension PCR strategy (21Lefebvre B. Formstecher P. Lefebvre P. Biotechniques. 1995; 19: 186-188PubMed Google Scholar). Two overlapping DNA fragments were amplified in separate PCR reactions using either an upstream mutagenic primer TTCCTGGCCCCAGGTGCGCCGCGGTGGATC and downstream flanking primer containing a stop codon and EcoRI site or a downstream mutagenic primer CGCACCTGGGGCCAGGAACTCCTTGTAGAT and an upstream flanking primer containing a start codon and BamHI site. The resulting PCR products were purified, combined, and subjected to splicing PCR amplification in the presence of flanking primers described above. The PCR product with the size corresponding to the RGS9-1 coding region was treated with BamHI andEcoRI endonucleases and ligated with the large fragment of a modified baculovirus transfer vector pVL1392, digested with the same restriction enzymes (7Skiba N.P. Martemyanov K.A. Elfenbein A. Hopp J.A. Bohm A. Simonds W.F. Arshavsky V.Y. J. Biol. Chem. 2001; 276: 37365-37372Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). The integrity of the DNA sequence and incorporation of mutations were confirmed by sequencing. The resulting construct encoded recombinant RGS9-1 containing L353E and R360P mutations preceded by a His6 tag and thrombin cleavage site. The baculovirus expression construct encoding Gβ5L employed the mouse cDNAs ligated between the EcoRI andXbaI cloning sites in pVL1392. Gβ5L was modified by a M43L point mutation to block an internal translation initiation site (22Watson A.J. Aragay A.M. Slepak V.Z. Simon M.I. J. Biol. Chem. 1996; 271: 28154-28160Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar). These constructs were used to generate recombinant baculoviruses using a custom service provided by BD PharMingen. Positive viral clones were isolated by plaque assays followed by immunoblotting detection of the expressed RGS9-1 and Gβ5L constructs using specific antibodies (20Makino E.R. Handy J.W., Li, T.S. Arshavsky V.Y. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 1947-1952Crossref PubMed Scopus (190) Google Scholar). Plaque-isolated recombinant viruses were amplified to obtain high titer stocks (>108 plaque-forming units per ml). RGS9-1 and its mutant were co-expressed with Gβ5L in an Sf9/baculovirus expression system and purified as described previously (7Skiba N.P. Martemyanov K.A. Elfenbein A. Hopp J.A. Bohm A. Simonds W.F. Arshavsky V.Y. J. Biol. Chem. 2001; 276: 37365-37372Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). Purified RGS9-1·Gβ5L and its mutant were gel-filtrated on an NAP-10 column (Amersham Biosciences) equilibrated with a buffer containing 20 mm Tris-HCl (pH 8.0), 300 mm NaCl, 10 mm MgCl2, 1 mm dithiothreitol, and 10% glycerol. Aliquots were flash-frozen and stored at −80 °C without any significant loss of their functional activity. The purity of recombinant RGS9-1·Gβ5L proteins was no less than 80%. Their concentrations were measured spectrophotometrically based on the theoretically calculated values of the extinction coefficients at 280 nm. The Escherichia coli vector pGEX2T encoding wild type RGS9d in the form of a GST-His6-RGS9d fusion protein was a generous gift from T. G. Wensel (Baylor College of Medicine). To obtain mutant RGS9d the region of full-length mutant RGS9-1 encoding the RGS homology domain (between residues 284 and 431) was amplified by PCR with an upstream primer containing an NdeI site and a downstream primer containing a stop codon and EcoRI site. The PCR product was treated with the corresponding restriction endonucleases and cloned into the pGEX2TE. coli expression vector at the BamHI andEcoRI sites via a BamHI-NdeI linker coding for the His6 tag. The resulting construct contained the coding region for RGS9d bearing the L353E and R360P mutations (mRGS9d) fused with a gene encoding GST and an in-frame linker encoding the His6 tag. Both RGS9d and mRGS9d constructs were expressed in E. coli, and the proteins were purified as described for the full-length RGS9-1·Gβ5L proteins. Transducin GTPase activity was determined by using either a multiple turnover ([GTP] > [transducin]) or single turnover ([GTP] < [transducin]) technique as described previously (8Skiba N.P. Hopp J.A. Arshavsky V.Y. J. Biol. Chem. 2000; 275: 32716-32720Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar). The assays were conducted at room temperature (22–24 °C). Multiple turnover assays were conducted in a buffer containing 10 mm Tris-HCl (pH 7.8), 100 mm NaCl, 8 mm MgCl2, and 1 mm dithiothreitol. Single turnover assays were conducted in a buffer containing 25 mm Tris-HCl (pH 8.0), 250 mm NaCl, 10 mm MgCl2, and 1 mm dithiothreitol. The urea-treated ROS membranes, lacking endogenous activity of RGS9, were used as a source for photoexcited rhodopsin required for transducin activation in both assays. The reactions were started by the addition of 10 μl of either 0.6 μm (single turnover) or 600 μm (multiple turnover) [γ-32P]GTP (∼105disintegrations/min/sample) to 20 μl of urea-treated ROS membranes (60 μm final rhodopsin concentration for single turnover and 20 μm for multiple turnover assays) reconstituted with proteins of choice. The reaction was stopped by the addition of 100 μl of 6% perchloric acid. The32Pi formation was measured with activated charcoal as described (23Cowan C.W. Wensel T.G. Arshavsky V.Y. Methods Enzymol. 2000; 315: 524-538Crossref PubMed Google Scholar). All data fitting and statistical analyses were performed with SigmaPlot software, Version 6. The pull-down assays were conducted essentially as described previously (7Skiba N.P. Martemyanov K.A. Elfenbein A. Hopp J.A. Bohm A. Simonds W.F. Arshavsky V.Y. J. Biol. Chem. 2001; 276: 37365-37372Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). 10 μl of Ni-NTA agarose beads were equilibrated with the binding buffer containing 20 mm Tris-HCl (pH 8.0), 300 mm NaCl, 0.25% lauryl sucrose, and 50 μg/ml bovine serum albumin. The beads were then incubated on ice for 20 min with 50 μl of 5 μmHis6-tagged RGS9-1·Gβ5L or 50 μl of 2 μm RGS9d and then washed with 500 μl of the binding buffer. The washed beads were resuspended in either 50 μl of binding buffer (for RGS9-1·Gβ5L) or in 500 μl of binding buffer (for RGS9d) containing 1 μg of transducin. 10 mm NaF and 30 μm AlCl3 (yielding AlF4−) and/or PDEγ (1 μmfinal) were added when necessary. The full-length PDEγ rather than the PDEγ-(63–87) peptide was used in this assay to allow better transducin·PDEγ complex retention upon washing the agarose beads because of a higher affinity of Gαt for PDEγ than for PDEγ-(63–87). The samples were incubated on ice for 20 min with occasional shaking. The beads were spun down and washed twice with 1 ml of the binding buffer supplemented with 20 mm imidazole. 10 mm NaF and 30 μm AlCl3 were present when required. Bound Gαt was eluted from the beads with 40 μl SDS-PAGE sample buffer. 10-μl aliquots of the eluates were then subjected to SDS-PAGE. Gαt was detected using anti-Gαt1 rabbit polyclonal antibodies (Santa Cruz Biotechnology). Crucial for the design of an RGS9d mutant that would interact preferentially with free activated Gαt instead of Gαt·PDEγ were the findings by Sowa et al. (10Sowa M.E., He, W. Slep K.C. Kercher M.A. Lichtarge O. Wensel T.G. Nat. Struct. Biol. 2001; 8: 234-237Crossref PubMed Scopus (113) Google Scholar) that identified the amino acid residues responsible for substrate specificity of RGS7d (a catalytic domain of RGS7 related closely to RGS9). They have shown that normally RGS7d activates the GTPase of free Gαt better than that of the Gαt·PDEγ complex, but substituting only two residues within RGS7d for corresponding residues from RGS9d reverses the effect of PDEγ, from inhibition of the RGS7d activity to its stimulation. Following the same logic, we introduced reciprocal amino acid substitutions (L353E and R360P) into RGS9d with the expectation that this would also reverse the substrate specificity of RGS9d. Both mutant proteins were expressed as described under “Experimental Procedures,” and their substrate specificities were studied by a combination of GTPase activity measurements and pull-down assays. We first studied the effects of the L353E/R360P double mutation on the catalytic properties of RGS9d. The abilities of wild type RGS9d and mRGS9d to stimulate transducin GTPase in the presence and absence of PDEγ were analyzed under single turnover conditions (Fig. 1). In this method, transducin is allowed to perform a single synchronized turnover of GTP hydrolysis, the rate of which can be determined from the exponential analysis of its time course. In agreement with our prediction, PDEγ stimulated the activity of RGS9d but inhibited the activity of mRGS9d. The inhibition of mRGS9d by PDEγ was so strong that no reliable difference in the rates of GTP hydrolysis were detected in the assays conducted with transducin alone and transducin supplemented with 0.5 μm mRGS9d and excess PDEγ-(63–87). We then analyzed the dependence of transducin GTPase rate on mRGS9d concentration (Fig. 2) and found that the inhibitory effect of PDEγ-(63–87) was the strongest at low mRGS9d concentrations and gradually disappeared as the concentration of mRGS9d increased. This observation is consistent with the idea that the affinity of mRGS9d for Gαt is higher than for Gαt·PDEγ so that the maximal difference in the GTPase rates is observed at the lowest tested concentrations of participating proteins. Similarly, the stimulatory effect of PDEγ on the activity of wild type RGS9d diminished with increasing RGS9d concentration (see Fig. 2C from Ref. 7Skiba N.P. Martemyanov K.A. Elfenbein A. Hopp J.A. Bohm A. Simonds W.F. Arshavsky V.Y. J. Biol. Chem. 2001; 276: 37365-37372Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). An independent evidence that the L353E/R360P mutation acts by modulating the affinities of RGS9d to its substrates, Gαtand Gαt·PDEγ, was obtained in the pull-down assays with RGS9d or mRGS9d immobilized on Ni-NTA-agarose beads (Fig.3). As we reported previously (7Skiba N.P. Martemyanov K.A. Elfenbein A. Hopp J.A. Bohm A. Simonds W.F. Arshavsky V.Y. J. Biol. Chem. 2001; 276: 37365-37372Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar), PDEγ caused a small but reliable increase in the ability of Gαt activated by AlF4− to bind to immobilized RGS9d. The binding of activated Gαt to mRGS9d was much more efficient than its binding to RGS9d. However, in contrast to RGS9d, PDEγ reduced this binding significantly. We next compared the abilities of RGS9d and mRGS9d to activate transducin GTPase in the multiple turnover assays. In this method, transducin GTPase is measured in the presence of a small catalytic amount of RGS protein and varying amounts of transducin at the saturating concentration of GTP. The Michaelis analysis of the data, assuming RGS as the enzyme and Gαt as the substrate, yields the maximal rate of RGS protein turnover and the value of its apparent Michaelis constant for transducin. The experiment shown in Fig. 4 indicated that theVmax value for mRGS9d was ∼3-fold higher than that for RGS9d, and the Km value for mRGS9d was ∼1.6-fold lower than the value for RGS9d. Thus, mRGS9d not only binds to activated Gαt with higher affinity than does RGS9d (as also evident from Fig. 3), but it also stimulates its GTPase activity more efficiently. Note that we did not attempt to analyze the effects of PDEγ on the mRGS9d activity in the multiple turnover assays, because PDEγ causes a strong inhibition of transducin release from RGS9d after the completion of GTP hydrolysis making the Michaelis analysis inapplicable (7Skiba N.P. Martemyanov K.A. Elfenbein A. Hopp J.A. Bohm A. Simonds W.F. Arshavsky V.Y. J. Biol. Chem. 2001; 276: 37365-37372Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). The same inhibitory effect was observed with mRGS9d; data not shown. In summary, our data indicate that the L353E/R360P mutations in RGS9d reversed its substrate specificity. Unlike RGS9d, mRGS9d interacts more efficiently with Gαt than with the Gαt·PDEγ complex. An additional effect of the mutations was that the catalytic activity of mRGS9d was increased, as well. In the next series of experiments we introduced the L353E/R360P mutations into the full-length RGS9-1·Gβ5L and studied how they affect the substrate specificity of the entire complex. We used the same combination of kinetic and pull-down assays as in the experiments with mRGS9d. Single turnover measurements of transducin GTPase activity revealed that PDEγ potentiated the ability of mutant RGS9-1·Gβ5L to activate transducin GTPase (Fig 5). This is in striking contrast to the inhibitory effect of PDEγ on the activity of mRGS9d (Fig. 1). Moreover, PDEγ stimulated the activity of mutant and wild type RGS9-1·Gβ5L to the same absolute level. Yet the basal activity of the mutant observed in the absence of PDEγ was higher than the basal activity of the wild type. We next compared the catalytic parameters of wild type and mutant RGS9-1·Gβ5L in multiple turnover GTPase assays. As discussed in our previous studies (7Skiba N.P. Martemyanov K.A. Elfenbein A. Hopp J.A. Bohm A. Simonds W.F. Arshavsky V.Y. J. Biol. Chem. 2001; 276: 37365-37372Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar, 8Skiba N.P. Hopp J.A. Arshavsky V.Y. J. Biol. Chem. 2000; 275: 32716-32720Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar), this approach allows an application of Michaelis analysis to studying RGS9-1·Gβ5L activity with and without PDEγ. The experiment shown in Fig.6 demonstrates that in the presence of PDEγ the wild type and mutant RGS9-1·Gβ5L have very similar catalytic properties yielding practically identicalVmax and Km values. This is entirely consistent with the results of the single turnover assays. TheKm value for the mutant in the absence of PDEγ was ∼3-fold lower than the Km for the wild type RGS9-1·Gβ5L, consistent with a smaller effect of PDEγ observed in single turnover GTPase measurements. The Vmaxvalues measured for both proteins without PDEγ were somewhat different, but this difference was much smaller than that between theKm values. The difference in the Km values observed in the absence of PDEγ in Fig. 6 suggests that mutant RGS9-1·Gβ5L has a higher affinity for Gαt than the wild type protein. This was confirmed independently in the pull-down assays illustrated in Fig.7. In striking contrast to the data obtained with mRGS9d (Fig. 3), PDEγ increased the amount of Gαt retained on the beads with both wild type and mutant RGS9-1·Gβ5L. The retention of Gαt·PDEγ by the mutant and wild type RGS9-1·Gβ5L was practically the same, whereas the retention of free Gαt by the mutant was more significant than by the wild type RGS9-1·Gβ5L. This is also consistent with the Michaelis analysis of Fig. 6. RGS proteins regulate signal duration in a large array of G protein pathways. Each G protein signal has to be terminated at a physiologically appropriate time, which may vary in different cell types and individual pathways. The abundance of both RGS and G proteins raises the issue of specificity in their mutual recognition. Many studies attempted to establish the patterns of this specificity in vitro by analyzing the ability of individual RGS proteins to form complexes with various Gα-subunits or to stimulate their GTPase activity (reviewed in Refs. 3Ross E.M. Wilkie T.M. Annu. Rev. Biochem. 2000; 69: 795-827Crossref PubMed Scopus (913) Google Scholar and 24Cowan C.W., He, W. Wensel T.G. Prog. Nucleic Acids Res. Mol. Biol. 2000; 65: 341-359Crossref Google Scholar). In these studies, specificity was defined as the ability of RGS to form the tightest complex with a given G protein α-subunit and/or to stimulate its GTP hydrolysis to the highest extent. For example, RGS2 was found to bind selectively to Gq but not to Go (25Heximer S.P. Watson N. Linder M.E. Blumer K.J. Hepler J.R. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 14389-14393Crossref PubMed Scopus (304) Google Scholar), whereas RGS7 and RGS6 complexes with Gβ5 were shown to stimulate the GTP hydrolysis of Go much better than that of many other G protein α-subunits (see Ref. 5Posner B.A. Gilman A.G. Harris B.A. J. Biol. Chem. 1999; 274: 31087-31093Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar for additional examples). In contrast, some RGS proteins, like RGS4, seem to be rather nonspecific in interacting with their Gα partners (5Posner B.A. Gilman A.G. Harris B.A. J. Biol. Chem. 1999; 274: 31087-31093Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar, 26Lan K.L. Zhong H.L. Nanamori M. Neubig R.R. J. Biol. Chem. 2000; 275: 33497-33503Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar). The studies of G protein signaling in vertebrate phototransduction revealed significant limitations of this straightforward approach to defining RGS-G protein interaction specificity. In this cascade, RGS9-1·Gβ5L has to rapidly inactivate Gαt after it stimulates the activity of the effector, PDE. However, to deliver the signal to the effector with maximal efficiency, Gαtshould not be inactivated by RGS9-1·Gβ5L before it interacts with PDE (27Arshavsky V.Y. Pugh E.N., Jr. Neuron. 1998; 20: 11-14Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar, 28Tsang S.H. Burns M.E. Calvert P.D. Gouras P. Baylor D.A. Goff S.P. Arshavsky V.Y. Science. 1998; 282: 117-121Crossref PubMed Scopus (164) Google Scholar, 29Arshavsky V.Y. Lamb T.D. Pugh E.N., Jr. Annu. Rev. Physiol. 2002; 64: 153-187Crossref PubMed Scopus (478) Google Scholar). This is achieved by the intrinsic ability of RGS9-1·Gβ5L to discriminate between free activated Gαt and Gαt complexed with PDEγ. Thus the specificity of RGS9-1·Gβ5L in this pathway can be defined as its ability to discriminate between the two states of Gαtrather than its ability to select among different G protein α-subunits. Furthermore, an assessment of RGS9-1·Gβ5L specificity without considering the contribution from PDEγ is unlikely to reveal transducin as its specific partner (compare, for example, Fig. 7,lanes 2 and 3). Such clear understanding of the physiological function of the RGS9-1·Gβ5L makes this RGS protein a good model for studying how the specificity of its action is determined by the molecular organization of its structural domains. Specific recognition of the Gαt·PDE complex by RGS9-1·Gβ5L is achieved by a large difference between the RGS9-1·Gβ5L affinities for free activated Gαt and for Gαt·PDEγ. Both RGS9-1·Gβ5L and RGS9d display this difference in affinities, but RGS9-1·Gβ5L discriminates between its two substrates to a much higher degree than RGS9d (6He W., Lu, L.S. Zhang X., El Hodiri H.M. Chen C.K. Slep K.C. Simon M.I. Jamrich M. Wensel T.G. J. Biol. Chem. 2000; 275: 37093-37100Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar, 7Skiba N.P. Martemyanov K.A. Elfenbein A. Hopp J.A. Bohm A. Simonds W.F. Arshavsky V.Y. J. Biol. Chem. 2001; 276: 37365-37372Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar, 8Skiba N.P. Hopp J.A. Arshavsky V.Y. J. Biol. Chem. 2000; 275: 32716-32720Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar, 9He W. Cowan C.W. Wensel T.G. Neuron. 1998; 20: 95-102Abstract Full Text Full Text PDF PubMed Scopus (302) Google Scholar, 10Sowa M.E., He, W. Slep K.C. Kercher M.A. Lichtarge O. Wensel T.G. Nat. Struct. Biol. 2001; 8: 234-237Crossref PubMed Scopus (113) Google Scholar, 12McEntaffer R.L. Natochin M. Artemyev N.O. Biochemistry. 1999; 38: 4931-4937Crossref PubMed Scopus (25) Google Scholar). Two independent reports indicated that the action of essentially all noncatalytic domains of RGS9-1·Gβ5L is required for attaining this high degree of substrate discrimination (6He W., Lu, L.S. Zhang X., El Hodiri H.M. Chen C.K. Slep K.C. Simon M.I. Jamrich M. Wensel T.G. J. Biol. Chem. 2000; 275: 37093-37100Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar, 7Skiba N.P. Martemyanov K.A. Elfenbein A. Hopp J.A. Bohm A. Simonds W.F. Arshavsky V.Y. J. Biol. Chem. 2001; 276: 37365-37372Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). In our previous study (7Skiba N.P. Martemyanov K.A. Elfenbein A. Hopp J.A. Bohm A. Simonds W.F. Arshavsky V.Y. J. Biol. Chem. 2001; 276: 37365-37372Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar), we showed that noncatalytic domains act by making two opposite contributions to the affinities of RGS9-1·Gβ5L for Gαt and Gαt·PDEγ. The seven-bladed β-propeller core of Gβ5 associated with the G protein α subunit-like (GGL) domain of RGS9 reduces the affinity between RGS9 and Gαt, regardless of whether Gαt is free or is complexed with PDEγ. Three other domains, including disheveled/EGL-10/pleckstrin homology (DEP), the C terminus of RGS9, and the N terminus of Gβ5L, increase the RGS9 affinity for Gαt·PDEγ but not for free Gαt, thus counteracting the affinity reduction (or inhibition) imposed by GGL·Gβ5. The overall effect of these two affinity shifts of opposite direction is manifested in the ∼20-fold difference in the RGS9·Gβ5L affinities for free Gαtand Gαt·PDEγ. Thus, noncatalytic domains provide a major contribution to the overall specificity of RGS9-1·Gβ5L. What remained to be determined is whether noncatalytic domains act by enhancing the intrinsic specificity of the catalytic domain or whether they contribute to the overall RGS9-1·Gβ5L specificity independently. The primary role of RGS catalytic domains in activating G protein GTPase may argue for the former alternative. This argument is consistent with the observations that RGS9d is capable to interact preferentially with the Gαt·PDEγ complex whereas all other tested RGS proteins and their catalytic domains interact preferentially with free activated Gαt. Yet the experiments reported in this study indicate that the latter alternative is correct. We found that introduction of two point mutations, L353E and R360P, reversed the substrate specificity of RGS9d so that it interacted preferentially with free activated Gαt rather than Gαt·PDEγ. However, an introduction of the same mutations into the entire RGS9-1·Gβ5L complex did not reverse its specificity. Recent studies with RGS7·Gβ5, a protein complex sharing the overall domain organization with RGS9-1·Gβ5L, demonstrated that noncatalytic domains are likely to determine its specificity, as well. It has been shown that the catalytic domain of RGS7 stimulates the GTPase activities of Gαi and Gαo with equal efficiencies (26Lan K.L. Zhong H.L. Nanamori M. Neubig R.R. J. Biol. Chem. 2000; 275: 33497-33503Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar, 30Rose J.J. Taylor J.B. Shi J. Cockett M.I. Jones P.G. Hepler J.R. J. Neurochem. 2000; 75: 2103-2112Crossref PubMed Scopus (70) Google Scholar) whereas the full-length RGS7·Gβ5 complex stimulates the GTPase activity of only Gαo (5Posner B.A. Gilman A.G. Harris B.A. J. Biol. Chem. 1999; 274: 31087-31093Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar, 30Rose J.J. Taylor J.B. Shi J. Cockett M.I. Jones P.G. Hepler J.R. J. Neurochem. 2000; 75: 2103-2112Crossref PubMed Scopus (70) Google Scholar). Thus, the primary role of the noncatalytic domains of RGS9-1·Gβ5L in determining its substrate specificity is likely to reflect a general principle in RGS protein functioning. Although mutations in the catalytic domain did not affect the overall substrate specificity of RGS9-1·Gβ5L, the degree of substrate discrimination by the mutant RGS9-1·Gβ5L was reduced. Although both wild type and mutant RGS9-1·Gβ5L interacted with Gαt·PDEγ with the same affinity, the affinity of the mutant for free Gαtwas higher than that of the wild type (see Figs. 6 and 7). Specifically, the Km value for stimulating transducin GTPase by mutant RGS9-1·Gβ5L with PDEγ present was ∼6-fold lower than the value observed without PDEγ. A significantly larger ∼23-fold difference in the corresponding Kmvalues was observed for the wild type RGS9-1·Gβ5L. Thus, noncatalytic domains are sufficient to ensure specific recognition of Gαt by RGS9-1·Gβ5L, but the physiologically high degree of substrate discrimination requires an additional contribution from the catalytic domain. Interestingly, this contribution from the catalytic domain appears to reside in its relatively low ability to interact with free Gαt. Indeed, the L353E/R360P mutations “improved” the catalytic properties of RGS9d by both increasing its affinity for Gαt and providing for a higher catalytic activity (see Figs. 3 and 4). However, these improvements were not beneficial for establishing the physiologically relevant substrate specificity of RGS9-1·Gβ5L. Another important aspect of the mutagenesis conducted in this study is that it re-emphasizes the crucial role of the α5-α6 helices in the core of RGS catalytic domain in conferring its substrate specificity. McEntaffer et al. (12McEntaffer R.L. Natochin M. Artemyev N.O. Biochemistry. 1999; 38: 4931-4937Crossref PubMed Scopus (25) Google Scholar) found that the replacement of a larger region, between the α3 and α5 helices, in RGS16 with a corresponding region from RGS9 reversed the inhibition of RGS16 by PDEγ for moderate stimulation. They also showed that a reciprocal replacement within RGS9d reversed its PDEγ stimulation for inhibition. More recently, Sowa et al. (10Sowa M.E., He, W. Slep K.C. Kercher M.A. Lichtarge O. Wensel T.G. Nat. Struct. Biol. 2001; 8: 234-237Crossref PubMed Scopus (113) Google Scholar) identified several amino acid residues in RGS7, located at the end of α5 helix and in the loop connecting α5 and α6 helixes of the catalytic domain, that regulate directly the ability of RGS7d to stimulate transducin GTPase and to cooperate positively with PDEγ. These and our findings are consistent with the data from the crystal structure of the triple complex of RGS9d, Gαt/i chimeric protein, and PDEγ-(46–87) peptide (31Slep K.C. Kercher M.A., He, W. Cowan C.W. Wensel T.G. Sigler P.B. Nature. 2001; 409: 1071-1077Crossref PubMed Scopus (219) Google Scholar). In this structure, Leu-353 is located at the end of the α5 helix of RGS9d, and Arg-360 is located in the loop connecting α5 and α6 helices. This entire region interacts with both switch II of Gαt and PDEγ consistent with observations that mutations in this region result in significant changes in their interactions. In summary, our results support the idea that a high degree of substrate specificity of a multi-domain RGS protein can be achieved though synergistic contributions from all of its constituting domains. We thank P. L. Lishko, K. J. Strissel, P. D. Calvert, J. A. Hopp, and I. B. Leskov for critical comments on the manuscript and J. A. Hopp for obtaining transducin and ROS membrane preparations." @default.
• W2129398220 created "2016-06-24" @default.
• W2129398220 creator A5020344994 @default.
• W2129398220 creator A5061375714 @default.
• W2129398220 date "2002-09-01" @default.
• W2129398220 modified "2023-09-29" @default.
• W2129398220 title "Noncatalytic Domains of RGS9-1·Gβ5L Play a Decisive Role in Establishing Its Substrate Specificity" @default.
• W2129398220 cites W1570920566 @default.
• W2129398220 cites W1580328099 @default.
• W2129398220 cites W1584284659 @default.
• W2129398220 cites W1953109900 @default.
• W2129398220 cites W1977202617 @default.
• W2129398220 cites W1977493444 @default.
• W2129398220 cites W1993573303 @default.
• W2129398220 cites W1995686520 @default.
• W2129398220 cites W2004581292 @default.
• W2129398220 cites W2009380370 @default.
• W2129398220 cites W2010201306 @default.
• W2129398220 cites W2016221462 @default.
• W2129398220 cites W2016542329 @default.
• W2129398220 cites W2017344454 @default.
• W2129398220 cites W2036636551 @default.
• W2129398220 cites W2046715091 @default.
• W2129398220 cites W2050307742 @default.
• W2129398220 cites W2069629128 @default.
• W2129398220 cites W2073066701 @default.
• W2129398220 cites W2077856147 @default.
• W2129398220 cites W207883401 @default.
• W2129398220 cites W2084146022 @default.
• W2129398220 cites W2086892892 @default.
• W2129398220 cites W2087507879 @default.
• W2129398220 cites W2091240754 @default.
• W2129398220 cites W2102695020 @default.
• W2129398220 cites W2105594005 @default.
• W2129398220 cites W2111993777 @default.
• W2129398220 cites W957816523 @default.
• W2129398220 cites W967892197 @default.
• W2129398220 doi "https://doi.org/10.1074/jbc.m205170200" @default.
• W2129398220 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12093815" @default.
• W2129398220 hasPublicationYear "2002" @default.
• W2129398220 type Work @default.
• W2129398220 sameAs 2129398220 @default.
• W2129398220 citedByCount "21" @default.
• W2129398220 countsByYear W21293982202013 @default.
• W2129398220 countsByYear W21293982202019 @default.
• W2129398220 crossrefType "journal-article" @default.
• W2129398220 hasAuthorship W2129398220A5020344994 @default.
• W2129398220 hasAuthorship W2129398220A5061375714 @default.
• W2129398220 hasBestOaLocation W21293982201 @default.
• W2129398220 hasConcept C185592680 @default.
• W2129398220 hasConcept C18903297 @default.
• W2129398220 hasConcept C2777289219 @default.
• W2129398220 hasConcept C86803240 @default.
• W2129398220 hasConceptScore W2129398220C185592680 @default.
• W2129398220 hasConceptScore W2129398220C18903297 @default.
• W2129398220 hasConceptScore W2129398220C2777289219 @default.
• W2129398220 hasConceptScore W2129398220C86803240 @default.
• W2129398220 hasIssue "36" @default.
• W2129398220 hasLocation W21293982201 @default.
• W2129398220 hasOpenAccess W2129398220 @default.
• W2129398220 hasPrimaryLocation W21293982201 @default.
• W2129398220 hasRelatedWork W1531601525 @default.
• W2129398220 hasRelatedWork W1990781990 @default.
• W2129398220 hasRelatedWork W2606230654 @default.
• W2129398220 hasRelatedWork W2607424097 @default.
• W2129398220 hasRelatedWork W2748952813 @default.
• W2129398220 hasRelatedWork W2899084033 @default.
• W2129398220 hasRelatedWork W2948807893 @default.
• W2129398220 hasRelatedWork W2949325754 @default.
• W2129398220 hasRelatedWork W2949912922 @default.
• W2129398220 hasRelatedWork W2778153218 @default.
• W2129398220 hasVolume "277" @default.
• W2129398220 isParatext "false" @default.
• W2129398220 isRetracted "false" @default.
• W2129398220 magId "2129398220" @default.
• W2129398220 workType "article" @default.