FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2130246821> ?p ?o ?g. }

• W2130246821 endingPage "22772" @default.
• W2130246821 startingPage "22761" @default.
• W2130246821 abstract "Colicin M was earlier demonstrated to provoke Escherichia coli cell lysis via inhibition of cell wall peptidoglycan (murein) biosynthesis. As the formation of the O-antigen moiety of lipopolysaccharides was concomitantly blocked, it was hypothesized that the metabolism of undecaprenyl phosphate, an essential carrier lipid shared by these two pathways, should be the target of this colicin. However, the exact target and mechanism of action of colicin M was unknown. Colicin M was now purified to near homogeneity, and its effects on cell wall peptidoglycan metabolism reinvestigated. It is demonstrated that colicin M exhibits both in vitro and in vivo enzymatic properties of degradation of lipid I and lipid II peptidoglycan intermediates. Free undecaprenol and either 1-pyrophospho-MurNAc-pentapeptide or 1-pyrophospho-MurNAc-(pentapeptide)-Glc-NAc were identified as the lipid I and lipid II degradation products, respectively, showing that the cleavage occurred between the lipid moiety and the pyrophosphoryl group. This is the first time such an activity is described. Neither undecaprenyl pyrophosphate nor the peptidoglycan nucleotide precursors were substrates of colicin M, indicating that both undecaprenyl and sugar moieties were essential for activity. The bacteriolytic effect of colicin M therefore appears to be the consequence of an arrest of peptidoglycan polymerization steps provoked by enzymatic degradation of the undecaprenyl phosphate-linked peptidoglycan precursors. Colicin M was earlier demonstrated to provoke Escherichia coli cell lysis via inhibition of cell wall peptidoglycan (murein) biosynthesis. As the formation of the O-antigen moiety of lipopolysaccharides was concomitantly blocked, it was hypothesized that the metabolism of undecaprenyl phosphate, an essential carrier lipid shared by these two pathways, should be the target of this colicin. However, the exact target and mechanism of action of colicin M was unknown. Colicin M was now purified to near homogeneity, and its effects on cell wall peptidoglycan metabolism reinvestigated. It is demonstrated that colicin M exhibits both in vitro and in vivo enzymatic properties of degradation of lipid I and lipid II peptidoglycan intermediates. Free undecaprenol and either 1-pyrophospho-MurNAc-pentapeptide or 1-pyrophospho-MurNAc-(pentapeptide)-Glc-NAc were identified as the lipid I and lipid II degradation products, respectively, showing that the cleavage occurred between the lipid moiety and the pyrophosphoryl group. This is the first time such an activity is described. Neither undecaprenyl pyrophosphate nor the peptidoglycan nucleotide precursors were substrates of colicin M, indicating that both undecaprenyl and sugar moieties were essential for activity. The bacteriolytic effect of colicin M therefore appears to be the consequence of an arrest of peptidoglycan polymerization steps provoked by enzymatic degradation of the undecaprenyl phosphate-linked peptidoglycan precursors. Colicins are plasmid-encoded toxins, synthesized and released in the growth medium by Escherichia coli, which kill susceptible E. coli strains and closely related bacterial species (1Pugsley A.P. Microbiol. Sci. 1984; 1: 168-175PubMed Google Scholar, 2Pugsley A.P. Microbiol. Sci. 1984; 1: 203-205PubMed Google Scholar, 3Lazdunski C.J. Bouveret E. Rigal A. Journet L. Lloubes R. Benedetti H. J. Bacteriol. 1998; 180: 4993-5002Crossref PubMed Google Scholar). Strains are protected against the colicin they produce by concomitant expression of a highly specific immunity protein. The lethal action of colicins can be divided into three steps: binding to a specific outer membrane receptor protein, translocation through the cell envelope, and finally interaction with the target and killing effect. To each of these steps corresponds a specific protein domain, the different colicins showing a similar three-domain structural organization. Depending on the import pathway they parasitize to enter the cells, the Tol system or the TonB system, colicins are classified into two groups A and B, respectively (3Lazdunski C.J. Bouveret E. Rigal A. Journet L. Lloubes R. Benedetti H. J. Bacteriol. 1998; 180: 4993-5002Crossref PubMed Google Scholar). The mode of action of colicins is variable: formation of voltage-gated pores in the cytoplasmic membrane (e.g. colicins A, B, E1, Ia, N), inhibition of protein synthesis (e.g. colicins D and E3), enzymatic degradation of cellular DNA or 16S rRNA (e.g. colicin E2) and inhibition of cell envelope biosynthesis (colicin M, see below). Various bacterial cell envelope polysaccharides (peptidoglycan, O-antigen, teichoic acid, capsular polysaccharide) in both Gram-negative and Gram-positive bacteria have a lipid-linked intermediary stage in their biosynthesis that is dependent on the essential carrier lipid undecaprenyl phosphate (C55-P) 4The abbreviations used are: C55-P, undecaprenyl phosphate; GlcNAc, N-acetylglucosamine; MurNAc, N-acetylmuramic acid; C55-PP, undecaprenyl pyrophosphate; C55-OH, undecaprenol; PP, pyrophosphoryl; A2pm, diaminopimelic acid; lipid I, C55-PP-MurNAc-pentapeptide; lipid II, C55-PP-MurNAc-(pentapeptide)-GlcNAc; Ni2+-NTA-agarose, nickel-nitrilotriacetate-agarose; DDM, n-dodecyl-β-d-maltoside; IPTG, isopropyl-β-d-thiogalactopyranoside; HPLC, high performance liquid chromatography; MALDI-TOF, matrix-assisted laser desorption/ionization time-of-flight. (4Wright A. Dankert M. Fennessey P. Robbins P.W. Proc. Natl. Acad. Sci. U. S. A. 1967; 57: 1798-1803Crossref PubMed Scopus (130) Google Scholar, 5Rick P.D. Hubbard G.L. Kitaoka M. Nagaki H. Kinoshita T. Dowd S. Simplaceanu V. Ho C. Glycobiology. 1998; 8: 557-567Crossref PubMed Scopus (63) Google Scholar, 6Scher M. Lennarz W.J. Sweeley C.C. Proc. Natl. Acad. Sci. U. S. A. 1968; 59: 1313-1320Crossref PubMed Scopus (97) Google Scholar, 7Watkinson R.J. Hussey H. Baddiley J. Nat. New Biol. 1971; 229: 57-59Crossref PubMed Scopus (29) Google Scholar, 8Rohr T.E. Levy G.N. Stark N.J. Anderson J.S. J. Biol. Chem. 1977; 252: 3460-3465Abstract Full Text PDF PubMed Google Scholar, 9Johnson J.G. Wilson D.B. J. Bacteriol. 1977; 129: 225-236Crossref PubMed Google Scholar, 10van Heijenoort J. Nat. Prod. Rep. 2001; 18: 503-519Crossref PubMed Scopus (361) Google Scholar, 11Raetz C.R. Whitfield C. Annu. Rev. Biochem. 2002; 71: 635-700Crossref PubMed Scopus (3423) Google Scholar, 12Neuhaus F.C. Baddiley J. Microbiol. Mol. Biol. Rev. 2003; 67: 686-723Crossref PubMed Scopus (774) Google Scholar, 13Reeves P.R. Hobbs M. Valvano M.A. Skurnik M. Whitfield C. Coplin D. Kido N. Klena J. Maskell D. Raetz C.R. Rick P.D. Trends Microbiol. 1996; 4: 495-503Abstract Full Text PDF PubMed Scopus (418) Google Scholar, 14Troy F.A. Frerman F.E. Heath E.C. J. Biol. Chem. 1971; 246: 118-133Abstract Full Text PDF PubMed Google Scholar, 15Troy F.A. Vijay I.K. Tesche N. J. Biol. Chem. 1975; 250: 156-163Abstract Full Text PDF PubMed Google Scholar) (Scheme 1). In the peptidoglycan pathway, this lipid is needed for the synthesis and transport of hydrophilic GlcNAc-MurNAc-peptide monomeric motifs across the cytoplasmic membrane to the external sites of polymerization. In other pathways, it can serve as an acceptor for oligosaccharide repeating units or, in some cases, possibly for completed polymers. C55-P is generated from the dephosphorylation of undecaprenyl pyrophosphate (C55-PP), which itself is the product of eight sequential condensations of isopentenyl pyrophosphate with farnesyl pyrophosphate, a reaction catalyzed by the C55-PP synthase UppS (16Apfel C.M. Takacs B. Fountoulakis M. Stieger M. Keck W. J. Bacteriol. 1999; 181: 483-492Crossref PubMed Google Scholar, 17Kato J. Fujisaki S. Nakajima K. Nishimura Y. Sato M. Nakano A. J. Bacteriol. 1999; 181: 2733-2738Crossref PubMed Google Scholar). Several integral membrane proteins exhibiting a C55-PP phosphatase (UppP) activity were recently identified in E. coli (18El Ghachi M. Bouhss A. Blanot D. Mengin-Lecreulx D. J. Biol. Chem. 2004; 279: 30106-30113Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar, 19El Ghachi M. Derbise A. Bouhss A. Mengin-Lecreulx D. J. Biol. Chem. 2005; 280: 18689-18695Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar): the BacA protein and three members from the PAP2 superfamily of phosphatases, YbjG, YeiU, and PgpB. Only the inactivation of these multiple genes was lethal and therefore required to completely deplete cells of the latter essential activity (19El Ghachi M. Derbise A. Bouhss A. Mengin-Lecreulx D. J. Biol. Chem. 2005; 280: 18689-18695Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar). C55-P phosphatase and undecaprenol kinase activities that catalyzed the interconversion of C55-P into undecaprenol (C55-OH) were also earlier detected and purified from extracts of some Gram-positive bacteria but their genes have not been identified to date (20Higashi Y. Strominger J.L. Sweeley C.C. J. Biol. Chem. 1970; 245: 3697-3702Abstract Full Text PDF PubMed Google Scholar, 21Kalin J.R. Allen Jr., C.M. Biochim. Biophys. Acta. 1979; 574: 112-122Crossref PubMed Scopus (21) Google Scholar, 22Willoughby E. Highasi Y. Strominger J.L. J. Biol. Chem. 1972; 247: 5113-5115Abstract Full Text PDF PubMed Google Scholar, 23Sandermann Jr., H. Strominger J.L. J. Biol. Chem. 1972; 247: 5123-5131Abstract Full Text PDF PubMed Google Scholar). In the metabolism of C55-P, the dephosphorylation of C55-PP is the target of bacitracin, a cyclic polypeptide antibiotic which acts by sequestration of the C55-PP substrate (24Storm D.R. Strominger J.L. J. Biol. Chem. 1973; 248: 3940-3945Abstract Full Text PDF PubMed Google Scholar, 25Siewert G. Strominger J.L. Proc. Natl. Acad. Sci. U. S. A. 1967; 57: 767-773Crossref PubMed Google Scholar, 26Stone K.J. Strominger J.L. Proc. Natl. Acad. Sci. U. S. A. 1971; 68: 3223-3227Crossref PubMed Scopus (283) Google Scholar). It was earlier hypothesized that the same step could also be the target of colicin M (27Harkness R.E. Braun V. J. Biol. Chem. 1989; 264: 6177-6182Abstract Full Text PDF PubMed Google Scholar), a class B colicin requiring the outer membrane protein FhuA as a receptor (28Pilsl H. Glaser C. Gross P. Killmann H. Olschlager T. Braun V. Mol. Gen. Genet. 1993; 240: 103-112Crossref PubMed Scopus (54) Google Scholar, 29Kock J. Olschlager T. Kamp R.M. Braun V. J. Bacteriol. 1987; 169: 3358-3361Crossref PubMed Google Scholar, 30Braun V. Schaller K. Wolff H. Biochim. Biophys. Acta. 1973; 323: 87-97Crossref PubMed Scopus (87) Google Scholar). Colicin M exhibits a unique mode of action as it is the only colicin known to inhibit peptidoglycan synthesis and cause cell lysis (31Schaller K. Höltje J.V. Braun V. J. Bacteriol. 1982; 152: 994-1000Crossref PubMed Google Scholar). Interestingly, it was shown to also interfere with lipopolysaccharide O-antigen synthesis (32Harkness R.E. Braun V. J. Biol. Chem. 1989; 264: 14716-14722Abstract Full Text PDF PubMed Google Scholar), suggesting an inhibition of a common step shared by the two pathways. As the C55-P carrier lipid is required in both processes, Harkness and Braun (32Harkness R.E. Braun V. J. Biol. Chem. 1989; 264: 14716-14722Abstract Full Text PDF PubMed Google Scholar) earlier hypothesized that the synthesis or recycling of this compound could be the target of colicin M. To identify the step of peptidoglycan synthesis blocked by colicin M, these authors analyzed the distribution of radiolabeled diaminopimelic acid (A2pm) in pulse-labeled colicin-treated cultures of E. coli and they observed an accumulation of the soluble peptidoglycan precursors (mainly UDP-MurNAc-pentapeptide) and the depletion of the pools of the two lipid intermediates I and II. It was thus concluded that colicin M acted by preventing the regeneration of the lipid carrier but the exact mechanism of action remained unknown and whether this inhibition was direct (e.g. inhibition of C55-PP phosphatase) or indirect was not determined (27Harkness R.E. Braun V. J. Biol. Chem. 1989; 264: 6177-6182Abstract Full Text PDF PubMed Google Scholar). In the present article, the effects of colicin M on peptidoglycan metabolism were reinvestigated. Colicin M was shown to exhibit both in vitro and in vivo enzymatic properties of degradation of the lipid I and lipid II peptidoglycan intermediates. The depletion of the pools of these precursors results in an inhibition of peptidoglycan polymerization steps and cell lysis. To the best of our knowledge, this is the first time such an activity has been described to date. Bacterial Strains, Plasmids, and Growth Conditions—The E. coli strains DH5α (supE44 ΔlacU169 hsdR17 recA1 endA1 gyrA96 thi-1 relA1 Φ80 dlacZ ΔM15) (Invitrogen) was used as the host for plasmids. The FB8r lysA::KmR strain (33Mengin-Lecreulx D. Siegel E. van Heijenoort J. J. Bacteriol. 1989; 171: 3282-3287Crossref PubMed Google Scholar) was used to study the incorporation of radiolabeled meso-A2pm into peptidoglycan. The plasmid vector pTrc99A was from Amersham Biosciences and the construction of pTrcHis30 and pTrcHis60 plasmids has been previously described (34Pompeo F. van Heijenoort J. Mengin-Lecreulx D. J. Bacteriol. 1998; 180: 4799-4803Crossref PubMed Google Scholar). The pTO4 plasmid carrying the cma gene encoding colicin M and the cmi immunity gene has been previously described (35Olschlager T. Schramm E. Braun V. Mol. Gen. Genet. 1984; 196: 482-487Crossref PubMed Scopus (36) Google Scholar). The BW25113 strain and the pKD3 and pKD46 plasmids used for gene disruption experiments (36Datsenko K.A. Wanner B.L. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 6640-6645Crossref PubMed Scopus (11305) Google Scholar) were kindly provided by B. Wanner via the E. coli Genetic Stock Center (Yale University, New Haven). 2YT medium or minimal medium M63 (37Miller J.H. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1972: 431-435Google Scholar) was used for growing cells. Ampicillin, kanamycin, and chloramphenicol were used at 100, 35, and 25 μg·ml−1, respectively. General DNA Techniques and E. coli Cell Transformation— PCR amplification of genes from the E. coli chromosome were performed in a Thermocycler 60 apparatus (Bio-med) using the Expand-Fidelity polymerase from Roche. The DNA fragments were purified using the Wizard PCR Preps DNA purification kit (Promega). Standard procedures for endonuclease digestions, ligation and agarose electrophoresis were used (38Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York1989Google Scholar). Small and large scale plasmid isolations were carried out by the alkaline lysis method (38Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York1989Google Scholar). E. coli cells were made competent for transformation with plasmid DNA by the method of Dagert and Ehrlich (39Dagert M. Ehrlich S.D. Gene (Amst.). 1979; 6: 23-28Crossref PubMed Scopus (849) Google Scholar) or by electroporation. Construction of Expression Plasmids—A plasmid allowing overexpression of the colicin M cma gene was constructed as follows: PCR primers Cma1 and Cma2 (see Table 1) were designed to incorporate an NcoI site 5′ to the initiation codon of the gene and a PstI site 3′ to the gene after the stop codon, respectively. The pTO4 plasmid (35Olschlager T. Schramm E. Braun V. Mol. Gen. Genet. 1984; 196: 482-487Crossref PubMed Scopus (36) Google Scholar) was used as the source of cma gene for the amplification and the resulting DNA fragment was treated with NcoI and PstI and ligated between the same sites of vector pTrc99A. The resulting plasmid, pMLD188, allowed expression of the cma gene under the control of the strong isopropyl-β-d-thiogalactopyranoside (IPTG)-inducible trc promoter.TABLE 1Oligonucleotides used in this studyOligonucleotidesSequenceaRestriction sites (in bold) introduced in oligonucleotides are indicated in parentheses, and the initiation codon of cma gene is underlinedFhuA-Inact1GTTACCGCTGCACCTGCGCCGCAAGAAAGCGCATGGGGGCCTGCTGCAACGTGTAGGCTGGAGCTGCTTCFhuA-Inact2CAGTATAACGACCACCGGTGCCCAGCGTCAGACCTGAAAGCGGACCGTCCATATGAATATCCTCCTTAGFhuA1ATACCCATGGCGCGTTCCAAAACTGCTCAGCC(NcoI)FhuA2AAGAGAGATCTGAAACGGAAGGTTGCGGTTGCAACGACCTG(BglII)Cma1TTATCCATGGAAACCTTAACTGTTCATGCACCATC(NcoI)Cma2CTAACTGCAGGTTATAAAGGCTGCATAAAAAGCCG(PstI)Cma3GGAGGGATCCATGGAAACCTTAACTGTTCATGCAC(BamHI)Cma4CCTTAGATCTTCGCTTACCACTTTCTTTAATGTG(BglII)CmiATTGCTGCAGCCACTTCACAGTATGCTCACATTG(PstI)a Restriction sites (in bold) introduced in oligonucleotides are indicated in parentheses, and the initiation codon of cma gene is underlined Open table in a new tab For expression of N-terminal His6-tagged colicin M, the gene was amplified with primers Cma2 and Cma3 and the resulting fragment was cut with BamHI and PstI and inserted into pTrcHis30, generating plasmid pMLD189. For expression of C-terminal His6-tagged colicin M, the gene was amplified with primers Cma1 and Cma4 and the resulting fragment was cut with NcoI and BglII and inserted into pTrcHis60, generating the plasmid pMLD190. A plasmid carrying both the cma gene and the cmi immunity gene was also constructed: in that case oligonucleotides Cma1 and Cmi were used for PCR amplification from the pTO4 plasmid and the 1.3-kb resulting fragment was cut by NcoI and PstI and inserted between the same sites of the vector pTrc99A, generating pMLD170. In all cases DNA sequencing was performed to determine that the sequence of the cloned fragments was correct. Construction of a Null fhuA Mutant—The E. coli mutant strain BW25113 ΔfhuA::CmR, carrying a deletion of the chromosomal fhuA gene (an internal 1,819-bp fragment of the 2,244-bp gene was deleted and replaced by the chloramphenicol resistance gene), was created by following the method of Datsenko and Wanner (36Datsenko K.A. Wanner B.L. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 6640-6645Crossref PubMed Scopus (11305) Google Scholar). The FhuA-Inact1 and FhuA-Inact2 oligonucleotides (Table 1) were used for PCR amplification of the antibiotic resistance gene from pKD3 flanked by sequences designed for specific disruption of the fhuA gene. The 1.1-kb PCR product was transformed by electroporation into BW25113(pKD46) cells that express phage lambda Red recombinase (36Datsenko K.A. Wanner B.L. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 6640-6645Crossref PubMed Scopus (11305) Google Scholar). Chloramphenicol-resistant clones were isolated, and the inactivation of the fhuA gene was verified by PCR using the FhuA1 and FhuA2 primers. Preparation of Crude Extracts and Purification of Colicin M— BW25113 ΔfhuA::CmR cells carrying plasmids pMLD189 or pMLD190 were grown at 37 °C in 2YT-ampicillin medium (2-liter cultures). When the optical density of the culture reached 1, IPTG was added at a final concentration of 1 mm, and growth was continued for 3 h. Cells were harvested and washed with 40 ml of cold 20 mm potassium phosphate buffer, pH 7.4, containing 0.5 mm MgCl2, 2 mm β-mercaptoethanol, and 150 mm NaCl (buffer A). The cell pellet (∼8 g wet wt) was suspended in 25 ml of the same buffer, and cells were disrupted by sonication in the cold (Bioblock Vibracell sonicator, model 72412). The resulting suspension was centrifuged at 4 °C for 30 min at 200,000 × g in a TL100 Beckman centrifuge. The supernatant (∼400 mg of proteins) was stored at −20 °C. The His6-tagged colicin M was purified basically following the manufacturer's recommendations (Qiagen). Soluble fractions described above were incubated for 1 h at 4 °C with nickel-nitrilotriacetate (Ni2+-NTA)-agarose pre-equilibrated in buffer A. The polymer was then washed extensively with buffer A containing 20 mm imidazole and elution of the protein was obtained by increasing step by step the concentration of imidazole, from 40 to 300 mm, in buffer A. Pure protein-containing fractions (100-200 mm imidazole) were concentrated to 8 ml on a Millipore PM10 membrane and then dialyzed overnight against 100 volumes of buffer A. The final preparations were stored at −20 °C after addition of 15% glycerol. Determination of Colicin M Activity—The bacteriolytic activity of the crude soluble extracts prepared from the colicin M-expressing BW25113 fhuA strain and of the purified His6-tagged colicin M was tested both on plates and in liquid medium. 2YT-agar plates were overlaid with 3 ml of soft nutrient agar containing ∼108 indicator bacteria (BW25113 or DH5α). Serial dilutions (×3) of colicin M-containing solutions were made in buffer A containing 150 mm NaCl and 2-μl samples were spotted on the overlay. Plates were incubated overnight at 37 °C and the titer of the colicin was expressed as the reciprocal of the final dilution still giving a clear spot. When assayed in liquid medium, dilutions of colicin M were added to exponentially growing cells when the optical density at 600 nm reached the value of 0.6. Preparation of UDP-MurNAc-pentapeptide and Derivatives—Unlabeled and radiolabeled forms of UDP-MurNAc-l-[14C]Ala-γ-d-Glu-meso-A2pm-d-Ala-d-Ala were prepared as previously described (40Bouhss A. Crouvoisier M. Blanot D. Mengin-Lecreulx D. J. Biol. Chem. 2004; 279: 29974-29980Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar). 1-Pyrophospho-MurNAc-pentapeptide and 1-phospho-MurNAc-pentapeptide were obtained by treatment of UDP-MurNAc-pentapeptide with periodate (41Lowe P.N. Beechey R.B. Biochemistry. 1982; 21: 4073-4082Crossref PubMed Scopus (59) Google Scholar, 42Maillard A.P. Biarrotte-Sorin S. Villet R. Mesnage S. Bouhss A. Sougakoff W. Mayer C. Arthur M. J. Bacteriol. 2005; 187: 3833-3838Crossref PubMed Scopus (32) Google Scholar) and nucleotide pyrophosphatase (43Abo-Ghalia M. Michaud C. Blanot D. van Heijenoort J. Eur. J. Biochem. 1985; 153: 81-87Crossref PubMed Scopus (28) Google Scholar), respectively. MurNAc-pentapeptide was obtained by mild-acid hydrolysis of UDP-MurNAc-pentapeptide (44van Heijenoort Y. van Heijenoort J. FEBS Lett. 1971; 15: 137-141Crossref PubMed Scopus (17) Google Scholar). These compounds were purified by reverse-phase high performance liquid chromatography (HPLC) and analyzed by mass spectrometry. 1-Pyrophospho-MurNAc-tetrapeptide and 1-pyrophospho-MurNAc-tripeptide were generated by treatments of 1-pyrophospho-MurNAc-pentapeptide with purified penicillin-binding protein PBP5 (45Girardin S.E. Travassos L.H. Hervé M. Blanot D. Boneca I.G. Philpott D.J. Sansonetti P.J. Mengin-Lecreulx D. J. Biol. Chem. 2003; 278: 41702-41708Abstract Full Text Full Text PDF PubMed Scopus (544) Google Scholar) and l,d-carboxypeptidase LdcA (46Stenbak C.R. Ryu J.H. Leulier F. Pili-Floury S. Parquet C. Hervé M. Chaput C. Boneca I.G. Lee W.J. Lemaitre B. Mengin-Lecreulx D. J. Immunol. 2004; 173: 7339-7348Crossref PubMed Scopus (128) Google Scholar), respectively. Synthesis of Radiolabeled C55-PP, Lipid I, and Lipid II—Radiolabeled C55-PP was produced enzymatically by incubating farnesyl pyrophosphate and [14C]isopentenyl pyrophosphate in the presence of pure UppS synthase, as previously described (18El Ghachi M. Bouhss A. Blanot D. Mengin-Lecreulx D. J. Biol. Chem. 2004; 279: 30106-30113Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar). [14C]C55-P was obtained by treatment of [14C]C55-PP with purified BacA phosphatase (18El Ghachi M. Bouhss A. Blanot D. Mengin-Lecreulx D. J. Biol. Chem. 2004; 279: 30106-30113Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar). The reaction mixture (200 μl) containing 100 mm Tris-HCl buffer, pH 7.5, 10 mm MgCl2, 3.9 mm n-dodecyl-β-d-maltoside (DDM), 5 μm [14C]C55-PP (20 kBq), and BacA enzyme (5 μg). The radiolabeled C55-P was recovered by extraction with 1-butyl alcohol and dried under vacuum. The synthesis of lipid I was performed in a reaction mixture (400 μl) consisting in 100 mm Tris-HCl, pH 7.5, 40 mm MgCl2, 1.25 mm C55-P, 150 mm NaCl, 2 mm UDP-MurNAc-pentapeptide, and 8.4 mm N-lauroyl sarcosine. The reaction was initiated by the addition of pure MraY enzyme (40Bouhss A. Crouvoisier M. Blanot D. Mengin-Lecreulx D. J. Biol. Chem. 2004; 279: 29974-29980Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar) (10 μg), and the mixture was incubated for 2 h at 37°C under shaking with a thermomixer (Eppendorf). [14C]lipid I labeled either in the pentapeptide moiety or the C55-P moiety were synthesized as described above for the unlabeled lipid I except that the reaction volume was 20 μl and the concentrations of radiolabeled [14C]C-P and UDP-MurNAc-[14C55]pentapeptide were 0.3 mm and 0.6 mm, respectively. The synthesis of lipid II was performed in a reaction mixture (200 μl) containing 200 mm Tris-HCl, pH 7.5, 10 mm MgCl2, 1 mm lipid I, 2 mm UDP-GlcNAc, and 35% (v/v) Me2SO (47Auger G. van Heijenoort J. Mengin-Lecreulx D. Blanot D. FEMS Microbiol. Lett. 2003; 219: 115-119Crossref PubMed Scopus (32) Google Scholar). The reaction was initiated by the addition of MurG enzyme (48Crouvoisier M. Mengin-Lecreulx D. van Heijenoort J. FEBS Lett. 1999; 449: 289-292Crossref PubMed Scopus (35) Google Scholar)(10 μg), and the mixture was incubated for 2 h at 37 °C under shaking with a thermomixer (Eppendorf). [14C]Lipid II labeled in the GlcNAc residue was synthesized as described above for the unlabeled lipid II except that the reaction volume was 20 μl, and the concentrations of lipid I and radiolabeled UDP-[14C]GlcNAc were 0.3 mm and 0.6 mm, respectively. In all cases, the extraction, analysis and quantification of lipid I and lipid II were performed as described previously (40Bouhss A. Crouvoisier M. Blanot D. Mengin-Lecreulx D. J. Biol. Chem. 2004; 279: 29974-29980Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar). Enzymatic Assays—(i) C55-PP Synthase Assay: the assay was performed in a reaction mixture (20 μl) containing 100 mm HEPES buffer, pH 7.5, 50 mm KCl, 0.5 mm MgCl2, 0.1% Triton X-100, 5 μm farnesyl pyrophosphate, and 50 μm [14C]isopentenyl pyrophosphate (2 kBq). The reaction was initiated by the addition of pure UppS enzyme (1 μg) and when required, colicin M (2.7 μg), and the mixture was incubated for 3 h at 25 °C. (ii) C55-PP Phosphatase Assay: the assay was performed in a reaction mixture (20 μl) containing 100 mm Tris-HCl buffer, pH 7.5, 10 mm MgCl2, 3.9 mm DDM, 5 μm [14C]C55-PP (2,035 Bq), and enzyme: 5 μl of an appropriate dilution (in buffer A supplemented with 3.9 mm DDM) of membranes or pure BacA protein (0.1 μg). When required, colicin M (2.7 μg) was added and the mixture was incubated for 1 h at 37°C. (iii) MraY Translocase Assay: the assay was performed in a reaction mixture (20 μl) containing 100 mm Tris-HCl, pH 7.5, 40 mm MgCl2, 1.1 mm C55-P, 150 mm NaCl, 12.5 μm UDP-MurNAc-[14C]pentapeptide (800 Bq), and 0.2% DDM. The reaction was initiated by the addition of pure MraY enzyme (0.01 μg). When required, 2.7 μg of colicin M was added and the mixture was incubated for 30 min at 37 °C under shaking with a thermomixer (Eppendorf). When E. coli membranes instead of pure MraY enzyme were used, C55-P was omitted. (iv) Standard assay for Colicin M activity: unless otherwise noted, the activity of colicin M was tested in a reaction mixture (20 μl) containing 100 mm Tris-HCl, pH 7.5, 20 mm MgCl2, 150 mm NaCl, 40 μm of 14C-radiolabeled substrate (400 Bq) and 0.2% DDM. The reaction was initiated by the addition of pure colicin M (2.7 μg), and the mixture was incubated for 30 min at 37 °C under shaking with a thermomixer (Eppendorf). In all cases, the reaction was stopped by heating at 100 °C for 1 min, and the mixture was analyzed by thin-layer chromatography (TLC) on silica gel plates LK6D (Whatman) using either 1-propyl alcohol/ammonium hydroxide/water (6:3:1; v/v/v) (solvent system I) or diisobutyl ketone/acetic acid/water (8:5:1, v/v/v) (solvent system II) as a mobile phase. The radioactive spots were located and quantified with a radioactivity scanner (model Multi-Tracemaster LB285; Berthold France). Purification of Lipid I and Lipid II Degradation Products by HPLC—Standard colicin M assays were performed as described above except that lipid I and lipid II (1 nmol) were used in unlabeled form. The reaction mixtures were diluted into 1 ml of 50 mm sodium phosphate buffer, pH 4.5, and applied to a Nucleosil 100C18 5 μm (4.6 × 250 mm, Alltech) column. Elution was performed with the phosphate buffer for 30 min, followed by a linear gradient of methanol from 0 to 20% during the next 30 min, at a flow rate of 0.6 ml·min−1. Peaks were detected at 215 nm. In these conditions the 1-pyrophospho-MurNAc-pentapeptide and 1-pyrophospho-MurNAc-(pentapeptide)-GlcNAc degradation products were eluted at 18 and 40 min, respectively. In the same conditions, pure 1-phospho-Mur-NAc-pentapeptide and the two α and β anomers of MurNAc-pentapeptide were eluted at 28, 34, and 50 min, respectively. The two degradation products were collected, lyophilized, and desalted by gel-filtration on a column of Sephadex G-25 fine. After lyophilization, these compounds were taken up in 10 μlof water and analyzed by mass spectrometry as described below. Matrix-Assisted Laser Desorption/Ionization Time-of-Flight (MALDI-TOF) Mass Spectrometry—MALDI-TOF mass spectra were recorded in the linear mode with delayed extraction on a PerSeptive Voyager-DE STR instrument (Applied Biosystems) equipped with a 337-nm laser. (i) 1-Pyrophospho derivatives: 1 μl of matrix solution (10 mg·ml−1 2,5-dihydroxybenzoic acid in 0.1 m citric acid) was deposited on the plate followed with 2 μl of sample solution. After evaporation of water, spectra were recorded in the negative mode at an acceleration voltage of −20 kV and an extraction delay time of 100 ns. A mixture of UDP-MurNAc, UDP-MurNAc-dipeptide, and UDP-MurNAc-pentapeptide was used as an external cal" @default.
• W2130246821 created "2016-06-24" @default.
• W2130246821 creator A5000323712 @default.
• W2130246821 creator A5013495213 @default.
• W2130246821 creator A5039764758 @default.
• W2130246821 creator A5061709927 @default.
• W2130246821 creator A5068216286 @default.
• W2130246821 creator A5068592665 @default.
• W2130246821 creator A5082261374 @default.
• W2130246821 date "2006-08-01" @default.
• W2130246821 modified "2023-10-03" @default.
• W2130246821 title "Colicin M Exerts Its Bacteriolytic Effect via Enzymatic Degradation of Undecaprenyl Phosphate-linked Peptidoglycan Precursors" @default.
• W2130246821 cites W1488306406 @default.
• W2130246821 cites W1509018654 @default.
• W2130246821 cites W1517875498 @default.
• W2130246821 cites W1520097912 @default.
• W2130246821 cites W1520986587 @default.
• W2130246821 cites W1523447849 @default.
• W2130246821 cites W1525931694 @default.
• W2130246821 cites W1526267918 @default.
• W2130246821 cites W1530956256 @default.
• W2130246821 cites W1532945196 @default.
• W2130246821 cites W1546781414 @default.
• W2130246821 cites W1561625136 @default.
• W2130246821 cites W1567063589 @default.
• W2130246821 cites W1584292656 @default.
• W2130246821 cites W1619892464 @default.
• W2130246821 cites W1630867752 @default.
• W2130246821 cites W1795651393 @default.
• W2130246821 cites W1797890742 @default.
• W2130246821 cites W1859248080 @default.
• W2130246821 cites W1919609509 @default.
• W2130246821 cites W1969882466 @default.
• W2130246821 cites W1988455936 @default.
• W2130246821 cites W1991486518 @default.
• W2130246821 cites W1994647181 @default.
• W2130246821 cites W2003634035 @default.
• W2130246821 cites W2010397557 @default.
• W2130246821 cites W2010589798 @default.
• W2130246821 cites W2019573780 @default.
• W2130246821 cites W2020105562 @default.
• W2130246821 cites W2024745731 @default.
• W2130246821 cites W2030794862 @default.
• W2130246821 cites W2037246097 @default.
• W2130246821 cites W2038246976 @default.
• W2130246821 cites W2040581338 @default.
• W2130246821 cites W2045440171 @default.
• W2130246821 cites W2048271655 @default.
• W2130246821 cites W2053388814 @default.
• W2130246821 cites W2067491825 @default.
• W2130246821 cites W2079289111 @default.
• W2130246821 cites W2079698915 @default.
• W2130246821 cites W2080082312 @default.
• W2130246821 cites W2089857618 @default.
• W2130246821 cites W2091367128 @default.
• W2130246821 cites W2101055681 @default.
• W2130246821 cites W2101830724 @default.
• W2130246821 cites W2105460489 @default.
• W2130246821 cites W2115285167 @default.
• W2130246821 cites W2116137883 @default.
• W2130246821 cites W2125397171 @default.
• W2130246821 cites W2128123492 @default.
• W2130246821 cites W2130534359 @default.
• W2130246821 cites W2131709544 @default.
• W2130246821 cites W2132143686 @default.
• W2130246821 cites W2159131031 @default.
• W2130246821 cites W2167973356 @default.
• W2130246821 cites W2169657688 @default.
• W2130246821 cites W2300552860 @default.
• W2130246821 cites W32309010 @default.
• W2130246821 cites W4234317413 @default.
• W2130246821 cites W4254367279 @default.
• W2130246821 cites W4293247451 @default.
• W2130246821 cites W98902621 @default.
• W2130246821 doi "https://doi.org/10.1074/jbc.m602834200" @default.
• W2130246821 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16777846" @default.
• W2130246821 hasPublicationYear "2006" @default.
• W2130246821 type Work @default.
• W2130246821 sameAs 2130246821 @default.
• W2130246821 citedByCount "107" @default.
• W2130246821 countsByYear W21302468212012 @default.
• W2130246821 countsByYear W21302468212013 @default.
• W2130246821 countsByYear W21302468212014 @default.
• W2130246821 countsByYear W21302468212015 @default.
• W2130246821 countsByYear W21302468212016 @default.
• W2130246821 countsByYear W21302468212017 @default.
• W2130246821 countsByYear W21302468212018 @default.
• W2130246821 countsByYear W21302468212019 @default.
• W2130246821 countsByYear W21302468212020 @default.
• W2130246821 countsByYear W21302468212021 @default.
• W2130246821 countsByYear W21302468212022 @default.
• W2130246821 countsByYear W21302468212023 @default.
• W2130246821 crossrefType "journal-article" @default.
• W2130246821 hasAuthorship W2130246821A5000323712 @default.
• W2130246821 hasAuthorship W2130246821A5013495213 @default.
• W2130246821 hasAuthorship W2130246821A5039764758 @default.
• W2130246821 hasAuthorship W2130246821A5061709927 @default.
• W2130246821 hasAuthorship W2130246821A5068216286 @default.

• next