FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2130064123> ?p ?o ?g. }

• W2130064123 endingPage "35344" @default.
• W2130064123 startingPage "35335" @default.
• W2130064123 abstract "ω-Conotoxins selective for N-type calcium channels are useful in the management of severe pain. In an attempt to expand the therapeutic potential of this class, four new ω-conotoxins (CVIA–D) have been discovered in the venom of the piscivorous cone snail, Conus catus, using assay-guided fractionation and gene cloning. Compared with other ω-conotoxins, CVID has a novel loop 4 sequence and the highest selectivity for N-type over P/Q-type calcium channels in radioligand binding assays. CVIA−D also inhibited contractions of electrically stimulated rat vas deferens. In electrophysiological studies, ω-conotoxins CVID and MVIIA had similar potencies to inhibit current through central (α1B-d) and peripheral (α1B-b) splice variants of the rat N-type calcium channels when coexpressed with rat β3 in Xenopus oocytes. However, the potency of CVID and MVIIA increased when α1B-d and α1B-b were expressed in the absence of rat β3, an effect most pronounced for CVID at α1B-d (up to 540-fold) and least pronounced for MVIIA at α1B-d (3-fold). The novel selectivity of CVID may have therapeutic implications. 1H NMR studies reveal that CVID possesses a combination of unique structural features, including two hydrogen bonds that stabilize loop 2 and place loop 2 proximal to loop 4, creating a globular surface that is rigid and well defined. ω-Conotoxins selective for N-type calcium channels are useful in the management of severe pain. In an attempt to expand the therapeutic potential of this class, four new ω-conotoxins (CVIA–D) have been discovered in the venom of the piscivorous cone snail, Conus catus, using assay-guided fractionation and gene cloning. Compared with other ω-conotoxins, CVID has a novel loop 4 sequence and the highest selectivity for N-type over P/Q-type calcium channels in radioligand binding assays. CVIA−D also inhibited contractions of electrically stimulated rat vas deferens. In electrophysiological studies, ω-conotoxins CVID and MVIIA had similar potencies to inhibit current through central (α1B-d) and peripheral (α1B-b) splice variants of the rat N-type calcium channels when coexpressed with rat β3 in Xenopus oocytes. However, the potency of CVID and MVIIA increased when α1B-d and α1B-b were expressed in the absence of rat β3, an effect most pronounced for CVID at α1B-d (up to 540-fold) and least pronounced for MVIIA at α1B-d (3-fold). The novel selectivity of CVID may have therapeutic implications. 1H NMR studies reveal that CVID possesses a combination of unique structural features, including two hydrogen bonds that stabilize loop 2 and place loop 2 proximal to loop 4, creating a globular surface that is rigid and well defined. voltage-sensitive calcium channels reverse phase-high pressure liquid chromatography polymerase chain reaction double-stranded mass spectrometer nuclear Overhauser effect Predatory marine gastropods of the genus Conus (cone snails) represent a diverse family of marine molluscs that use venom for prey capture. The venom of each species contains a unique array of more than 100 peptides, whose pharmaceutical potential remain largely unexploited (1Adams D.J. Alewood P.F. Craik D.J. Drinkwater R. Lewis R.J. Drug Dev. Res. 1999; 46: 219-234Crossref Scopus (109) Google Scholar). Different classes of conotoxins have evolved to target ion channels and receptors for the successful capture of fish, molluscs, or worms (2Olivera B.M. Gray W.R. Zeikus R. McIntosh J.M. Varga J. Science. 1990; 230: 1338-1343Crossref Scopus (641) Google Scholar, 3McIntosh J.M. Olivera B.M. Cruz L.J. Methods Enzymol. 1999; 294: 605-624Crossref PubMed Scopus (77) Google Scholar). One important class, the ω-conotoxins (Table I) isolated from piscivorous species, inhibits neuronal voltage-sensitive calcium channels (VSCCs)1 found in mammals (4Miljanich G.P. Ramachandran J. Annu. Rev. Pharmacol. Toxicol. 1995; 35: 707-734Crossref PubMed Scopus (284) Google Scholar). ω-Conotoxins have selectivity for N-type (e.g. MVIIA and GVIA) or P/Q-type (e.g. MVIIC) VSCCs, making them widely used research tools for defining the distribution and role of neuronal VSCCs (4Miljanich G.P. Ramachandran J. Annu. Rev. Pharmacol. Toxicol. 1995; 35: 707-734Crossref PubMed Scopus (284) Google Scholar, 5Seabrook G.R. Adams D.J. Br. J. Pharmacol. 1989; 97: 1125-1136Crossref PubMed Scopus (41) Google Scholar, 6Takahashi T. Momiyama A. Nature. 1993; 366: 156-158Crossref PubMed Scopus (612) Google Scholar, 7McDonough S.I. Swartz K.J. Mintz I.M. Boland L.M. Bean B.P. J. Neurosci. 1996; 16: 2612-2623Crossref PubMed Google Scholar, 8Currie K.P. Fox A.P. J. Neurosci. 1997; 17: 4570-4579Crossref PubMed Google Scholar). In addition to their use as research tools, animal studies have shown that ω-conotoxins that target N-type VSCCs have clinical potential in ischemic brain injury (9Yamada K. Teraoka T. Morita S. Hasegawa T. Nabeshima T. Neuropharmacology. 1994; 33: 251-254Crossref PubMed Scopus (36) Google Scholar) and pain (10Malmberg A.B. Yaksh T.L. Pain. 1995; 60: 83-90Abstract Full Text PDF PubMed Scopus (213) Google Scholar). However, ω-conotoxins presently available are not ideal therapeutics, despite their selectivity and potency and the dominant role of N-type VSCCs at synapses in carrying nociceptive information in the spinal cord (11Wetenbroek R.E. Hoskins L. Catterall W.A. J. Neurosci. 1998; 18: 6319-6330Crossref PubMed Google Scholar). For example, intrathecal MVIIA causes a variety of neurological side effects of unknown origin (12Penn R.D. Paice J. Pain. 2000; 85: 291-296Abstract Full Text Full Text PDF PubMed Scopus (164) Google Scholar). Another N-type VSSC selective ω-conotoxin, GVIA, dissociates slowly from N-type VSCCs (13Kristipati R. Nádasdi L. Tarczy-Hornoch K. Lau K. Miljanich G.P. Ramachandran J. Bell J.R. Mol. Cell. Neurosci. 1994; 5: 219-228Crossref PubMed Scopus (84) Google Scholar, 14Lin Z. Haus S. Edgerton J. Lipscombe D. Neuron. 1997; 18: 153-166Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar) and, accordingly, may be difficult to administer in a clinical setting. Other ω-conotoxins are less selective for N-type VSCCs and are not considered useful therapeutic candidates.Table ISequence and VSCC selectivity of selected ω-conotoxinsName 1-aω-Conotoxins from the venom of piscivorous C. catus (C), C. geographus (G),C. tulipa (T), C. magus (M), and C. striatus (S) are shown.Sequence 1-bAll ω-conotoxins are C-terminally amidated (Selectivity 1-cSelectivity determined from relative potencies to displace 125I-GVIA (N-type) and125I-MVIIC (P/Q-type) binding to rat brain membrane.Ref.Loop 1 2 3 4CVIACKSTGASCRRTSYDCCTGSCRS--GRC 1-150).NPresent studyCVIBCKGKGASCRKTMYDCCRGSCRS--GRC 1-150).N/P/QPresent studyCVICCKGKGQSCSKLMYDCCTGSCSRR-GKC 1-150).N/P/QPresent studyCVIDCKSKGAKCSKLMYDCCSGSCSGTVGRC 1-150).NPresent studyGVIACKSOGSSCSOTSYNCCR-SCNOYTKRCY1-150).N57Olivera B.M. McIntosh J.M. Cruz L.J. Luque F.A. Gray W.R. Biochemistry. 1984; 23: 5087-5090Crossref PubMed Scopus (369) Google ScholarTVIACLSOGSSCSOTSYNCCR-SCNOYSRKCY1-150).N4Miljanich G.P. Ramachandran J. Annu. Rev. Pharmacol. Toxicol. 1995; 35: 707-734Crossref PubMed Scopus (284) Google ScholarMVIIACKGKGAKCSRLMYDCCTGSCRS--GKC 1-150).N58Olivera B.M. Cruz L.J. deSantos V. LeChaminant G.W. Griffin D. Zeikus R. McIntosh J.M. Galyean R. Varga J. Gray W.R. Rivier J. Biochemistry. 1987; 26: 2086-2090Crossref PubMed Scopus (311) Google ScholarMVIICCKGKGAPCRKTMYDCCSGSCGRR-GKC1-150).P/Q59Hillyard D.R. Monje V.D. Mintz I.M. Bean B.P. Nadasdi L. Ramachandran J. Miljanich G. Azimi-Zonooz A. McIntosh J.M. Cruz L.J. Imperial J.S. Olivera B.M. Neuron. 1992; 9: 69-77Abstract Full Text PDF PubMed Scopus (439) Google ScholarSVIBCKLKGQSCRKTSYDCCSGSCGRS-GKC 1-150).N/P/Q51Ramilo C.A. Zafaralla G.C. Nadasdi L. Hammerland L.G. Gray W.R. Krispati R. Ramachandran J. Miljanich G. Olivera B.M. Cruz L.J. Biochemistry. 1992; 31: 9919-9926Crossref PubMed Scopus (155) Google Scholar1-a ω-Conotoxins from the venom of piscivorous C. catus (C), C. geographus (G),C. tulipa (T), C. magus (M), and C. striatus (S) are shown.1-b All ω-conotoxins are C-terminally amidated (1-150 ).1-c Selectivity determined from relative potencies to displace 125I-GVIA (N-type) and125I-MVIIC (P/Q-type) binding to rat brain membrane. Open table in a new tab A number of central and peripheral splice variants of the N-type VSCC have been reported (14Lin Z. Haus S. Edgerton J. Lipscombe D. Neuron. 1997; 18: 153-166Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar). However, calcium channel probes with greater selectivity are required to help understand the role(s) played by the various forms of the N-type VSCC in normal and disease states. Here we report the isolation and characterization of four new ω-conotoxins (CVIA—D, see Table I) discovered in the venom of the piscivorous cone snail, Conus catus. One of these, CVID, has a number of novel structural features that underlie an enhanced ability to discriminate between N-type (α1B) and P/Q-type (α1A) VSCCs, as well as between splice variants of the α1B expressed in oocytes in the presence or absence of rat β3. 37 specimens of C. catus(average length 4 cm) were collected from the southern Great Barrier Reef. Crude venom duct contents were extracted with 30% acetonitrile/water acidified with 0.1% trifluoroacetic acid and centrifuged. Soluble material was lyophilized and stored at −20 °C prior to use. The crude venom extract (12 mg) was fractionated using semi-preparative RP-HPLC (10 μm C18, 1.0 × 25 cm, Vydac) eluted at 2.5 ml/min with a linear gradient of 0–60% solvent B over 60 min, then to 80% solvent B over 20 min, using a Waters 600 solvent delivery system (solvent A, 10% acetonitrile, 0.1% trifluoroacetic acid; solvent B, 90% acetonitrile, 0.09% trifluoroacetic acid). Inhibition of 125I-GVIA binding to rat brain membrane (see below) identified six 1-min fractions eluting at 17, 18, 22, 23, 26, and 27 min that contained ω-conotoxins. The ω-conotoxins in each fraction were further purified by size exclusion HPLC (Superdex HR10/30, Amersham Pharmacia Biotech) eluted with 30% acetonitrile, 0.1% trifluoroacetic acid at 0.5 ml/min. Active fractions were finally rechromatographed by analytical RP-HPLC (5 μm C18, 0.46 × 25 cm, Vydac) eluted at 1 ml/min with a linear gradient of 0–50% solvent B over 45 or 90 min. Peaks detected at 214 nm were collected and sequenced. Screening of the venom of other Australian cone snails, including the piscivorousConus striatus, Conus tulipa, Conus geographus, andConus magus, only identified sequences corresponding to known ω-conotoxins. The purified peptides (∼100 pmol) were reduced in the presence of TCEP, 50 mm ammonium acetate at pH 4.5 (37 °C for 1 h), and then alkylated in the presence of maleimide (37 °C, 1 h). The alkylated peptides were purified by RP-HPLC, applied to a Biobrene-treated glass fiber filter, and analyzed by Edman chemistry using an Applied Biosystems, Inc., model 470A protein sequencer. Alkylation of peptides with maleimide allowed their cysteine residues to be observed as phenylthiohydantoin-Cys-maleimide doublets (diastereomers), and Ser was confirmed by the presence of dehydroserine. The high number of serine, threonine, and cysteine residues present in each conotoxin resulted in a relatively rapid decrease in the amino acid yields in successive cycles; however, complete sequences were obtained in each case. The low serine signals were accompanied by the presence of large dehydroserine peak. Ducts from two specimens of C. catus were emulsified, and poly(A)+-tailed mRNA was extracted using the QuickPrep mRNA purification system (Amersham Pharmacia Biotech). Strand-1 cDNA was 3′ end-synthesized from the C. catuspoly(A)+ mRNA templates using aNotI-d(T)18 bifunctional primer (5′-AACTGGAAGAATTCGCGGCCGCAGGAAT18) (Amersham Pharmacia Biotech) extended with Superscript II reverse transcriptase (Life Technologies, Inc.). The resultant cDNA templates were used to manufacture double-stranded cDNA using a RNase H/DNA polymerase procedure (cDNA Timesaver system, Amersham Pharmacia Biotech). Marathon adaptors (CLONTECH) were added to the 5′ and 3′ ends of the ds-cDNA molecules to complete the cDNA construction. An oligonucleotide PCR primer (R-301A 5′-atcatcaaaATGAAACTGACGTG) was designed from a consensus of aligned coding sequences from conotoxins with a 6-cysteine/4-loop framework comprising published (15Woodward S.R. Cruz L.J. Olivera B.M. Hillyard D.R. EMBO J. 1990; 9: 1015-1020Crossref PubMed Scopus (172) Google Scholar, 16Colledge C.J. Hunsperger J.P. Imperial J.S. Hillyard D.R. Toxicon. 1992; 30: 1111-1116Crossref PubMed Scopus (55) Google Scholar) and unpublished data. 2R. J. Lewis, K. J. Nielsen, D. J. Craik, M. L. Loughnan, D. A. Adams, I. A. Sharpe, T. Luchian, D. J. Adams, T. Bond, L. Thomas, A. Jones, J.-L. Matheson, R. Drinkwater, P. R. Andrews, and P. F. Alewood, unpublished data. The primer included a translation start site (underlined) and 9 base pairs of 5′-untranslated sequence (lowercase). This forward PCR primer was designed to work in conjunction with the reverse ANCHOR primer (5′- AACTGGAAGAATTCGCGGCCGCAGGAAT) that was homologous to the adaptor at the 3′ termini of the ds-cDNA templates. PCR was carried out on samples containing ds-cDNA from C. catus, the R-301A primer, the ANCHOR primer, AmpliTaq Gold polymerase (PerkinElmer Life Sciences), the manufacturer's AmpliTaq buffer, 25 mm MgCl2, and 100 μmdeoxynucleotides. The samples were incubated in a PTC-100 thermal cycler (MJ Research, Bresatec, Australia) at 95 °C for 2 min (1 cycle), 95 °C for 30 s, 55 °C for 60 s, 72 °C for 90 s (35 cycles), and 72 °C for 10 min (1 cycle). The PCR products were assessed on agarose gels and, when necessary, isolated and purified using BRESAspin gel extraction systems (Bresatec, Australia). The purified PCR products were blunt end-cloned into dephosphorylated Sma-1 cut pUC-18 plasmid vector DNA (Amersham Pharmacia Biotech) and sequenced using the pUC-18 forward and reverse primers (Amersham Pharmacia Biotech), dideoxy terminator sequencing chemistries (PerkinElmer Life Sciences) on Applied Biosystems, Inc., 377 sequencers. CVIA–D were each manually synthesized, deprotected, and cleaved from resin as described previously (17Schnölzer M. Alewood P. Jones A. Alewood D. Kent S.B.H. Int. J. Pept. Protein Res. 1992; 40: 180-193Crossref PubMed Scopus (938) Google Scholar, 18Nielsen K.J. Adams D. Thomas L. Bond T.J. Alewood P.F. Craik D.J. Lewis R.J. J. Mol. Biol. 1999; 289: 1405-1421Crossref PubMed Scopus (68) Google Scholar).O-(7-Azabenzotriazol-1-yl)-N,N,N′,N′-tetramethyluronium hexafluorophosphate was used in place ofO-(benzotriazol-1-yl)-N,N,N′,N′-tetramethyluronium hexafluorophosphate for difficult sections. The pure, reduced peptides (0.02–0.05 mm) were oxidized in aqueous 0.33 mNH4Oac, 0.5 m guanidine·HCl (pH 7.5–8.0, adjusted with 0.1 m NH4OH). The peptide solutions were then stirred for 2–4 days at 4 °C in the presence of reduced and oxidized glutathione (molar ratio 1:100:10) to achieve oxidation. Oxidized peptides were purified by preparative RP-HPLC (18Nielsen K.J. Adams D. Thomas L. Bond T.J. Alewood P.F. Craik D.J. Lewis R.J. J. Mol. Biol. 1999; 289: 1405-1421Crossref PubMed Scopus (68) Google Scholar). Peptides were quantified initially by triplicate amino acid analysis (19Bidlingmeyer B.A. Cohen S.A. Tarvin T.L. J. Chromatogr. 1984; 336: 93-104Crossref PubMed Scopus (2115) Google Scholar) and then by RP-HPLC (HP 1100) using an external reference standard for each peptide. Stability studies in physiological saline solutions showed that nonspecific binding of these peptides to glass or polypropylene was minimal. Mass spectra were acquired on a PE-Sciex API III triple quadrupole electrospray mass spectrometer (MS) in positive ion mode (m/z 500–2000, at 0.1–0.2-Da steps, declustering potentials of 10–90 V, and dwell times of 0.4–1.0 s). Data were deconvoluted (MacSpec 3.2, Sciex, Canada) to obtain the molecular weight from the multiply charged species. MS was used to confirm purity and to monitor peptide oxidation. Native and synthetic CVIA−D were compared on a 5-μm C18 column (0.21 × 25 cm, Vydac) eluted with 0.05% trifluoroacetic acid for 2 min and then with a linear gradient to 80% solvent B (solvent B, 90% acetonitrile, 0.045% trifluoroacetic acid) over 80 min at a flow rate of 130 μl/min, using a Hewlett-Packard 1100 pump and MS detection. Radioligand binding were performed on rat brain membrane incubated in the following (mm): 20 HEPES (pH 7.2), 75 NaCl, 0.1 EDTA, 0.1 EGTA, 2 leupeptin, 0.5 units of aprotinin, and 0.1% bovine serum albumin, as described previously (18Nielsen K.J. Adams D. Thomas L. Bond T.J. Alewood P.F. Craik D.J. Lewis R.J. J. Mol. Biol. 1999; 289: 1405-1421Crossref PubMed Scopus (68) Google Scholar,20Nielsen K.J. Adams D.A. Alewood P.F. Lewis R.J. Thomas L. Schroeder T. Craik D.J. Biochemistry. 1999; 38: 6741-6751Crossref PubMed Scopus (44) Google Scholar, 21Cruz L.J. Olivera B.M. J. Biol. Chem. 1986; 261: 6230-6233Abstract Full Text PDF PubMed Google Scholar). 125I-[Tyr22]GVIA,125I-CVID, 125I-MVIIA, and125I-MVIIC were prepared using IODOGEN, stored at 4 °C, and used within 3 weeks. 125I-CVID and125I-MVIIA both eluted ∼3 min after CVID or MVIA, respectively, as single homogenous peaks on RP-HPLC. Cold iodinated CVID (127I-CVID) was also prepared and quantified by HPLC.127I-CVID coeluted with 125I-CVID, and MS confirmed it as the monoiodinated species. For displacement studies, [125I-Tyr22]GVIA, 125I-MVIIA, or125I-MVIIC (7 pm diluted with assay buffer) were incubated with increasing concentrations of cold peptide. Saturation binding studies were performed with freshly prepared125I-CVID and 125I-MVIIA (n = 4 experiments). On-rate and off-rate experiments were performed at 23 °C in single 50-ml polypropylene tubes containing125I-CVID or 125I-MVIIA (30 pmdiluted with assay buffer). On-rate experiments commenced with the addition of rat brain membrane, and off-rate experiments commenced with the addition of excess CVID or MVIIA (10−7m) following a 30-min incubation of rat brain membrane with125I-CVID or 125I-MVIIA (30 pm), respectively. At defined intervals, aliquots (300 μl) were filtered (25-mm Whatman GF/B treated with 0.6% polyethyleneimine), and the filtrates were rapidly washed three times with ice-cold wash buffer. Nonlinear regressions were fitted to each experiment (n= 3 data points per experiment) with Prism software (GraphPad, San Diego, CA). Male Wistar rats (250–350 ×g) were killed by cervical dislocation and exsanguinated. Prostatic halves of each vas deferens were mounted under 0.5 ×g tension in 5-ml organ baths containing physiological solution containing the following (mm): 119 NaCl, 4.7 KCl, 1.17, MgSO4, 1.18 KH2PO4, 25.0 NaHCO3, 5.5 glucose, 2.5 CaCl2, 0.026 EDTA, at 37 °C and bubbled with 5% CO2 in O2 (pH 7.4). After 45 min of equilibration, electrical field stimulation every 3 min (single 55 V, 0.1-ms duration pulses generated by a Grass S44 stimulator) were applied via two platinum-stimulating electrodes straddling the tissue. Isometric contractions were measured using a force transducer (F-60, Narco Bio-System) and recorded digitally on a Power Macintosh computer using Chart version 3.5.6/s software and a MacLab/8 s data acquisition system (ADInstruments, Australia) at a sampling frequency of 200 Hz. Evoked contractions were abolished by tetradotoxin (0.1 μm), indicating that they were of neurogenic origin. Conotoxins were added cumulatively at 18-min intervals, with allowance made for a small (0.16% /min) deterioration of the evoked response. CVID effect on ATP (3 × 10−3m, Sigma) and norepinephrine (10−4m, Sigma) responses in the bisected epididymal portion of the rat vas deferens was also determined. Dose-response data (means ± S.E.; n = 5) were analyzed using Prism software. Oocytes were surgically removed from mature Xenopus laevis frogs anesthetized by submersion in 0.1% ethyl m-aminobenzoate (MS 222). Stage V–VI oocytes were prepared for injection by dissociation in Ca2+-free solution containing the following (mm): 96 NaCl, 2 KCl, 1 MgCl2, 5 HEPES (pH 7.4), plus 1 mg/ml collagenase (Sigma, type I) for 1 h at room temperature. Oocytes, maintained in storage solution containing (mm) 96 NaCl, 2 KCl, 1 CaCl2, 1 MgCl2, 5 HEPES, 5 pyruvate, plus 50 μg/ml gentamicin (pH 7.4), were injected with 25–50 ng of total cRNA using a precision injector (Drummond “Nanojet”) and incubated at 18 °C for 3−5 days. Injected cRNA obtained using an Ambion mMessage mMachine kit comprised rat brain peripheral (α1B-b) or central (α1B-d) subunits of the N-type VSCC expressed in the absence or presence (1:1 ratio) of the rat β3 subunit provided by D. Lipscombe (12Penn R.D. Paice J. Pain. 2000; 85: 291-296Abstract Full Text Full Text PDF PubMed Scopus (164) Google Scholar). Recordings were made in a nominally Ca2+-free solution containing (mm) 85 tetraethylammonium, 5 BaCl2, 5 KCl, 5 HEPES, adjusted to pH 7.4 with methanesulfonic acid perfused at a rate of ∼10 ml/min. Depolarization-activated Ba2+ currents were recorded using a GeneClamp 500B two-electrode voltage clamp amplifier (Axon Instruments Inc., Foster City, CA) at room temperature (21−23 °C). Voltage and current electrodes were filled with 3m KCl and had final resistances of 0.2–1.0 MΩ. VSCC currents in oocytes were evoked by a step depolarization to 0 mV from a holding potential of −80 mV using pClamp programs (Axon Instruments Inc). The linear membrane capacitative and leak currents were subtracted using a −P/4 pulse protocol. Membrane currents were sampled at 10 kHz and filtered at 2 kHz. Oocytes showing <15% change in peak current amplitude over a 10-min incubation period were used in these studies to avoid effects associated with current run down. Oocytes that exhibited a slowly developing Cl− current were discarded, and in control experiments on the remaining oocytes, BAPTA injection did not affect the Ba2+ current, indicating that this current was not contaminated by Ca2+-activated Cl− current. Perfusion was stopped, and cumulative additions of ω-conotoxins were added to a Teflon chamber (0.8 ml volume) to achieve rapid mixing. Inhibition of peak Ba2+current amplitude was measured when the inhibitory effects of each concentration of MVIIA and CVID approached steady state values, typically requiring a 5–7-min incubation to achieve <2% change in peak current amplitude per min. Data (means ± S.E.;n = 3–5) were fitted with nonlinear regressions using Origin software. All NMR experiments were recorded on a Bruker ARX 500 spectrometer equipped with a z-gradient unit, or a Bruker DMX 750 spectrometer equipped with an x,y,z-gradient unit. The Hα chemical shifts were obtained from spectra of CVIA–D in 95% H2O, 5% D2O (pH 2.5–3.5) at 293 K, and restraints for three-dimensional structure calculations of CVID were obtained from spectra recorded at 280 and 293 K at pH 3 and 5.5 (18Nielsen K.J. Adams D. Thomas L. Bond T.J. Alewood P.F. Craik D.J. Lewis R.J. J. Mol. Biol. 1999; 289: 1405-1421Crossref PubMed Scopus (68) Google Scholar). Structures were calculated using the torsion angle dynamics/simulated annealing protocol in XPLOR version 3.8 (22Brünger A.T. Clore G.M. Gronenborn A.M Karplus M. Proc. Nat. Acad. Sci. U. S. A. 1986; 83: 3801-3805Crossref PubMed Scopus (321) Google Scholar, 23Brünger A.T. A System for X-ray Crystallography and NMR, X-PLOR Version 3.1. Yale University, New Haven1992Google Scholar, 24Rice L.M. Brünger A.T. Proteins Struct. Funct. Genet. 1994; 19: 277-290Crossref PubMed Scopus (382) Google Scholar, 25Stein E.G. Rice L.M. Brünger A.T. J. Magn. Reson. 1996; 124: 1554-1564Google Scholar), as described previously (20Nielsen K.J. Adams D.A. Alewood P.F. Lewis R.J. Thomas L. Schroeder T. Craik D.J. Biochemistry. 1999; 38: 6741-6751Crossref PubMed Scopus (44) Google Scholar). The four ω-conotoxins, CVIA−D, were isolated from the crude venom ofC. catus using activity-directed fractionation. Each comprised <1% of total venom peptide as determined by HPLC (214 nm) or MS detection (m/z 500–2000). The amino acid sequences of CVIA and CVIB were cosequenced at a 3:2 ratio, whereas CVIC and CVID were obtained from separate fractions. Synthetic C-terminally amidated CVIA, CVIC, and CVID gave retention times and masses that were indistinguishable from the corresponding native peptides (Fig.1), thus CVIA, CVIC, and CVID were determined to be C-terminally amidated. For each peptide, the oxidized form eluted earlier than the reduced form. PCR of the C. catus venom duct cDNA templates produced a DNA product of approximately 380−500 base pairs (data not shown). A relatively broad DNA band indicated the presence of a composite PCR product. Subsequent sequence analysis of more than 100 clones derived from the PCR product libraries confirmed this observation. The PCR products contained peptides of the ω- and δ-conotoxin types, as well as sequences from at least two other conotoxin families yet to be assigned. Within the ω-conotoxin sequences isolated were two that translated to putative mature peptides identical to the CVIA and CVID sequences. Despite an extensive screening of the two C. catus PCR product libraries, clones for the conotoxins CVIB and CVIC were not located, and the CVID clone was located in only one specimen. The complete nucleotide and predicted amino acid sequences derived for CVIA and CVID are shown in Fig. 2 and are aligned with the sequences for MVIIA and GVIA. Homology screening of public nucleotide and amino acid data bases with the CVIA and CVID sequences indicated that both sequences were unique. Synthetic CVIA−D, GVIA, MVIIA, and MVIIC each fully displaced 125I-GVIA (defining N-type VSCCs) and 125I-MVIIC (defining P/Q-type VSCCs) binding to crude rat brain membrane (Fig. 3; Table II). GVIA, MVIIA, and CVID had similarly high affinity for the N-type VSCC (pIC50± S.E. values of 10.4 ± 0.05, 10.3 ± 0.03, and 10.2 ± 0.03 m, respectively). In comparison, CVIA was a moderate inhibitor, and CVIB and CVIC were relatively poor inhibitors at the N-type VSCC. GVIA, MVIIA, and CVID also fully displaced125I-MVIIA, with potencies (IC50 values of 49, 29, and 50 pm, respectively) similar to those obtained for displacement of 125I-GVIA. At the P/Q-type VSCC MVIIC had highest affinity (pIC50 9.2 ± 0.04m); CVIB and CVIC were moderate inhibitors; MVIIA, CVIA, and MVIIA were poor inhibitors; and CVID was an exceptionally weak inhibitor (IC50 55 μm) (Fig.3 B and Table II).Table IIPotency (nm) of ω-conotoxins to inhibit 125 I-GVIA (N-type) or 125 I-MVIIC (P/Q-type) binding to rat brain VSCCs, and contractions of electrically stimulated rat vas deferensω-ConotoxinDisplacement of 125I-GVIA, IC50(95% CI)Inhibition of vas deferens, IC50 (95% CI)Displacement of 125I-MVIIC, IC50 (95% CI)CVIA0.56 (0.44–0.70)205 (170–250)850 (700–1020)CVIB7.7 (7.1–8.5)630 (480–830)11 (9.0–13)CVIC7.6 (7.0–8.3)410 (290–590)31 (26–37)CVID0.070 (0.058–0.077)18.4 (16–21)55,000 (49,000–62,000)MVIIA0.055 (0.047–0.066)18.2 (15–22)440 (380–520)GVIA0.038 (0.030–0.047)4.9 (4.0–6.0)1050 (830–1320)MVIIC7.0 (5.3–9.8)0.60 (0.49–0.72) Open table in a new tab Saturation binding studies indicated that 125I-CVID and125I-MVIIA (67 ± 11 and 37 ± 12 pm, respectively) had potencies slightly lower than CVID and MVIIA in rat brain membrane, and both appeared to occupy a single class of receptor (Fig. 4). In paired experiments (n = 4), 125I-CVID (0.07 ± 0.03 pmol/mg protein) bound to 31% fewer receptors in rat brain membrane than 125I-MVIIA (0.10 ± 0.04 pmol/mg protein) (p = 0.049, paired two-tailed t test), and125I-CVID had half the nonspecific binding of125I-MVIIA (Fig. 4). Despite this difference in the density of receptor sites recognized, displacement assays did not reveal a component of 125I-GVIA or 125I-MVIIA binding that was not displaced by CVID. 127I-CVID (IC500.44 nm) also fully displaced 125I-MVIIA binding to rat brain with a Hill slope of unity. However, saturation binding studies have limited power to resolve binding sites of similar affinity, and a lower affinity binding site comprising 30% of receptors would be under-represented with the concentration of125I-MVIIA used in the displacement assays (20% of itsK d concentration). Displacement of higher concentrations of 125I-MVIIA by MVIIA, GVIA, CVID, or127I-CVID also did not identify a significant resistant component, possibly due to the reduction in the signal to noise of the assay with increased labeled ligand concentrations (data not shown). The difference in B max did not arise from differences in binding kinetics; 125I-CVID and125I-MVIIA had similar k on values (0.024 and 0.08 min−1pm−1, after adjusting fork off) and k off values (0.56 and 0.53 min−1, respectively). TheK d values for 125I-CVID and125I-MVIIA calculated from kinetic data (23 and 7 pm, respectively) were similar to the estimates obtained from saturation binding studies (67 and 37 pm, respectively). CVIA–D inhibited electrically stimulated rat vas deferens contractions (Fig.5 A). The rank order of potency was GVIA > CVID ≈ MVIIA > CVIA > CVIC > CVIB (Fig. 5 B and Table II). Inhibition of the nerve-evoked responses in rat vas deferens was positively correlated with displacement of 125I-GVIA binding across the ω-conotoxins tested (log(rat vas deferens IC50) = 0.78(log(125I-GVIA IC50) + 0.1) (r 2 = 0.92)). CVID and MVIIA gave Hill slopes significantly greater than unity (2.9 and 3.3, respectively), whereas CVIA-C and GVIA gave Hill slopes that were not significantly different from unity. The origin of these differences is unclear; however, differences in N-type versus P/Q-type VSCC selectivity do not appear to be a contributing factor. The nonlinear relationship between calcium influx and transmitter release (26Wheeler D.B. Ran" @default.
• W2130064123 created "2016-06-24" @default.
• W2130064123 creator A5013170471 @default.
• W2130064123 creator A5013274992 @default.
• W2130064123 creator A5015799672 @default.
• W2130064123 creator A5025308092 @default.
• W2130064123 creator A5025386235 @default.
• W2130064123 creator A5025539645 @default.
• W2130064123 creator A5034438103 @default.
• W2130064123 creator A5038205856 @default.
• W2130064123 creator A5044789750 @default.
• W2130064123 creator A5046140228 @default.
• W2130064123 creator A5058316270 @default.
• W2130064123 creator A5066638520 @default.
• W2130064123 creator A5079308758 @default.
• W2130064123 creator A5085182117 @default.
• W2130064123 creator A5090111434 @default.
• W2130064123 date "2000-11-01" @default.
• W2130064123 modified "2023-10-13" @default.
• W2130064123 title "Novel ω-Conotoxins from Conus catus Discriminate among Neuronal Calcium Channel Subtypes" @default.
• W2130064123 cites W1424687720 @default.
• W2130064123 cites W1526580466 @default.
• W2130064123 cites W1577883243 @default.
• W2130064123 cites W1682432998 @default.
• W2130064123 cites W1812943678 @default.
• W2130064123 cites W1967647423 @default.
• W2130064123 cites W1973472528 @default.
• W2130064123 cites W1978335820 @default.
• W2130064123 cites W1979899788 @default.
• W2130064123 cites W1980325410 @default.
• W2130064123 cites W1983880435 @default.
• W2130064123 cites W1986054627 @default.
• W2130064123 cites W1990237430 @default.
• W2130064123 cites W1998013875 @default.
• W2130064123 cites W1999337430 @default.
• W2130064123 cites W2003918837 @default.
• W2130064123 cites W2013637360 @default.
• W2130064123 cites W2014803874 @default.
• W2130064123 cites W2016098772 @default.
• W2130064123 cites W2017252819 @default.
• W2130064123 cites W2017385903 @default.
• W2130064123 cites W2029708340 @default.
• W2130064123 cites W2030758816 @default.
• W2130064123 cites W2032114328 @default.
• W2130064123 cites W2032529224 @default.
• W2130064123 cites W2036929503 @default.
• W2130064123 cites W2037378018 @default.
• W2130064123 cites W2041090336 @default.
• W2130064123 cites W2043935466 @default.
• W2130064123 cites W2046117783 @default.
• W2130064123 cites W2050739020 @default.
• W2130064123 cites W2051393379 @default.
• W2130064123 cites W2059399327 @default.
• W2130064123 cites W2062194670 @default.
• W2130064123 cites W2062488318 @default.
• W2130064123 cites W2066787103 @default.
• W2130064123 cites W2078879206 @default.
• W2130064123 cites W2081544730 @default.
• W2130064123 cites W2083030813 @default.
• W2130064123 cites W2085269882 @default.
• W2130064123 cites W2110095865 @default.
• W2130064123 cites W2113022597 @default.
• W2130064123 cites W2128345958 @default.
• W2130064123 cites W2132351632 @default.
• W2130064123 cites W2133387156 @default.
• W2130064123 cites W2144589096 @default.
• W2130064123 cites W2146837416 @default.
• W2130064123 cites W2154688239 @default.
• W2130064123 cites W2157568294 @default.
• W2130064123 cites W2160722908 @default.
• W2130064123 cites W2165328940 @default.
• W2130064123 cites W2168867452 @default.
• W2130064123 cites W2171405755 @default.
• W2130064123 cites W2171682691 @default.
• W2130064123 cites W2172205732 @default.
• W2130064123 doi "https://doi.org/10.1074/jbc.m002252200" @default.
• W2130064123 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10938268" @default.
• W2130064123 hasPublicationYear "2000" @default.
• W2130064123 type Work @default.
• W2130064123 sameAs 2130064123 @default.
• W2130064123 citedByCount "205" @default.
• W2130064123 countsByYear W21300641232012 @default.
• W2130064123 countsByYear W21300641232013 @default.
• W2130064123 countsByYear W21300641232014 @default.
• W2130064123 countsByYear W21300641232015 @default.
• W2130064123 countsByYear W21300641232016 @default.
• W2130064123 countsByYear W21300641232017 @default.
• W2130064123 countsByYear W21300641232018 @default.
• W2130064123 countsByYear W21300641232019 @default.
• W2130064123 countsByYear W21300641232020 @default.
• W2130064123 countsByYear W21300641232021 @default.
• W2130064123 countsByYear W21300641232022 @default.
• W2130064123 countsByYear W21300641232023 @default.
• W2130064123 crossrefType "journal-article" @default.
• W2130064123 hasAuthorship W2130064123A5013170471 @default.
• W2130064123 hasAuthorship W2130064123A5013274992 @default.
• W2130064123 hasAuthorship W2130064123A5015799672 @default.
• W2130064123 hasAuthorship W2130064123A5025308092 @default.

• next