FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2130927802> ?p ?o ?g. }

• W2130927802 endingPage "9705" @default.
• W2130927802 startingPage "9698" @default.
• W2130927802 abstract "l-Rhamnose is an essential component of the cell wall and plays roles in mediating virulence and adhesion to host tissues in many microorganisms. Glucose-1-phosphate thymidylyltransferase (RmlA, EC 2.7.7.24) catalyzes the first reaction of the four-step pathway of l-rhamnose biosynthesis, producing dTDP-d-glucose from dTTP and glucose-1-phosphate. Three RmlA homologues of varying size have been identified in the genome of a thermophilic archaeon, Sulfolobus tokodaii strain 7. In this study, we report the heterologous expression of the largest homologue (a 401 residue-long ST0452 protein) and characterization of its thermostable activity. RmlA enzymatic activity of this protein was detected from 65 to 100 °C, with a half-life of 60 min at 95 °C and 180 min at 80 °C. Analysis of a deletion mutant lacking the 170-residue C-terminal domain indicated that this region has an important role in the thermostability and activity of the protein. Analyses of substrate specificity indicated that the enzymatic activity of the full-length protein is capable of utilizing α-d-glucose-1-phosphate and N-acetyl-d-glucosamine-1-phosphate but not α-d-glucosamine-1-phosphate. However, the protein is capable of utilizing all four deoxyribonucleoside triphosphates and UTP. Thus, the ST0452 protein is an enzyme containing both glucose-1-phosphate thymidylyltransferase and N-acetyl-d-glucosamine-1-phosphate uridylyltransferase activities. This is the first report of a thermostable enzyme with dual sugar-1-phosphate nucleotidylyltransferase activities. l-Rhamnose is an essential component of the cell wall and plays roles in mediating virulence and adhesion to host tissues in many microorganisms. Glucose-1-phosphate thymidylyltransferase (RmlA, EC 2.7.7.24) catalyzes the first reaction of the four-step pathway of l-rhamnose biosynthesis, producing dTDP-d-glucose from dTTP and glucose-1-phosphate. Three RmlA homologues of varying size have been identified in the genome of a thermophilic archaeon, Sulfolobus tokodaii strain 7. In this study, we report the heterologous expression of the largest homologue (a 401 residue-long ST0452 protein) and characterization of its thermostable activity. RmlA enzymatic activity of this protein was detected from 65 to 100 °C, with a half-life of 60 min at 95 °C and 180 min at 80 °C. Analysis of a deletion mutant lacking the 170-residue C-terminal domain indicated that this region has an important role in the thermostability and activity of the protein. Analyses of substrate specificity indicated that the enzymatic activity of the full-length protein is capable of utilizing α-d-glucose-1-phosphate and N-acetyl-d-glucosamine-1-phosphate but not α-d-glucosamine-1-phosphate. However, the protein is capable of utilizing all four deoxyribonucleoside triphosphates and UTP. Thus, the ST0452 protein is an enzyme containing both glucose-1-phosphate thymidylyltransferase and N-acetyl-d-glucosamine-1-phosphate uridylyltransferase activities. This is the first report of a thermostable enzyme with dual sugar-1-phosphate nucleotidylyltransferase activities. Polysaccharides are the outermost structures on a bacterial cell and play a critical role in the interactions between the bacterium and its immediate environment. Such interactions have been implicated as important factors in the virulence of many pathogens (1Roberts I.S. Annu. Rev. Microbiol. 1996; 50: 285-315Crossref PubMed Scopus (531) Google Scholar). l-Rhamnose was found to be a key component in many bacterial polysaccharides. In Gram-negative bacteria, l-rhamnose is an important residue in the lipopolysaccharide O-antigen, which plays a key role in virulence (2Köplin R. Wang G. Hötte B. Priefer U.B. Pühler A. J. Bacteriol. 1993; 175: 7786-7792Crossref PubMed Google Scholar). In mycobacteria, l-rhamnose is present in the arabinogalactan moiety that links the lipid mycolic acid layer to the inner peptidoglycan (3McNeil M. Daffe M. Brennan P.J. J. Biol. Chem. 1990; 265: 18200-18206Abstract Full Text PDF PubMed Google Scholar). Because the attachment of these two layers by l-rhamnose is important for viability of mycobacteria (4Deng L. Mikusova K. Robuck K.G. Scherman M. Brennan P.J. McNeil M.R. Antimicrob. Agents Chemother. 1995; 39: 694-701Crossref PubMed Scopus (134) Google Scholar) and l-rhamnose is not present in mammalian polysaccharides, the pathway for l-rhamnose biosynthesis represents a potential target for development of antibacterial drugs. dTDP-l-rhamnose is synthesized from dTTP and glucose-1-phosphate by a conserved four-step reaction catalyzed by glucose-1-phosphate thymidylyltransferase (RmlA, EC 2.7.7.24), dTDP-d-glucose 4,6-dehydratase (RmlB, EC 4.2.1.46), dTDP-6-deoxy-d-xylo-4-hexulose 3,5-epimerase (RmlC, EC 5.1.3.13), and dTDP-6-deoxy-l-xylo-4-hexulose reductase (RmlD, EC 1.1.1.133). l-Rhamnose has not previously been identified in any cell wall polymer from archaea (5Kandler O. König H. Cell Mol. Life Sci. 1998; 54: 305-308Crossref PubMed Scopus (140) Google Scholar, 6Niemetz R. Kärcher U. Kandler O. Tindall B.J. König H. Eur. J. Biochem. 1997; 249: 905-911Crossref PubMed Scopus (48) Google Scholar), and biosynthesis of the nucleotide rhamnose in archaea has not been reported. However, putative RmlA–D genes that may encode the four enzymes of the l-rhamnose biosynthesis pathway, RmlA–D, respectively, have been identified in the genomes of some archaeal species, including Pyrococcus horikoshii OT3 (7Kawarabayasi Y. Sawada M. Horikawa H. Haikawa Y. Hino Y. Yamamoto S. Sekine M. Baba S. Kosugi H. Hosoyama A. Nagai Y. Sakai M. Ogura K. Otsuka R. Nakazawa H. Täkamiya M. Ohfuku Y. Funahashi T. Tanaka T. Kudoh Y. Yamazaki J. Kushida N. Oguchi A. Aoki K. Kikuchi H. DNA Res. 1998; 5: 147-155Crossref PubMed Scopus (132) Google Scholar), Archaeoglobus fulgidus (8Klenk H.P. Clayton R.A. Tomb J.F. White O. Nelson K.E. Ketchum K.A. Dodson R.J. Gwinn M. Hickey E.K. Peterson J.D. Richardson D.L. Kerlavage A.R. Graham D.E. Kyrpides N.C. Fleischmann R.D. Quackenbush J. Lee N.H. Sutton G.G. Gill S. Kirkness E.F. Dougherty B.A. McKenney K. Adams M.D. Loftus B. Peterson S. Reich C.I. McNeil L.K. Badger J.H. Glodek A. Zhou L. Overbeek R. Gocayne J.D. Weidman J.F. McDonald L. Utterback T. Cotton M.D. Spriggs T. Artiach P. Kaine B.P. Sykes S.M. Sadow P.W. D'Andrea K.P. Bowman C. Fujii C. Garland S.A. Mason T.M. Olsen G.J. Fraser C.M. Smith H.O. Woese C.R. Venter J.C. Nature. 1997; 390: 364-370Crossref PubMed Scopus (1207) Google Scholar), Sulfolobus solfataricus (9She Q. Singh R.K. Confalonieri F. Zivanovic Y. Allard G. Awayez M.J. Chan-Weiher C.C. Clausen I.G. Curtis B.A. De Moors A. Erauso G. Fletcher C. Gordon P.M. Heikamp-de Jong I. Jeffries A.C. Kozera C.J. Medina N. Peng X. Thi-Ngoc H.P. Redder P. Schenk M.E. Theriault C. Tolstrup N. Charlebois R.L. Doolittle W.F. Duguet M. Gaasterland T. Garrett R.A. Ragan M.A. Sensen C.W. Van der Oost J. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 7835-7840Crossref PubMed Scopus (673) Google Scholar), and Sulfolobus tokodaii strain 7 (10Kawarabayasi Y. Hino Y. Horikawa H. Jin-no K. Takahashi M. Sekine M. Baba S. Ankai A. Kosugi H. Hosoyama A. Fukui S. Nagai Y. Nishijima K. Otsuka R. Nakazawa H. Takamiya M. Kato Y. Yoshizawa T. Tanaka T. Kudoh Y. Yamazaki J. Kushida N. Oguchi A. Aoki K. Masuda S. Yanagii M. Nishimura M. Yamagishi A. Oshima T. Kikuchi H. DNA Res. 2001; 8: 123-140Crossref PubMed Scopus (277) Google Scholar). In S. tokodaii strain 7, a gene cluster containing RmlA–D, which includes the ST1971, ST1972, ST1969, and ST1970 ORFs, 1The abbreviations used are: ORF, open reading frame; HPLC, high pressure liquid chromatography. has been identified. Such a cluster structure for genes encoding RmlA–D is conserved in most microorganisms. In S. tokodaii strain 7, in addition to the RmlA included in this cluster, two other ORFs, ST0452 and ST2352, have been identified as RmlA homologues. However, both ST0452 and ST2352 are located at genomic sites remote from the cluster encoding RmlA–D. It is known that RmlA catalyzes the first step in the l-rhamnose biosynthesis pathway, producing dTDP-d-glucose from dTTP and glucose-1-phosphate, and is the key enzyme for feedback control of the entire l-rhamnose biosynthesis pathway (11Melo A. Glaser L. J. Biol. Chem. 1965; 240: 398-405Abstract Full Text PDF PubMed Google Scholar). Comparison of the putative products of the RmlA-like ORFs indicated that the ST0452 protein would be the largest, mainly because of an additional C-terminal domain. To determine whether the putative protein encoded by ST0452 actually functions as an RmlA enzyme, and what function the extra C-terminal region has, the ST0452 ORF was cloned and expressed in Escherichia coli. Here, we present evidence that ST0452 encodes an extremely thermostable enzyme with RmlA activity. Analysis of substrate specificity indicated that the enzyme possesses two distinct sugar-1-phosphate nucleotidylyltransferase activities: glucose-1-phosphate thymidylytransferase and N-acetyl-d-glucosamine-1-phosphate uridylyltransferase. Analysis of a deletion mutant indicated that the 170-residue C-terminal region plays an important role for the thermostability of this protein. This is the first report to identify a thermostable enzyme with dual sugar-1-phosphate nucleotidylyltransferase activities. Materials—ATP, CTP, GTP, UTP, dATP, dCTP, dGTP, dTTP, ADP-d-glucose, GDP-d-glucose, dTDP-d-glucose, UDP-d-glucose, UDP-N-acetyl-d-glucosamine, and all sugar-1-phosphates were purchased from Sigma. The restriction enzymes and ligase used in this work were purchased from New England BioLabs, Inc. (Beverly, MA). The KOD-plus DNA polymerase used for PCR amplification was purchased from Toyobo. Co., Ltd. (Osaka, Japan). The plasmid vector pET21(b) was purchased from Novagen (Madison, WI). S. tokodaii strain 7 (JCM10545) was obtained from the Japan Collection of Microorganisms. E. coli strain DH5α was obtained from Takara Bio Inc. (Otsu, Shiga, Japan) for plasmid cloning and the strain BL21-Codon Plus (DE3)-RIL was obtained from Stratagene (La Jolla, CA) for expression of recombinant protein. Construction of Expression Vectors—To amplify and clone the ST0452 ORF, the primer P1 (ATAGCATATGAAGGCATTTATTCTTGCTGC) was designed from the 5′ sequence of ST0452, and primers P2 (TCAACTCGAGCTAGACCTTGAAAAACTCACC) and P3 (TCAACTCGAGGACCTTGAAAAACTCACC) were designed from the 3′ sequence of ST0452. Primer P1 contained an NdeI site, and primers P2 and P3 contained XhoI sites for cloning into the pET21(b) vector. To enable the expression of wild-type gene product from ST0452, primers P1 and P2 were used for PCR amplification. To obtain recombinant protein fused with a histidine tag at the C terminus, primers P1 and P3 were used for PCR amplification. Ten nanograms of S. tokodaii strain 7 genomic DNA and 100 pmol of each primer were added to 50 μl of standard PCR mixture. 25 cycles with a temperature profile of 30 s at 94 °C, 30 s at 55 °C, and 1 min at 68 °C were performed with 1 unit of KOD-plus DNA polymerase. The PCR products were digested with NdeI and XhoI and ligated with vector pET21(b) digested with the same restriction enzymes. After confirmation of their nucleotide sequences, the plasmids possessing the ST0452 coding region without and with the histidine tag were referred to as pST0452 and pST0452H, respectively. To construct the expression vector for a C-terminal deleted ST0452 gene product with the histidine tag at the C terminus, the primer P4 (TCAACTCGAGATTTTGACTAAATACAAGATTATCTAAAGC) was designed from the nucleotide sequence 510 bp upstream from the stop codon. The product of the PCR using primers P1 and P4 was digested with the restriction enzymes NdeI and XhoI and then ligated with the vector pET21(b). This plasmid construct was designated as pST0452(N231)H. Expression and Purification of Recombinant Protein—After confirmation of expression vector constructs by sequencing, these vectors were introduced into the E. coli strain BL21-Codon Plus (DE3)-RIL cells. Transformed E. coli was grown in 2 ml of LB medium containing 100 μg/ml ampicillin and 50 μg/ml chloramphenicol at 37 °C until the A600 reached 0.6. Isopropyl β-d-thiogalactopyranoside was added to a final concentration of 0.1 mm, and aeration was continued for 4 h at 37 °C to induce expression of recombinant proteins. After induction, the cells were collected by centrifugation at 5,000 × g for 5 min and suspended in 100 μl of 20 mm sodium phosphate buffer (pH 7.4) and 0.5 m NaCl. The suspended cells were ruptured by sonication with a Bioruptor (Cosmo Bio Co. Ltd., Tokyo, Japan), using 10 cycles of 30-s pulses followed by a 30-s rest on ice. The suspension was centrifuged at 20,000 × g for 10 min, and the supernatant was collected as the soluble fraction. The soluble fraction was treated at 80 °C for 20 min and then centrifuged at 20,000 × g for 10 min. Proteins contained in 10 μl of supernatant were separated by 0.1% SDS, 12% polyacrylamide gel electrophoresis and detected with Coomassie Brilliant Blue R-250. Recombinant proteins expressed in E. coli strain BL21-Codon Plus (DE3)-RIL harboring pST0452H and pST0452(N231)H were purified by the nickel-loaded HiTrap Chelating HP column (Amersham Biosciences) according to the manufacturer's protocol. The fractions collected were dialyzed against 50 mm Tris-HCl (pH 7.5). Purified protein was stored at 4 °C. The protein concentration of the pure fraction was determined by the BCA protein assay reagent kit (Pierce). Enzyme Assays—Enzymatic activity of the recombinant protein was analyzed by the method described by Lindquist et al. (12Lindquist L. Kaiser R. Reeves P.R. Lindberg A.A. Eur. J. Biochem. 1993; 211: 763-770Crossref PubMed Scopus (66) Google Scholar) with some modification. The assay for the reaction producing the dTDP-d-glucose from α-d-glucose-1-phosphate and dTTP, the forward reaction, was performed in a 30-μl reaction mixture containing 50 mm Tris-HCl (pH 7.5), 2 mm MgCl2, 10 mm α-d-glucose-1-phosphate, 0.1 mm dTTP, and 0.05 μg of purified recombinant protein. After 2 min of preincubation at 80 °C, the reaction was started by the addition of the recombinant protein and progressed at 80 °C for 5 min as a standard. The reaction mixture was immediately mixed with 300 μl of 500 mm KH2PO4 to stop the reaction. A 50-μl aliquot of the solution was analyzed on a Waters LC module I plus (Waters, Milford, MA) HPLC system with a 0.46 × 25-cm column of Wakosil 5C18–200 (Wako, Osaka, Japan). The flow rate of 500 mm KH2PO4 was maintained at 1 ml/min. The product of the reaction, dTDP-d-glucose, was monitored by absorbance at 254 nm, and the amount of product was calculated from the area under the peaks. The assay for the formation of dTTP from dTDP-d-glucose and pyrophosphate, the reverse reaction, was performed in 30 μl of reaction mixture containing 50 mm Tris-HCl (pH 7.5), 2 mm MgCl2, 1 mm pyrophosphate, 0.1 mm dTDP-d-glucose, and 0.05 μg of purified recombinant protein. The reaction conditions and detection of the product, dTTP, were identical to those used for the forward reaction. Construction of Expression Vector for ST0452—The 1206-bp ST0452 ORF was predicted to be a homologue of RmlA on the basis of sequence similarity. A putative 401-amino acid residue gene product of ST0452 showed 26–30% identity with the RmlA enzymes from Salmonella enterica (13Li Q. Reeves P.R. Microbiology. 2000; 146: 2291-2307Crossref PubMed Scopus (53) Google Scholar), Shigella flexneri (14Macpherson D.F. Manning P.A. Morona R. Mol. Microbiol. 1994; 11: 281-292Crossref PubMed Scopus (71) Google Scholar), Mycobacterium tuberculosis (15Ma Y. Mills J.A. Belisle J.T. Vissa V. Howell M. Bowlin K. Scherman M.S. McNeil M. Microbiology. 1997; 143: 937-945Crossref PubMed Scopus (58) Google Scholar), Pseudomonas aeruginosa (16Blankenfeldt W. Asuncion M. Lam J.S. Naismith J.H. EMBO J. 2000; 19: 6652-6663Crossref PubMed Scopus (162) Google Scholar), and E. coli (17Zuccotti S. Zanardi D. Rosano C. Sturla L. Tonetti M. Bolognesi M. J. Mol. Biol. 2001; 313: 831-843Crossref PubMed Scopus (93) Google Scholar). Amino acid sequences for the nucleotide and sugar-binding motifs, the exact sequences of which are (G)GXGTRX9K and EKPXXPXS, respectively (18Thorson J.S. Kelly T.M. Liu H.W. J. Bacteriol. 1994; 176: 1840-1849Crossref PubMed Google Scholar), were identified in ST0452 as shown in Fig. 1. In comparison with the RmlA from E. coli and P. aeruginosa, the protein encoded by ST0452 has an additional ∼170-residue domain at the C terminus. A putative ribosome-binding site, GGTAAT, and a putative promoter consensus sequence, TTTAAC, were identified at 4 and 19 bases, respectively, upstream from the translation initiation codon for ST0452. Based on these elements, ST0452 was expected to be transcriptionally active in S. tokodaii strain 7 cells. To investigate the function of the ST0452-encoded protein, two expression vectors, pST0452 and pST0452H, were constructed according to the procedure described under “Experimental Procedures.” Expression and Purification of the ST0452 Protein—Recombinant protein with or without a histidine tag at the C-terminal region was obtained from E. coli harboring the plasmids pST0452H and pST0452, respectively. As shown in lane 1 in Fig. 2, recombinant protein with a histidine tag was detected in the soluble fraction. This recombinant protein remained soluble after 20 min of treatment at 80 °C, as shown in lane 2 in Fig. 2. Hence, the recombinant protein with a histidine tag was purified by nickel affinity column chromatography after heating. As Fig. 2 also shows, SDS-PAGE detected a purified protein as a single band with an approximate molecular mass of 46 kDa, consistent with the molecular mass expected from the nucleotide sequence. The purified recombinant protein was used in the following enzymatic analyses. RmlA Activity of the Recombinant Protein—RmlA activity, catalyzing the forward reaction that produces dTDP-d-glucose from dTTP and α-d-glucose-1-phosphate, was analyzed using purified recombinant protein fused with a histidine tag, because this species, partially purified by heat treatment, possessed identical RmlA activity to the wild-type recombinant protein (data not shown). As shown in Fig. 3A, dTTP and dTDP-d-glucose were independently detected as peaks with different elution times on the Wakosil 5C18–200 column. Consequently, time-dependent formation and accumulation of dTDP-d-glucose was observed when dTTP and α-d-glucose-1-phosphate were incubated with the recombinant protein at 80 °C for the different periods indicated in Fig. 3B. Activity catalyzing the reverse reaction of RmlA, which produces dTTP from dTDP-d-glucose and pyrophosphate, was also detected in this recombinant protein (data not shown). These results demonstrate that the recombinant protein encoded by ST0452 indeed exhibits thermostable RmlA activity. Optimal pH, Optimal Temperature, and Thermostability for RmlA Activity—The effect of pH on the forward reaction of RmlA activity was analyzed using three different solutions: acetate-NaOH buffer for pH 5, 4-morpholineethanesulfonic acid-NaOH buffer for pH 6, and Tris-HCl buffer for pH 7–10. The recombinant protein exhibited relatively high activity around pH 7.5 and 9, with maximum activity at pH 8.5 (Fig. 4A). This optimal pH is considerably different from that of the surrounding environment for growth of the host cell, which is between pH 2 and 4, indicating that the intracellular environment of S. tokodaii strain 7 might be maintained at approximately neutral pH. Because the recombinant protein was originally cloned from a thermophilic archaeon, S. tokodaii strain 7, which grows optimally at 80 °C, the temperature dependence of the enzymatic activity was analyzed between 37 and 100 °C. As shown in Fig. 4B, the enzyme had relatively high activity between 80 and 100 °C with a maximum at 95 °C. Because the activity was greatest at high temperatures, the stability of the protein at those temperatures was examined. Purified recombinant protein, 0.05 mg/ml in 50 mm Tris-HCl (pH 7.5) and 2 mm MgCl2 was treated at 80 or 95 °C for the periods indicated in Fig. 4C, and then the relative activity was measured by the standard assay. The half-life of the enzyme at 95 °C was about 60 min but was 180 min at 80 °C. This indicates that the protein encoded by ST0452 is an extremely thermostable enzyme. Effect of Metal Ions on RmlA Activity—Because it is well known that the nucleotide- or nucleic acid-modifying enzymes require metal ions for catalytic activity, the effects of different metal ions on the forward reaction catalyzed by the recombinant protein were investigated. As indicated in Table I, the enzymatic activity of the recombinant protein has an absolute requirement for a divalent cation, with no RmlA activity detectable when a divalent cation was absent from the reaction buffer. The order of effectiveness of metal ions on the activity of the enzyme was Co2+ > Mn2+ > Mg2+ and Zn2+. Because Mg2+ was the most common of these metal ions in the reaction buffer, the effect of Mg2+ concentration was measured in reaction mixtures containing 2–12 mm MgCl2. The results indicated that the optimal Mg2+ concentration was 6 mm, but the enzymatic activity did not change substantially between 2 and 12 mm (data not shown).Table IRmlA activities of the recombinant protein in the presence of different metal ions The metal ion concentration used was 2 mm. The assay conditions were as described under “Experimental Procedures.” The relative activity is shown as a percentage of the activity detected for Mg2+. ND, not detected.Metal ionSpecific activityRelative activityμmol/min/mg protein%Co2+3.21 ± 0.17243Mn2+2.17 ± 0.07164Mg2+1.32 ± 0.07100Zn2+0.95 ± 0.0372Ca2+NDNDNoneNDND Open table in a new tab Kinetic Constants for RmlA Activity—To determine the effect of substrate concentration on the enzymatic activity, double reciprocal plots of initial velocity were performed. Calculation of Km for each substrate was performed under conditions where the concentration of the second substrate was 5–10 times higher than its Km value. Because the protein had relatively high activity with dTTP and α-d-glucose-1-phosphate as the substrate combination, the kinetic constants were determined for these substrates. For the forward reaction of RmlA, the apparent Km values for dTTP and α-d-glucose-1-phosphate were 0.02 ± 0.002 and 1.12 ± 0.04 mm, respectively. As indicated in Table II, the Vmax for the forward reaction was 1.46 ± 0.025 μmol/min/mg. The kinetic constants for the reverse reaction catalyzed by RmlA activity were determined as indicated in the previous section. The calculated Km values for dTDP-d-glucose and pyrophosphate were 0.05 ± 0.009 and 0.39 ± 0.028 mm, respectively.Table IIKinetic properties for the RmlA activity of the ST0452 recombinant proteinSubstrateKmVmaxmMμmol/min/mg proteinForward reactiondTTP0.02 ± 0.0021.46 ± 0.025α-d-glucose-1-phosphate1.12 ± 0.040Reverse reactiondTDP-d-glucose0.05 ± 0.00913.65 ± 1.306Pyrophosphate0.39 ± 0.028 Open table in a new tab Substrate Specificity of the Recombinant Enzyme—The report by Lidquist et al. (12Lindquist L. Kaiser R. Reeves P.R. Lindberg A.A. Eur. J. Biochem. 1993; 211: 763-770Crossref PubMed Scopus (66) Google Scholar) indicated that the RmlA protein from S. enterica was capable of utilizing several different sugar-1-phosphates and nucleoside triphosphates as substrates. Consequently, the specificity of the ST0452 recombinant protein for various nucleoside triphosphates (0.1 mm) and sugar-1-phosphates (10 mm) in the forward reaction was examined under the standard assay conditions. Initially, the specificity for various nucleoside triphosphates was examined. When α-d-glucose-1-phosphate was utilized as an acceptor substrate, the highest activity was with UTP, which was 1.2 times higher than that with dTTP. As shown in Table III, enzymatic activity with dCTP, dGTP, and dATP was 110, 47, and 40%, respectively, of the level of activity with dTTP. These results indicate that the enzyme is capable of utilizing all four major deoxyribonucleoside triphosphates as substrates but only UTP of the ribonucleoside triphosphates. Because high activity was obtained with the combination of dTTP or UTP and α-d-glucose-1-phosphate, the effect of various sugar-1-phosphate species on enzymatic activity was analyzed using both dTTP and UTP.Table IIISubstrate specificity of the ST0452 enzyme ND, not detected.Direction of reactionSubstrate ASubstrate BSpecific activityμmol/min/mg proteinForwarddTTPα-d-Glucose-1-phosphate1.35 ± 0.09dCTP1.46 ± 0.10dGTP0.62 ± 0.06dATP0.53 ± 0.09UTP1.57 ± 0.16ATP/CTP/GTPNDdTTPN-Acetyl-glucosamine-1-phosphate7.87 ± 0.39α-d-Glucosamine-1-phosphateNDα-d-Galactose-1-phosphateNDα-d-Mannose-1-phosphateNDUTPN-Acetyl-glucosamine-1-phosphate6.42 ± 0.29α-d-Glucosamine-1-phosphateNDα-d-Galactose-1-phosphateNDα-d-Mannose-1-phosphateNDReversedTDP-d-glucosePyrophosphate9.40 ± 0.87UDP-d-glucose7.48 ± 0.35UDP-N-acetyl-d-glucosamine16.34 ± 0.47GDP-d-glucoseND Open table in a new tab As shown in Table III, the highest activity was detected with N-acetyl-d-glucosamine-1-phosphate in the presence of dTTP or UTP. The activity with N-acetyl-d-glucosamine-1-phosphate combined with dTTP or UTP was 5.8 and 3.4 times higher, respectively, than the corresponding activity with α-d-glucose-1-phosphate. Other sugar-1-phosphates tested, including α-d-galactose-1-phosphate, α-d-glucosamine-1-phosphate, and α-d-mannose-1-phosphate, were not utilized as substrates by the recombinant protein. These results indicated that the high activity of the recombinant protein was detected when dTTP or UTP and α-d-glucose-1-phosphate or N-acetyl-d-glucosamine-1-phosphate were used as substrates. Previous studies have indicated that RmlA is capable of utilizing α-d-galactose-1-phosphate and α-d-glucosamine-1-phosphate as substrates but not N-acetyl-d-glucosamine-1-phosphate (12Lindquist L. Kaiser R. Reeves P.R. Lindberg A.A. Eur. J. Biochem. 1993; 211: 763-770Crossref PubMed Scopus (66) Google Scholar). In addition, an N-acetylglucosamine-1-phosphate uridyltranferase (GlmU) enzyme capable of utilizing N-acetyl-d-glucosamine-1-phosphate could only utilize UTP but not dTTP as a nucleotide substrate (19Brown K. Pompeo F. Dixon S. Mengin-Lecreulx D. Cambillau C. Bourne Y. EMBO J. 1999; 18: 4096-4107Crossref PubMed Scopus (168) Google Scholar). Therefore, the enzymatic activity possessed by the ST0452 protein is distinctly different from that of other nucleotidylyltransferases (12Lindquist L. Kaiser R. Reeves P.R. Lindberg A.A. Eur. J. Biochem. 1993; 211: 763-770Crossref PubMed Scopus (66) Google Scholar, 19Brown K. Pompeo F. Dixon S. Mengin-Lecreulx D. Cambillau C. Bourne Y. EMBO J. 1999; 18: 4096-4107Crossref PubMed Scopus (168) Google Scholar). Because the enzymatic activity of the recombinant protein was shown to have a broad substrate specificity in the forward reaction, the substrate specificity in the reverse reaction was analyzed with sugar nucleotides at a concentration of 0.1 mm. Production of dTTP, UTP, or UTP was detected when dTDP-d-glucose, UDP-d-glucose, or UDP-N-acetyl-d-glucosamine, respectively, was used as the substrate. However, GTP was not detected when GDP-d-glucose was used as substrate, as was the case in the corresponding forward reaction. The highest activity was detected with UDP-N-acetyl-d-glucosamine, followed by dTDP-d-glucose and UDP-d-glucose. Role of the C-terminal Domain of the Recombinant Protein—In contrast with RmlA from E. coli, the protein encoded by ST0452 has an additional 170-residue C-terminal domain. To determine the function of this region, a plasmid vector containing a truncated gene encoding a protein lacking the 170-residue C-terminal domain was constructed. For this purpose, the 231st amino acid was directly fused to the histidine tag sequence in pET21(b); the resulting plasmid was designated pST0452(N231)H. The truncated protein, ST0452(N231)H, was expressed in E. coli and purified by nickel affinity column chromatography. Fig. 5 indicates that ST0452(N231)H remained soluble after treatment at 60 °C or below for 5 min but was precipitated after heating above 70 °C. This indicated that the tertiary structure of this truncated protein was drastically changed between 60 and 70 °C. This truncated enzyme, with decreased thermostability, was also analyzed for RmlA activity. Although the truncated protein did not precipitated until 60 °C when analyzed by SDS-PAGE, it was not expected to possess the complete RmlA activity exhibited by the full-length enzyme. Therefore, analyses of RmlA activity for both the truncated and the full-length ST0452 proteins were performed at 37 °C, the optimal temperature for the E. coli enzyme. It was shown that the truncated protein exhibited RmlA activity with a specific initial velocity of 1.59 ± 0.03 nmol/min/mg protein; this value was 23 times lower than that of the native enzyme when measured at 37 °C, which was 36.72 ± 2.01 nmol/min/mg protein. The fact that the truncated enzyme possessed residual RmlA activity promoted the next question, which was whether the radical structural change induced by heat treatment affected the enzymatic activity. To determine this, N-acetyl-d-glucosamine-1-phosphate uridyltransferase activity remaining after 5 min of treatment of the truncated enzyme at different temperatures was measured. As shown in Fig. 6, N-acetyl-d-glucosamine-1-phosphate uridylyltransferase activity remained in the truncated enzyme after 5 min of heating at 65 °C but was completely removed by treatment over 70 °C. These results indicated that the additional C-terminal domain of ST0452 plays an important role in both the thermostability" @default.
• W2130927802 created "2016-06-24" @default.
• W2130927802 creator A5002278218 @default.
• W2130927802 creator A5002612935 @default.
• W2130927802 creator A5021583038 @default.
• W2130927802 creator A5027264754 @default.
• W2130927802 creator A5043683696 @default.
• W2130927802 creator A5069668883 @default.
• W2130927802 date "2005-03-01" @default.
• W2130927802 modified "2023-10-16" @default.
• W2130927802 title "Identification of an Extremely Thermostable Enzyme with Dual Sugar-1-phosphate Nucleotidylyltransferase Activities from an Acidothermophilic Archaeon, Sulfolobus tokodaii strain 7" @default.
• W2130927802 cites W1482481751 @default.
• W2130927802 cites W1538201642 @default.
• W2130927802 cites W1596437127 @default.
• W2130927802 cites W1608218663 @default.
• W2130927802 cites W1921879758 @default.
• W2130927802 cites W1978801963 @default.
• W2130927802 cites W1982121527 @default.
• W2130927802 cites W2000663107 @default.
• W2130927802 cites W2002170620 @default.
• W2130927802 cites W2013595954 @default.
• W2130927802 cites W2015091013 @default.
• W2130927802 cites W2015935547 @default.
• W2130927802 cites W2067043700 @default.
• W2130927802 cites W2103282423 @default.
• W2130927802 cites W2110612352 @default.
• W2130927802 cites W2124894558 @default.
• W2130927802 cites W2128639098 @default.
• W2130927802 cites W2150412933 @default.
• W2130927802 cites W2152291739 @default.
• W2130927802 cites W2166526453 @default.
• W2130927802 cites W27750664 @default.
• W2130927802 cites W4237258603 @default.
• W2130927802 doi "https://doi.org/10.1074/jbc.m411211200" @default.
• W2130927802 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15598657" @default.
• W2130927802 hasPublicationYear "2005" @default.
• W2130927802 type Work @default.
• W2130927802 sameAs 2130927802 @default.
• W2130927802 citedByCount "43" @default.
• W2130927802 countsByYear W21309278022012 @default.
• W2130927802 countsByYear W21309278022013 @default.
• W2130927802 countsByYear W21309278022014 @default.
• W2130927802 countsByYear W21309278022015 @default.
• W2130927802 countsByYear W21309278022017 @default.
• W2130927802 countsByYear W21309278022018 @default.
• W2130927802 countsByYear W21309278022019 @default.
• W2130927802 countsByYear W21309278022020 @default.
• W2130927802 countsByYear W21309278022021 @default.
• W2130927802 countsByYear W21309278022022 @default.
• W2130927802 crossrefType "journal-article" @default.
• W2130927802 hasAuthorship W2130927802A5002278218 @default.
• W2130927802 hasAuthorship W2130927802A5002612935 @default.
• W2130927802 hasAuthorship W2130927802A5021583038 @default.
• W2130927802 hasAuthorship W2130927802A5027264754 @default.
• W2130927802 hasAuthorship W2130927802A5043683696 @default.
• W2130927802 hasAuthorship W2130927802A5069668883 @default.
• W2130927802 hasBestOaLocation W21309278021 @default.
• W2130927802 hasConcept C104317684 @default.
• W2130927802 hasConcept C105702510 @default.
• W2130927802 hasConcept C116834253 @default.
• W2130927802 hasConcept C181199279 @default.
• W2130927802 hasConcept C185592680 @default.
• W2130927802 hasConcept C2777108408 @default.
• W2130927802 hasConcept C2778022156 @default.
• W2130927802 hasConcept C2778644216 @default.
• W2130927802 hasConcept C550995028 @default.
• W2130927802 hasConcept C55493867 @default.
• W2130927802 hasConcept C59822182 @default.
• W2130927802 hasConcept C86803240 @default.
• W2130927802 hasConceptScore W2130927802C104317684 @default.
• W2130927802 hasConceptScore W2130927802C105702510 @default.
• W2130927802 hasConceptScore W2130927802C116834253 @default.
• W2130927802 hasConceptScore W2130927802C181199279 @default.
• W2130927802 hasConceptScore W2130927802C185592680 @default.
• W2130927802 hasConceptScore W2130927802C2777108408 @default.
• W2130927802 hasConceptScore W2130927802C2778022156 @default.
• W2130927802 hasConceptScore W2130927802C2778644216 @default.
• W2130927802 hasConceptScore W2130927802C550995028 @default.
• W2130927802 hasConceptScore W2130927802C55493867 @default.
• W2130927802 hasConceptScore W2130927802C59822182 @default.
• W2130927802 hasConceptScore W2130927802C86803240 @default.
• W2130927802 hasIssue "10" @default.
• W2130927802 hasLocation W21309278021 @default.
• W2130927802 hasOpenAccess W2130927802 @default.
• W2130927802 hasPrimaryLocation W21309278021 @default.
• W2130927802 hasRelatedWork W1850986032 @default.
• W2130927802 hasRelatedWork W1968721630 @default.
• W2130927802 hasRelatedWork W1998948129 @default.
• W2130927802 hasRelatedWork W2024227697 @default.
• W2130927802 hasRelatedWork W2029732200 @default.
• W2130927802 hasRelatedWork W2080203695 @default.
• W2130927802 hasRelatedWork W2361964297 @default.
• W2130927802 hasRelatedWork W2411638873 @default.
• W2130927802 hasRelatedWork W4236524246 @default.
• W2130927802 hasRelatedWork W4242974861 @default.
• W2130927802 hasVolume "280" @default.
• W2130927802 isParatext "false" @default.
• W2130927802 isRetracted "false" @default.

• next