FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2130057582> ?p ?o ?g. }

• W2130057582 endingPage "5967" @default.
• W2130057582 startingPage "5956" @default.
• W2130057582 abstract "Protein kinase A (PKA) has been suggested to be spatially regulated in migrating cells due to its ability to control signaling events that are critical for polarized actin cytoskeletal dynamics. Here, using the fluorescence resonance energy transfer-based A-kinase activity reporter (AKAR1), we find that PKA activity gradients form with the strongest activity at the leading edge and are restricted to the basal surface in migrating cells. The existence of these gradients was confirmed using immunocytochemistry using phospho-PKA substrate antibodies. This observation holds true for carcinoma cells migrating randomly on laminin-1 or stimulated to migrate on collagen I with lysophosphatidic acid. Phosphodiesterase inhibition allows the formation of PKA activity gradients; however, these gradients are no longer polarized. PKA activity gradients are not detected when a non-phosphorylatable mutant of AKAR1 is used, if PKA activity is inhibited with H-89 or protein kinase inhibitor, or when PKA anchoring is perturbed. We further find that a specific A-kinase anchoring protein, AKAP-Lbc, is a major contributor to the formation of these gradients. In summary, our data show that PKA activity gradients are generated at the leading edge of migrating cells and provide additional insight into the mechanisms of PKA regulation of cell motility. Protein kinase A (PKA) has been suggested to be spatially regulated in migrating cells due to its ability to control signaling events that are critical for polarized actin cytoskeletal dynamics. Here, using the fluorescence resonance energy transfer-based A-kinase activity reporter (AKAR1), we find that PKA activity gradients form with the strongest activity at the leading edge and are restricted to the basal surface in migrating cells. The existence of these gradients was confirmed using immunocytochemistry using phospho-PKA substrate antibodies. This observation holds true for carcinoma cells migrating randomly on laminin-1 or stimulated to migrate on collagen I with lysophosphatidic acid. Phosphodiesterase inhibition allows the formation of PKA activity gradients; however, these gradients are no longer polarized. PKA activity gradients are not detected when a non-phosphorylatable mutant of AKAR1 is used, if PKA activity is inhibited with H-89 or protein kinase inhibitor, or when PKA anchoring is perturbed. We further find that a specific A-kinase anchoring protein, AKAP-Lbc, is a major contributor to the formation of these gradients. In summary, our data show that PKA activity gradients are generated at the leading edge of migrating cells and provide additional insight into the mechanisms of PKA regulation of cell motility. Cell motility is controlled by a complex network of signals that are initiated by binding to the extracellular matrix. Understanding the biochemical mechanisms that control cell migration is necessary for better comprehension of processes like wound healing, embryonic development, and angiogenesis as well as cancer metastasis (1Lauffenburger D.A. Horwitz A.F. Cell. 1996; 84: 359-369Abstract Full Text Full Text PDF PubMed Scopus (3226) Google Scholar). PKA 3The abbreviations used are: PKA, protein kinase A; AKAP, A-kinase anchoring proteins; AKAR1, A-kinase activity reporter; FRET, fluorescence resonance energy transfer; Fc, sensitized acceptor emission or corrected FRET; PDE, phosphodiesterase; PKI, protein kinase inhibitor; RII, type II regulatory; NT, non-targeting; LPA, lysophosphatidic acid; PIPES, 1,4-piperazinediethane-sulfonic acid; CFP, cyan fluorescent protein; YFP, yellow fluorescent protein; siRNA, small interfering RNA; IBMX, isobutylmethylxanthine.3The abbreviations used are: PKA, protein kinase A; AKAP, A-kinase anchoring proteins; AKAR1, A-kinase activity reporter; FRET, fluorescence resonance energy transfer; Fc, sensitized acceptor emission or corrected FRET; PDE, phosphodiesterase; PKI, protein kinase inhibitor; RII, type II regulatory; NT, non-targeting; LPA, lysophosphatidic acid; PIPES, 1,4-piperazinediethane-sulfonic acid; CFP, cyan fluorescent protein; YFP, yellow fluorescent protein; siRNA, small interfering RNA; IBMX, isobutylmethylxanthine. is an important regulator of cell signaling and various biological functions (2Meinkoth J.L. Alberts A.S. Went W. Fantozzi D. Taylor S.S. Hagiwara M. Montminy M. Feramisco J.R. Mol. Cell. Biochem. 1993; 127-8: 179-186Crossref Scopus (123) Google Scholar, 3Taylor S. Knighton D.R. Zheng J. TenEyck L.F. Sowadski J.M. Faraday Discuss. 1992; 93: 143-153Crossref PubMed Google Scholar, 4Iyengar R. Science. 1996; 271: 461-463Crossref PubMed Scopus (120) Google Scholar). Previous studies have shown that cell motility is delicately controlled by synthesis and breakdown of cAMP through its effects on PKA. PKA regulates key signaling events that are critical for actin cytoskeletal remodeling and cell polarization during migration, including control of the activation states of RhoA, Rac, cdc42, Pak, and c-Abl. For example, PKA is known to inhibit the activation of RhoA, whereas it is required for the activation of Rac1, two proteins that are spatially regulated during cell migration. Therefore, it has been suggested that PKA activity in migrating cells is spatially regulated (5O'Connor K.L. Shaw L.M. Mercurio A.M. J. Cell Biol. 1998; 143: 1749-1760Crossref PubMed Scopus (136) Google Scholar, 6O'Connor K.L. Mercurio A.M. J. Biol. Chem. 2001; 276: 47895-47900Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar, 7Howe A.K. Baldor L.C. Hogan B.P. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 14320-14325Crossref PubMed Scopus (69) Google Scholar, 8Howe A.K. Biochim. Biophys. Acta. 2004; 1692: 159-174Crossref PubMed Scopus (250) Google Scholar, 9Goldfinger L.E. Han J. Kiosses W.B. Howe A.K. Ginsberg M.H. J. Cell Biol. 2003; 162: 731-741Crossref PubMed Scopus (102) Google Scholar). The mounting evidence for the formation of cAMP/PKA gradients and their influence over directed cell motility is compelling. To conclusively determine that PKA activity gradients exist, the visualization of these gradients in single cells is needed to determine the nature of gradients and the mechanisms governing how they are formed. The compartmental action of cAMP was suggested over three decades ago (10Corbin J.D. Sugden P.H. Lincoln T.M. Keely S.L. J. Biol. Chem. 1977; 252: 3854-3861Abstract Full Text PDF PubMed Google Scholar, 11Hayes J.S. Brunton L.L. J. Cyclic Nucleotide Res. 1982; 8: 1-16PubMed Google Scholar) and has hence been shown to mediate the precise spatiotemporal control of its effectors (12Jurevicius J. Fischmeister R. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 296-299Crossref Scopus (307) Google Scholar, 13Rich T.C. Fagan K.A. Tse T.E. Schaack J. Cooper D.M. Karpen J.W. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 13049-13054Crossref PubMed Scopus (239) Google Scholar, 14Wong W. Scott J.D. Nat. Rev. Mol. Cell Biol. 2004; 5: 959-970Crossref PubMed Scopus (836) Google Scholar, 15Zaccolo M. Magalhaes P. Pozzan T. Curr. Opin. Cell Biol. 2002; 14: 160-166Crossref PubMed Scopus (104) Google Scholar). Tight control of cAMP levels is governed by the coordinated actions of cyclic nucleotide phosphodiesterases (PDEs) and adenylyl cyclases. Gradients of cAMP and, thus, PKA activity are expected to exist in a cell. This idea is based, most simplistically, on the fact that cAMP is generated by membrane-bound adenylyl cyclases and broken down by cytosolic PDEs; that is, the two arms of cAMP metabolism are spatially separated. Further compartmentalization of PKA activity also occurs as a result of the anchoring of PKA and cAMP-specific PDEs to A-kinase anchoring proteins (AKAPs), which has been demonstrated in a variety of cell types (16Dodge K.L. Khouangsathiene S. Kapiloff M.S. Mouton R. Hill E.V. Houslay M.D. Langeberg L.K. Scott J.D. EMBO J. 2001; 20: 1921-1930Crossref PubMed Scopus (394) Google Scholar, 17Taskén K.A. Collas P. Kemmner W.A. Witczak O. Conti M. Taskén K. J. Biol. Chem. 2001; 276: 21999-22002Abstract Full Text Full Text PDF PubMed Scopus (202) Google Scholar). The anchoring of PKA occurs typically through the binding of the type II regulatory (RII) subunits to AKAPs where the relative levels of PDE activity and cAMP generated regulate the regional activity of PKA. PKA anchoring, in addition to cAMP synthesis and degradation, is believed to control spatial signaling of PKA (14Wong W. Scott J.D. Nat. Rev. Mol. Cell Biol. 2004; 5: 959-970Crossref PubMed Scopus (836) Google Scholar, 15Zaccolo M. Magalhaes P. Pozzan T. Curr. Opin. Cell Biol. 2002; 14: 160-166Crossref PubMed Scopus (104) Google Scholar). Until recently, we have lacked both the model systems and technology to adequately study the possibility that cAMP/PKA activity gradients exist. We and others (5O'Connor K.L. Shaw L.M. Mercurio A.M. J. Cell Biol. 1998; 143: 1749-1760Crossref PubMed Scopus (136) Google Scholar, 6O'Connor K.L. Mercurio A.M. J. Biol. Chem. 2001; 276: 47895-47900Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar, 7Howe A.K. Baldor L.C. Hogan B.P. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 14320-14325Crossref PubMed Scopus (69) Google Scholar, 8Howe A.K. Biochim. Biophys. Acta. 2004; 1692: 159-174Crossref PubMed Scopus (250) Google Scholar) have established that polarization and migration of cells are dependent on cAMP synthesis and breakdown. Here, we sought to demonstrate the existence of cAMP/PKA gradients in single migrating cells using the fluorescence resonance energy transfer (FRET)-based PKA biosensor A-kinase activity reporter (AKAR1) and determine how signaling components that regulate PKA activity, including cAMP synthesis, PDEs, and PKA anchoring, affect the formation of these gradients. Cell Transfection and Treatments—Clone A colon carcinoma cells were grown to 70% confluence in RPMI plus 10% fetal calf serum before transfection with AKAR1, a non-phosphorylatable (S475A) mutant of AKAR1 (courtesy of Dr. Jin Zhang, Department of Pharmacology, Johns Hopkins University) (18Zhang J. Ma Y. Taylor S.S. Tsien R.Y. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 14997-15002Crossref PubMed Scopus (482) Google Scholar), pECFP only, or pEYFP (BD Biosciences) constructs (16 μg/10-cm dish) using Lipofectamine™ 2000 reagent (Invitrogen). At 24 h post-transfection cells were detached by trypsinization and washed 3 times with RPMI medium containing 0.25 mg/ml bovine serum albumin. Cells (1 × 106 cells/ml) were treated for 30 min with either 1 mm IBMX, 25 μm forskolin, 15 μm H-89, or 20 μm myristoylated protein kinase inhibitor (PKI) or for 5 min with 5 μm stHt31 or stHt31P (negative control for stHt31) as indicated. Cells were then plated onto coverslips coated with laminin-1 (10 μg/ml) in the presence of drug for 55 min at 37 °C. Cells were then fixed for 20 min at room temperature with 4% paraformaldehyde, 10 mm PIPES, pH 6.8, 2 mm EGTA, 2 mm MgCl2, 7% sucrose, 100 mm KCl, 50 mm NaF, and 10 mm sodium pyrophosphate. Coverslips were then mounted with MOWIOL mounting medium (Calbiochem). Cells with recombinant protein expression levels high enough to give good fluorescence signal in lamellae were chosen for analysis. For experiments using MDA-MB-231 cells, cells were grown to 70% confluence, suspended by trypsinization, and plated onto collagen-coated coverslips in serum-free Dulbecco's modified Eagle's medium containing 0.25 mg/ml of bovine serum albumin for 2-3 h. Cells were then stimulated with 100 nm lysophosphatidic acid (LPA) for 15 min or left untreated before fixation. FRET Image Collection—Images were obtained using a Zeiss LSM-510 META confocal microscope with a 63×, 1.4 numerical aperture oil immersion objective (Optical Imaging Laboratory, University of Texas Medical Branch). The images where collected using two lines of excitation (458 and 514 nm, argon ion laser) and two different channels of emission. The intensity of fluorescence of cyan fluorescent protein (CFP) after CFP excitation at 458 nm (donor signal, IDD) was obtained using a 470-500-nm bandpass filter. The intensity of fluorescence of yellow fluorescent protein (YFP; acceptor signal, IAA) after excitation of YFP at 514 nm and the fluorescence intensity of FRET signal (raw FRET signal, IDA) after excitation at 458 nm were measured using a 530-570-nm filter. All images were collected using 4-frame Kallman-averaging with a pixel time of 1.60 μs, a pixel size of 90 × 90 nm (scan zoom of 2 and a frame size of 792 × 792 pixels), and an optical slice of 0.8 μm. Because of the cell to cell variability of AKAR1 expression levels, the detector gains and the amplifier offsets were adjusted as needed to maximize the range of signal for each channel; however, the ratios between the gains of the three channels were kept constant. For each imagining session, the same collection conditions were used for cells expressing AKAR1 constructs, YFP, or CFP. Image Processing—Images were imported into Metamorph software (Molecular Devices, Downingtown, PA) for processing. Initially, background was subtracted from all images based on the signal of non-cellular regions, and a low-pass filter was applied using a 5 × 5 kernel to improve the signal-to-noise ratio (19van Rheenen J. Langeslag M. Jalink K. Biophys. J. 2004; 86: 2517-2529Abstract Full Text Full Text PDF PubMed Scopus (171) Google Scholar). To obtain a corrected FRET image (Fc), we processed the raw FRET image (IDA) to compensate for nonspecific signals in the FRET channel, such as channel cross-talk due to the spectral overlap between CFP and YFP, defined by the equation Fc = IDA-aIAA-dIDD (20Gordon G.W. Berry G. Liang X.H. Levine B. Herman B. Biophys. J. 1998; 74: 2702-2713Abstract Full Text Full Text PDF PubMed Scopus (711) Google Scholar, 21Youvan D.C. Coleman W.J. Silva C.M. Petersen J. Bylina E.J. Yang M.M. Biotechnology et alia. 1997; 1: 1-16Google Scholar, 22Tron L. Szollosi J. Damjanovich S. Helliwell S.H. Arndt-Jovin D.J. Jovin T.M. Biophys. J. 1984; 45: 939-946Abstract Full Text PDF PubMed Scopus (180) Google Scholar), where a and d represent cross-talk correction coefficients. The Fc values were then divided by the acceptor emission after direct acceptor excitation (IAA) yielding the normalized FRET index (Fc/YFP), as proposed by van Rheenen et al. (19van Rheenen J. Langeslag M. Jalink K. Biophys. J. 2004; 86: 2517-2529Abstract Full Text Full Text PDF PubMed Scopus (171) Google Scholar), which permitted the acquisition of higher resolution images under the conditions used here. These calculations correct for nonspecific signals present in specified channels, normalize for expression of the reporter construct throughout the cell, and render a FRET index independent of laser fluctuations (23Zal T. Gascoigne N.R. Biophys. J. 2004; 86: 3923-3939Abstract Full Text Full Text PDF PubMed Scopus (305) Google Scholar). The cross-talk coefficients (a and d) were calculated using images collected from cells expressing either CFP (donor) or YFP (acceptor) alone. Coefficient a was obtained from the ratio of IDA over IAA for acceptor-only samples, whereas the coefficient d was obtained from the ratio of IDA over IDD for donor-only samples. For each imaging session, averages of coefficients a and d were calculated from at least 25 non-saturated regions using at least two different cells and three different sets of gains (note that there was no significant difference noted between the coefficients calculated at the different gains provided that the ratio between the gain intensities for the individual channels was kept constant). The constants were then used to calculate sensitized emission of the Fc for images collected on the same day. The Fc values were then normalized to the local concentration of construct using acceptor emission and reported as a ratio (Fc/YFP) as reported previously (19van Rheenen J. Langeslag M. Jalink K. Biophys. J. 2004; 86: 2517-2529Abstract Full Text Full Text PDF PubMed Scopus (171) Google Scholar). For each cell analyzed, the average pixel intensity of Fc/YFP signal versus distance in microns was plotted such that the last distance point represents the edge of the cell, which represents the FRET gradient. For experiments involving siRNA-treated cells, the slopes of multiple line scans were calculated, averaged, and reported in a histogram plot (untreated, n = 20; non-targeting siRNA, n = 19; AKAP-Lbc siRNA number 3, n = 11, and number 5, n = 9). The slopes were taken from the last 90 pixels (equivalent to 8 μm) of each line scan, where the gradients of Fc/YFP are consistently found in untreated cells. This approach was used to standardize the distance analyzed from the leading edge to the cell body and to avoid selection bias. For all data cells shown represent cells from at least two coverslips and a minimum of three separate experiments. PKA Assays—Active PKA was assessed by pseudosubstrate affinity precipitation of cell lysates, as described (24Paulucci-Holthauzen A.A. O'Connor K.L. Anal. Biochem. 2006; 355: 175-182Crossref PubMed Scopus (6) Google Scholar). Briefly, cells were plated on laminin-coated dishes in the presence of select inhibitors and then harvested in a hypotonic buffer and gently sonicated. A portion of cleared lysates (1 part) was set aside as a loading control, and the remaining lysate (10 parts) was incubated with beads conjugated to glutathione S-transferase-PKI fusion protein for 30 min at 4 °C and then rinsed. Glutathione S-transferase-PKI (active)-bound PKA and lysate controls (10% total) were then immunoblotted for the PKA catalytic subunit (BD Transduction Laboratories). Several exposures were analyzed and quantified by digital capture of luminescence using a Fluorochem™ 8900 luminescent imager (Alpha Innotech) to ensure that signals remain in the linear range. Small Interference RNA Treatment—Suspended cells (3 × 106) were electroporated with 16 μg of AKAR1 alone or in conjunction with 200 nm siRNA specific for AKAP-Lbc (AKAP13) or a control (non-targeting) sequence (Dharmacon, Inc.) as reported previously (25Chen M. O'Connor K.L. Oncogene. 2005; 24: 5125-5130Crossref PubMed Scopus (96) Google Scholar). Individual sequences for AKAP-Lbc are UCAACAGACUCACUAAAUAUU (number 3) and GGAAGAAGCUUGUACGUGAUU (number 5). Cells were then kept in normal growth medium for 48 h and then assessed for target gene expression using immunoblot analysis, PKA-FRET, or cell migration. Immunoblotting—Cells were harvested using radioimmune precipitation assay buffer (150 mm NaCl, 0.5 mm EGTA, 0.5% sodium deoxycholate, 0.1% SDS, 1% Triton X-100, 50 mm Tris-HCl, pH 7.4) containing 15 μg/ml protease inhibitor mixture (Sigma Aldrich) and 1 mm phenylmethanesulfonyl fluoride. Total protein was then electrophoresed on a 7.5% SDS-PAGE and transferred to nitrocellulose. The membrane was cut, blocked with 5% nonfat dry milk, and then probed for either AKAP-Lbc (1:5000 dilution, rabbit polyclonal, VO-96, supplied by Dr. Ben Pedroja, Vollum Institute/OHSU) or β-tubulin (1:1000 dilution, rat monoclonal antibody 1864, Chemicon). Migration Assays—For laminin haptotaxis assays the lower compartments of Transwell chambers (6.5-mm diameter, 8-μm pore size; Costar) were coated with 15 μg/ml laminin-1. Cells (1 × 105) suspended in RPMI/bovine serum albumin were added to the upper chamber and incubated at 37 °C for 4 h. Cells were removed from the upper chamber with a cotton swab, and migrated cells on the lower membrane surface were fixed, stained with crystal violet, and quantified visually as described previously (26O'Connor K.L. Nguyen B.-K. Mercurio A.M. J. Cell Biol. 2000; 148: 253-258Crossref PubMed Scopus (180) Google Scholar). Immunocytochemistry—Cells were fixed for 10 min at room temperature with 4% paraformaldehyde, 10 mm PIPES, pH 6.8, 2 mm EGTA, 2 mm MgCl2, 7% sucrose, 100 mm KCl, 50 mm NaF, and 10 mm sodium pyrophosphate, rinsed in phosphate-buffered saline (PBS) for 20 min, permeabilized with 0.5% Triton X-100 in PBS, and then rinsed. Cells were incubated in block solution (3% bovine serum albumin, 1% normal goat serum in phosphate-buffered saline) for 30 min and then incubated overnight with 1:100 dilution of phospho-PKA substrate (RRXS/T) monoclonal antibody (100G7, Cell Signaling Technologies) in block solution at 4 °C. After three 10-min phosphate-buffered saline washes, cells were incubated with either Alexa 594- or Alexa 488-conjugated secondary, rinsed, mounted with MOWIOL mounting medium (Calbiochem), and imaged by confocal microscopy. Statistics—Pairwise comparisons between AKAR-transfected versus each of the non-targeting (NT) and siRNA groups were carried out using the two-sample t test. Normality and equal variance assumptions were assessed, and log transformation was employed as necessary before conduct of the parametric tests. To determine the spatial distribution of PKA activity in migrating cells, we utilized the previously characterized AKAR1 single-molecule FRET sensor (18Zhang J. Ma Y. Taylor S.S. Tsien R.Y. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 14997-15002Crossref PubMed Scopus (482) Google Scholar). AKAR1 contains a modified Kemptide sequence that can be phosphorylated by PKA and the phosphoamino acid binding domain of 14-3-3τ, which binds to this phosphorylated sequence. These domains are flanked by CFP and YFP that display FRET upon binding of the phosphorylated Kemptide sequence to the 14-3-3τ domain, thereby indicating where PKA is active. The FRET emitted by this construct is initiated by PKA and is likely terminated by an uncharacterized phosphatase. Thus, this signal represents the lifetime of phosphate for a single type of PKA substrate. As a cell model for assessing the nature of PKA activity gradients during migration, we utilize the cAMP-sensitive Clone A migration model. Clone A cells adhere to and migrate randomly on laminin-1 by signaling through the α2β1 and α6β4 integrins (27Rabinovitz I. Mercurio A.M. J. Cell Biol. 1997; 139: 1873-1884Crossref PubMed Scopus (201) Google Scholar). Migrating Clone A cells form a polarized morphology in which the leading edge is marked with a ruffling lamellipodium. Time-lapse videomicroscopic analysis of these cells shows that cells migrate in a forward direction toward the lamellipodial ruffle. If multiple lamellipodia are present, one will eventually become dominant, and the cell will move in the direction of the new dominant lamellae (data not shown). Therefore, we are able to identify migrating cells by the presence of a lamellipodial ruffle which signifies the leading edge and retraction fibers at the trailing edge. To determine the spatial distribution of cAMP/PKA activity, Clone A cells transfected with either AKAR1, a non-phosphorylatable mutant (S475A) of AKAR1, CFP-only, or YFP-only constructs were allowed to migrate on laminin-1 and then fixed. Lamellar area quantification of cells transfected with AKAR1 and untreated cells notably shows that cells expressing the AKAR1 construct display no differences in morphology when compared with untreated cells (n for each condition equals 20; data not shown). Cells expressing levels of construct sufficient for good resolution of fluorescent signal in the lamellar region were then imaged using a confocal microscope with a three-filter set for the determination of sensitized acceptor emission or corrected FRET (Fc) (20Gordon G.W. Berry G. Liang X.H. Levine B. Herman B. Biophys. J. 1998; 74: 2702-2713Abstract Full Text Full Text PDF PubMed Scopus (711) Google Scholar, 21Youvan D.C. Coleman W.J. Silva C.M. Petersen J. Bylina E.J. Yang M.M. Biotechnology et alia. 1997; 1: 1-16Google Scholar), as detailed under “Experimental Procedures.” Correction coefficients for bleed-through were calculated from cells transfected with CFP or YFP alone. This method of obtaining FRET values has been proven to generate high resolution images (20Gordon G.W. Berry G. Liang X.H. Levine B. Herman B. Biophys. J. 1998; 74: 2702-2713Abstract Full Text Full Text PDF PubMed Scopus (711) Google Scholar, 28Oliveria S.F. Gomez L.L. Dell'Acqua M.L. J. Cell Biol. 2003; 160: 101-112Crossref PubMed Scopus (107) Google Scholar) that are independent of the photoconversion of YFP into CFP-like species that occurs during acceptor photobleaching experiments (29Valentin G. Verheggen C. Piolot T. Neel H. Coppey-Moisan M. Bertrand E. Nat. Methods. 2005; 2: 801Crossref PubMed Scopus (96) Google Scholar). The Fc value was then normalized to the local concentration of construct and reported as a ratio with acceptor emissions (Fc/YFP) as previously suggested (19van Rheenen J. Langeslag M. Jalink K. Biophys. J. 2004; 86: 2517-2529Abstract Full Text Full Text PDF PubMed Scopus (171) Google Scholar), permitting a more accurate read-out for PKA activity. Under wide-field optics, the larger volume and, thus, higher fluorescence within the cell body caused light scattering that prevented definition of cell borders and lamellar structures. Therefore, confocal analysis was necessary to obtain proper resolution. As shown in Fig. 1A, Clone A cells induced to migrate on laminin-1 show a higher Fc/YFP signal within lamellae with a marked gradient of increasing intensity culminating at the leading edge, indicating higher PKA activity in this region and the presence of a gradient of PKA activity (representative of 14 of 15 cells imaged). Further analysis of line scans within the image show graphically that the Fc/YFP ratio increases dramatically in the lamellae area, demonstrating that PKA activity is spatially distributed within the cell during migration. To confirm that the observed gradients in Fc/YFP signal are specific to PKA activity and not a result of cell processing, image handling, or phosphorylation of AKAR1 from another kinase, several controls were performed. Initially, cells were transfected with the S475A mutant of AKAR1 that cannot be phosphorylated by PKA and, therefore, should not emit FRET as demonstrated previously (18Zhang J. Ma Y. Taylor S.S. Tsien R.Y. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 14997-15002Crossref PubMed Scopus (482) Google Scholar). Cells plated on laminin-1 that were chosen for analysis were morphologically similar to those expressing the AKAR1 construct and were processed in an identical manner. In Fig. 1B we show that cells expressing the S475A mutant construct displayed very low FRET and were devoid of any apparent gradient in the residual signal, as shown by the Fc/YFP panels (representative of 7 of 7 cells analyzed) and line scan graphics and region analysis. Next, we sought to confirm that the FRET signal observed was specific and a direct result of PKA activity. For these experiments we treated AKAR1-expressing cells with PKA-specific inhibitors, H-89, and the naturally occurring PKI before and during migration on laminin-1. Clone A cells are unique in the fact that they continue to form lamellae and membrane ruffles under conditions in which PKA is inhibited, as they utilize RhoA for these processes and not Rac1 (26O'Connor K.L. Nguyen B.-K. Mercurio A.M. J. Cell Biol. 2000; 148: 253-258Crossref PubMed Scopus (180) Google Scholar), which requires PKA activity to function (6O'Connor K.L. Mercurio A.M. J. Biol. Chem. 2001; 276: 47895-47900Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar, 7Howe A.K. Baldor L.C. Hogan B.P. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 14320-14325Crossref PubMed Scopus (69) Google Scholar, 30Dormond O. Bezzi M. Mariotti A. Ruegg C. J. Biol. Chem. 2002; 277: 45838-45846Abstract Full Text Full Text PDF PubMed Scopus (142) Google Scholar). Therefore, the contributions of PKA to the FRET signal in AKAR1-expressing cells can still be monitored in lamellar structures. Here, we find that cells treated with H-89 (Fig. 1C; representative of 10-12 cells imaged) or PKI (Fig. 1D; representative of 7 of 9 cells imaged) show minimal FRET and no PKA activity gradients similar to cells expressing the S475A AKAR1 mutant. Notably, the PKA activity gradients are present predominantly in the lamellae (∼0.1 μm in thickness) where the cell volume is less than the optical sections taken within the cell body (0.8 μm thick). To confirm that our results are not a consequence of changes in the intracellular concentration of AKAR1 or the shallow depth at the periphery, we performed region analysis of cells. Regions 1 and 2 where chosen to contain similar YFP intensities where region 1 is present in the cell body and region 2 is found near the leading edge. Region 3 was chosen at the leading edge and contains the same area as regions 1 and 2. As shown in the histograms in Fig. 1A, we observe that region 2 contains an increased average Fc/YFP intensity compared with region 1 in untreated cells. Region 3 in these cells displays even higher Fc/YFP intensity, thus confirming the presence of a gradient. In contrast, the S475 construct-transfected cells or H89 or PKI-treated cells show no change or a decrease in FRET intensity between regions. Collectively, these data confirm that the FRET signal detected with AKAR1 in migrating cells is specifically due to the PKA phosphorylation of the AKAR1 construct and is in agreement with the specificity demonstrated by the original characterization of AKAR1 (18Zhang J. Ma Y. Taylor S.S. Tsien R.Y. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 14997-15002Crossref PubMed Scopus (482) Google Scholar). To determine whether PKA activity gradients exist vertically within the lamellipodium, we analyzed serial confocal sections of migrating Clone A cells expressing the AKAR1 construct at 0.2-μm intervals. As depicted in Fig. 2, the gradients are found primarily within the basal most section. These data demonstrate that the PKA activity gradients are tightly associated with the basal plasma membrane within close proximity to the regions where new integrin contacts are being made during the migratory process. These observations suggest that cAMP/activated PKA gradi" @default.
• W2130057582 created "2016-06-24" @default.
• W2130057582 creator A5009510786 @default.
• W2130057582 creator A5016380606 @default.
• W2130057582 creator A5033799076 @default.
• W2130057582 creator A5048594811 @default.
• W2130057582 creator A5066002550 @default.
• W2130057582 creator A5081619370 @default.
• W2130057582 date "2009-02-01" @default.
• W2130057582 modified "2023-10-16" @default.
• W2130057582 title "Spatial Distribution of Protein Kinase A Activity during Cell Migration Is Mediated by A-kinase Anchoring Protein AKAP Lbc" @default.
• W2130057582 cites W1236053900 @default.
• W2130057582 cites W1485823898 @default.
• W2130057582 cites W1490352408 @default.
• W2130057582 cites W1511836437 @default.
• W2130057582 cites W1530102523 @default.
• W2130057582 cites W1568955905 @default.
• W2130057582 cites W1575134115 @default.
• W2130057582 cites W1960862471 @default.
• W2130057582 cites W1964145620 @default.
• W2130057582 cites W1967265143 @default.
• W2130057582 cites W1977109399 @default.
• W2130057582 cites W1977874249 @default.
• W2130057582 cites W1977892054 @default.
• W2130057582 cites W2001953889 @default.
• W2130057582 cites W2003891723 @default.
• W2130057582 cites W2004169102 @default.
• W2130057582 cites W2006003203 @default.
• W2130057582 cites W2015467981 @default.
• W2130057582 cites W2015557754 @default.
• W2130057582 cites W2016312253 @default.
• W2130057582 cites W2018606077 @default.
• W2130057582 cites W2024732013 @default.
• W2130057582 cites W2028653056 @default.
• W2130057582 cites W2029799527 @default.
• W2130057582 cites W2032906293 @default.
• W2130057582 cites W2034839112 @default.
• W2130057582 cites W2039854741 @default.
• W2130057582 cites W2053144857 @default.
• W2130057582 cites W2059822315 @default.
• W2130057582 cites W2064965146 @default.
• W2130057582 cites W2068281228 @default.
• W2130057582 cites W2068879726 @default.
• W2130057582 cites W2068924803 @default.
• W2130057582 cites W2070212643 @default.
• W2130057582 cites W2078403132 @default.
• W2130057582 cites W2090687717 @default.
• W2130057582 cites W2110193578 @default.
• W2130057582 cites W2110610061 @default.
• W2130057582 cites W2111555671 @default.
• W2130057582 cites W2114633481 @default.
• W2130057582 cites W2115202118 @default.
• W2130057582 cites W2123066014 @default.
• W2130057582 cites W2126920991 @default.
• W2130057582 cites W2127669953 @default.
• W2130057582 cites W2128331958 @default.
• W2130057582 cites W2139655221 @default.
• W2130057582 cites W2139879939 @default.
• W2130057582 cites W2140960985 @default.
• W2130057582 cites W2141266158 @default.
• W2130057582 cites W2141340524 @default.
• W2130057582 cites W2144491728 @default.
• W2130057582 cites W2148910944 @default.
• W2130057582 cites W2157512279 @default.
• W2130057582 cites W2158713438 @default.
• W2130057582 cites W2158962985 @default.
• W2130057582 cites W2159804098 @default.
• W2130057582 cites W2165899646 @default.
• W2130057582 cites W2166632668 @default.
• W2130057582 cites W2168094164 @default.
• W2130057582 cites W2168960379 @default.
• W2130057582 cites W2171530560 @default.
• W2130057582 cites W2346147167 @default.
• W2130057582 doi "https://doi.org/10.1074/jbc.m805606200" @default.
• W2130057582 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/2645839" @default.
• W2130057582 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/19106088" @default.
• W2130057582 hasPublicationYear "2009" @default.
• W2130057582 type Work @default.
• W2130057582 sameAs 2130057582 @default.
• W2130057582 citedByCount "53" @default.
• W2130057582 countsByYear W21300575822012 @default.
• W2130057582 countsByYear W21300575822013 @default.
• W2130057582 countsByYear W21300575822014 @default.
• W2130057582 countsByYear W21300575822015 @default.
• W2130057582 countsByYear W21300575822016 @default.
• W2130057582 countsByYear W21300575822017 @default.
• W2130057582 countsByYear W21300575822018 @default.
• W2130057582 countsByYear W21300575822019 @default.
• W2130057582 countsByYear W21300575822020 @default.
• W2130057582 countsByYear W21300575822021 @default.
• W2130057582 countsByYear W21300575822022 @default.
• W2130057582 crossrefType "journal-article" @default.
• W2130057582 hasAuthorship W2130057582A5009510786 @default.
• W2130057582 hasAuthorship W2130057582A5016380606 @default.
• W2130057582 hasAuthorship W2130057582A5033799076 @default.
• W2130057582 hasAuthorship W2130057582A5048594811 @default.
• W2130057582 hasAuthorship W2130057582A5066002550 @default.
• W2130057582 hasAuthorship W2130057582A5081619370 @default.

• next