FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2131208049> ?p ?o ?g. }

• W2131208049 endingPage "35867" @default.
• W2131208049 startingPage "35859" @default.
• W2131208049 abstract "NOD2/CARD15 is the first characterized susceptibility gene in Crohn disease. The Nod2 1007fs (Nod2fs) frameshift mutation is the most prevalent in Crohn disease patients. Muramyl dipeptide from bacterial peptidoglycan is the minimal motif detected by Nod2 but not by Nod2fs. Here we investigated the response of human peripheral blood mononuclear cells (PBMCs) from Crohn disease patients not only to muramyl dipeptide but also to several other muramyl peptides. Most unexpectedly, we observed that patients homozygous for the Nod2fs mutation were totally unresponsive to MurNAc-l-Ala-d-Glu-meso-diaminopimelic acid (DAP) (M-TriDAP), the specific agonist of Nod1, and to Gram-negative bacterial peptidoglycan. In contrast, PBMCs from a patient homozygous for the Nod2 R702W mutation, also associated with Crohn disease, displayed normal response to Gram-negative bacterial peptidoglycan. In addition, the blockage of the Nod1/M-TriDAP pathway could be partially overcome by co-stimulation with the Toll-like receptors agonists lipoteichoic acid or lipopolysaccharide. Investigation into the mechanism of this finding revealed that Nod2fs did not act as a dominant-negative molecule for the Nod1/M-TriDAP pathway, implying that the blockage is dependent upon the expression or activity of other factors. We demonstrated that PBMCs from Nod2fs patients express high levels of the peptidoglycan recognition protein S, a secreted protein known to interact with muramyl peptides. We proposed that through a scavenger function, peptidoglycan recognition protein S may dampen M-TriDAP-dependent responses in Nod2fs patients. Together, our results identified a cross-talk between the Nod1 and Nod2 pathways and suggested that down-regulation of Nod1/M-TriDAP pathway may be associated with Crohn disease. NOD2/CARD15 is the first characterized susceptibility gene in Crohn disease. The Nod2 1007fs (Nod2fs) frameshift mutation is the most prevalent in Crohn disease patients. Muramyl dipeptide from bacterial peptidoglycan is the minimal motif detected by Nod2 but not by Nod2fs. Here we investigated the response of human peripheral blood mononuclear cells (PBMCs) from Crohn disease patients not only to muramyl dipeptide but also to several other muramyl peptides. Most unexpectedly, we observed that patients homozygous for the Nod2fs mutation were totally unresponsive to MurNAc-l-Ala-d-Glu-meso-diaminopimelic acid (DAP) (M-TriDAP), the specific agonist of Nod1, and to Gram-negative bacterial peptidoglycan. In contrast, PBMCs from a patient homozygous for the Nod2 R702W mutation, also associated with Crohn disease, displayed normal response to Gram-negative bacterial peptidoglycan. In addition, the blockage of the Nod1/M-TriDAP pathway could be partially overcome by co-stimulation with the Toll-like receptors agonists lipoteichoic acid or lipopolysaccharide. Investigation into the mechanism of this finding revealed that Nod2fs did not act as a dominant-negative molecule for the Nod1/M-TriDAP pathway, implying that the blockage is dependent upon the expression or activity of other factors. We demonstrated that PBMCs from Nod2fs patients express high levels of the peptidoglycan recognition protein S, a secreted protein known to interact with muramyl peptides. We proposed that through a scavenger function, peptidoglycan recognition protein S may dampen M-TriDAP-dependent responses in Nod2fs patients. Together, our results identified a cross-talk between the Nod1 and Nod2 pathways and suggested that down-regulation of Nod1/M-TriDAP pathway may be associated with Crohn disease. Nod2 (also known as CARD15) is a member of the Nod family of pattern recognition molecules involved in peptidoglycan sensing (1Girardin S.E. Hugot J.P. Sansonetti P.J. Trends Immunol. 2003; 24: 652-658Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar, 2Inohara N. Chamaillard M. McDonald C. Nunez G. Annu. Rev. Biochem. 2005; 74: 355-383Crossref PubMed Scopus (814) Google Scholar). Although Nod2 detects a muramyl dipeptide (MDP) 3The abbreviations used are:MDPmuramyl dipeptidePBMCsperipheral blood mononuclear cellsILinterleukinTNFαtumor necrosis factor-αLPSlipopolysaccharidePGRPpeptidoglycan recognition proteinLTAlipoteichoic acidPGpeptidoglycanDAPdiaminopimelic acidTLRToll-like receptorHPLChigh pressure liquid chromatographyAnhanhydroCTRcontrolMurNAcN-acetylmuramic acid motif found in peptidoglycans from all classes of bacteria (3Girardin S.E. Boneca I.G. Viala J. Chamaillard M. Labigne A. Thomas G. Philpott D.J. Sansonetti P.J. J. Biol. Chem. 2003; 278: 8869-8872Abstract Full Text Full Text PDF PubMed Scopus (1928) Google Scholar, 4Girardin S.E. Travassos L.H. Herve M. Blanot D. Boneca I.G. Philpott D.J. Sansonetti P.J. Mengin-Lecreulx D. J. Biol. Chem. 2003; 278: 41702-41708Abstract Full Text Full Text PDF PubMed Scopus (544) Google Scholar, 5Inohara N. Ogura Y. Fontalba A. Gutierrez O. Pons F. Crespo J. Fukase K. Inamura S. Kusumoto S. Hashimoto M. Foster S.J. Moran A.P. Fernandez-Luna J.L. Nunez G. J. Biol. Chem. 2003; 278: 5509-5512Abstract Full Text Full Text PDF PubMed Scopus (1413) Google Scholar), Nod1 detects a diaminopimelic acid (DAP)-containing muramyl tripeptide (M-TriDAP) found primarily in Gram-negative bacterial peptidoglycan (4Girardin S.E. Travassos L.H. Herve M. Blanot D. Boneca I.G. Philpott D.J. Sansonetti P.J. Mengin-Lecreulx D. J. Biol. Chem. 2003; 278: 41702-41708Abstract Full Text Full Text PDF PubMed Scopus (544) Google Scholar, 6Girardin S.E. Boneca I.G. Carneiro L.A. Antignac A. Jehanno M. Viala J. Tedin K. Taha M.K. Labigne A. Zahringer U. Coyle A.J. DiStefano P.S. Bertin J. Sansonetti P.J. Philpott D.J. Science. 2003; 300: 1584-1587Crossref PubMed Scopus (1267) Google Scholar, 7Chamaillard M. Hashimoto M. Horie Y. Masumoto J. Qiu S. Saab L. Ogura Y. Kawasaki A. Fukase K. Kusumoto S. Valvano M.A. Foster S.J. Mak T.W. Nunez G. Inohara N. Nat. Immun. 2003; 4: 702-707Crossref Scopus (1020) Google Scholar). In addition to its role as an intracellular pattern recognition molecule, genetic evidence has identified NOD2 as the first susceptibility gene for Crohn disease (8Hugot J.P. Chamaillard M. Zouali H. Lesage S. Cezard J.P. Belaiche J. Almer S. Tysk C. O'Morain C.A. Gassull M. Binder V. Finkel Y. Cortot A. Modigliani R. Laurent-Puig P. Gower-Rousseau C. Macry J. Colombel J.F. Sahbatou M. Thomas G. Nature. 2001; 411: 599-603Crossref PubMed Scopus (4725) Google Scholar, 9Ogura Y. Bonen D.K. Inohara N. Nicolae D.L. Chen F.F. Ramos R. Britton H. Moran T. Karaliuskas R. Duerr R.H. Achkar J.P. Brant S.R. Bayless T.M. Kirschner B.S. Hanauer S.B. Nunez G. Cho J.H. Nature. 2001; 411: 603-606Crossref PubMed Scopus (4206) Google Scholar). Crohn disease is an inflammatory disorder affecting the digestive tract, the etiology of which remains largely unknown. However, the recent association between the disease and Nod2 on the one hand and between Nod2 and bacterial sensing on the other hand suggests that Crohn disease is likely a consequence of a breakdown in tolerance to the intestinal bacterial flora. Still, it remains unclear why Nod2 dysfunction is a risk factor favoring the onset of Crohn disease. Indeed, although Nod2fs is fully defective for peptidoglycan sensing, other Nod2 mutant proteins found in Crohn disease patients display only minor differences in peptidoglycan detection (10Chamaillard M. Philpott D. Girardin S.E. Zouali H. Lesage S. Chareyre F. Bui T.H. Giovannini M. Zaehringer U. Penard-Lacronique V. Sansonetti P.J. Hugot J.P. Thomas G. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 3455-3460Crossref PubMed Scopus (273) Google Scholar, 11Bonen D.K. Ogura Y. Nicolae D.L. Inohara N. Saab L. Tanabe T. Chen F.F. Foster S.J. Duerr R.H. Brant S.R. Cho J.H. Nunez G. Gastroenterology. 2003; 124: 140-146Abstract Full Text Full Text PDF PubMed Scopus (356) Google Scholar). muramyl dipeptide peripheral blood mononuclear cells interleukin tumor necrosis factor-α lipopolysaccharide peptidoglycan recognition protein lipoteichoic acid peptidoglycan diaminopimelic acid Toll-like receptor high pressure liquid chromatography anhydro control N-acetylmuramic acid Through the identification of new important functions of Nod2, substantial progress has been made over the past few years toward understanding the link between Nod2 mutations and Crohn disease (1Girardin S.E. Hugot J.P. Sansonetti P.J. Trends Immunol. 2003; 24: 652-658Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar, 2Inohara N. Chamaillard M. McDonald C. Nunez G. Annu. Rev. Biochem. 2005; 74: 355-383Crossref PubMed Scopus (814) Google Scholar, 12Rogler G. Curr. Opin. Gastroenterol. 2004; 20: 311-317Crossref PubMed Scopus (72) Google Scholar). Indeed, Nod2 function has been shown to be related to intracellular bacterial killing (13Hisamatsu T. Suzuki M. Reinecker H.C. Nadeau W.J. McCormick B.A. Podolsky D.K. Gastroenterology. 2003; 124: 993-1000Abstract Full Text Full Text PDF PubMed Scopus (557) Google Scholar), defensin activity due to its expression in Paneth cells (14Kobayashi K.S. Chamaillard M. Ogura Y. Henegariu O. Inohara N. Nunez G. Flavell R.A. Science. 2005; 307: 731-734Crossref PubMed Scopus (1489) Google Scholar, 15Ogura Y. Lala S. Xin W. Smith E. Dowds T.A. Chen F.F. Zimmermann E. Tretiakova M. Cho J.H. Hart J. Greenson J.K. Keshav S. Nunez G. Gut. 2003; 52: 1591-1597Crossref PubMed Scopus (374) Google Scholar, 16Wehkamp J. Harder J. Weichenthal M. Schwab M. Schaffeler E. Schlee M. Herrlinger K.R. Stallmach A. Noack F. Fritz P. Schroder J.M. Bevins C.L. Fellermann K. Stange E.F. Gut. 2004; 53: 1658-1664Crossref PubMed Scopus (688) Google Scholar), as well as the induction of the anti-inflammatory cytokine IL-10 (17Netea M.G. Kullberg B.J. de Jong D.J. Franke B. Sprong T. Naber T.H. Drenth J.P. Van der Meer J.W. Eur. J. Immunol. 2004; 34: 2052-2059Crossref PubMed Scopus (200) Google Scholar). Also, Nod2 –/– mice display an increased TH1 profile of cytokine responses following stimulation with Toll-like receptor (TLRs) agonists (18Watanabe T. Kitani A. Murray P.J. Strober W. Nat. Immun. 2004; 5: 800-808Crossref Scopus (702) Google Scholar), which is an observation compatible with some features of Crohn disease. Finally, a recent study has reported the characterization of a knock-in mouse homozygous for the Nod2fs mutation, thus mimicking the natural human mutation associated with Crohn disease (19Maeda S. Hsu L.C. Liu H. Bankston L.A. Iimura M. Kagnoff M.F. Eckmann L. Karin M. Science. 2005; 307: 734-738Crossref PubMed Scopus (671) Google Scholar). Most surprisingly, macrophages from these animals displayed increased response to MDP, which contradicts results obtained by groups studying human cells (5Inohara N. Ogura Y. Fontalba A. Gutierrez O. Pons F. Crespo J. Fukase K. Inamura S. Kusumoto S. Hashimoto M. Foster S.J. Moran A.P. Fernandez-Luna J.L. Nunez G. J. Biol. Chem. 2003; 278: 5509-5512Abstract Full Text Full Text PDF PubMed Scopus (1413) Google Scholar, 17Netea M.G. Kullberg B.J. de Jong D.J. Franke B. Sprong T. Naber T.H. Drenth J.P. Van der Meer J.W. Eur. J. Immunol. 2004; 34: 2052-2059Crossref PubMed Scopus (200) Google Scholar, 20Li J. Moran T. Swanson E. Julian C. Harris J. Bonen D.K. Hedl M. Nicolae D.L. Abraham C. Cho J.H. Hum. Mol. Genet. 2004; 13: 1715-1725Crossref PubMed Scopus (226) Google Scholar). It is still unclear why Nod2fs mutation seems to represent a loss-of-function in humans and a gain-of-function in the mouse model. In the present study, we aimed to investigate the response of primary mononuclear cells isolated from Crohn disease patients not only to MDP but also to several muramyl peptides or peptidoglycan agonists. Most surprisingly, we observed that M-TriDAP, the specific agonist of Nod1, failed to induce cytokine response in PBMCs from Nod2fs patients, although it stimulated cells efficiently from either healthy donors or non-Nod2 Crohn disease patients. The importance of this result is further reinforced by the observation that cells from Nod2fs patients were totally unresponsive to peptidoglycan from Helicobacter pylori, which is an efficient activator of both Nod1 and Nod2 signaling pathways. Because Nod2fs was unable to act directly as a dominant-negative molecule for the Nod1 pathway, our results rather suggest that the blockage relies on additional factors expressed in Nod2fs cells. Accordingly, we provide evidence that PBMCs from Nod2fs patients express significantly higher levels of peptidoglycan recognition protein S (PGRP-S) than cells from healthy donors. We propose that PGRP-S expression contributes to the down-regulation of Nod1-dependent responses in Crohn disease patients with Nod2fs mutation. Therefore, these observations suggest the existence of an unexpected cross-talk between the Nod1 and Nod2 signaling pathways. Moreover, our results imply that defects in Nod1 function could participate in the development of Crohn disease. Together, this study provides a basis for the design of original therapeutic approaches for Crohn disease, aiming at establishing a functional Nod1 pathway in Nod2fs patients. Preparation of Highly Purified Peptidoglycans from Gram-negative and Gram-positive Bacteria—Bacterial strains used to prepare peptidoglycans are the following: H. pylori 26695; Staphylococcus aureus COL (from Olivier Chesneau, Institut Pasteur); and Streptococcus pneumoniae R800. The peptidoglycans purification procedures were exactly as described previously (6Girardin S.E. Boneca I.G. Carneiro L.A. Antignac A. Jehanno M. Viala J. Tedin K. Taha M.K. Labigne A. Zahringer U. Coyle A.J. DiStefano P.S. Bertin J. Sansonetti P.J. Philpott D.J. Science. 2003; 300: 1584-1587Crossref PubMed Scopus (1267) Google Scholar, 21Travassos L.H. Girardin S.E. Philpott D.J. Blanot D. Nahori M.A. Werts C. Boneca I.G. EMBO Rep. 2004; 5: 1000-1006Crossref PubMed Scopus (396) Google Scholar). Purity of samples was assessed by HPLC amino acid and saccharide analysis after HCl hydrolysis. Also, each peptidoglycan preparation was tested for the absence of LPS contamination using the Limulus amebocyte lysate assay as described previously (21Travassos L.H. Girardin S.E. Philpott D.J. Blanot D. Nahori M.A. Werts C. Boneca I.G. EMBO Rep. 2004; 5: 1000-1006Crossref PubMed Scopus (396) Google Scholar). The absence of TLR2-detected contaminants (lipoproteins or lipoteichoic acids) was tested on thioglycollate-elicited mouse peritoneal macrophages from either C57Bl6 or TLR2–/– mice as described previously (21Travassos L.H. Girardin S.E. Philpott D.J. Blanot D. Nahori M.A. Werts C. Boneca I.G. EMBO Rep. 2004; 5: 1000-1006Crossref PubMed Scopus (396) Google Scholar). Preparation of Muropeptides—DAP- and Lys-containing UDP-Mur-NAc-peptides were prepared as described previously (4Girardin S.E. Travassos L.H. Herve M. Blanot D. Boneca I.G. Philpott D.J. Sansonetti P.J. Mengin-Lecreulx D. J. Biol. Chem. 2003; 278: 41702-41708Abstract Full Text Full Text PDF PubMed Scopus (544) Google Scholar, 22Flouret B. Mengin-Lecreulx D. van Heijenoort J. Anal. Biochem. 1981; 114: 59-63Crossref PubMed Scopus (64) Google Scholar). M-TetraLYS, M-TriLYS, and M-TriDAP were generated by mild acid hydrolysis (0.1 m HCl, 10 min at 100 °C) of the corresponding UDP-MurNAc peptides. Replacement of meso-DAP by l-Lys in the peptidoglycan of Escherichia coli was obtained by overexpression in the latter species of the murE gene from S. aureus encoding UDP-MurNAc-l-Ala-d-Glu:l-Lys adding enzyme (23Mengin-Lecreulx D. Falla T. Blanot D. van Heijenoort J. Adams D.J. Chopra I. J. Bacteriol. 1999; 181: 5909-5914Crossref PubMed Google Scholar). Cells were harvested before cell lysis occurred, and their peptidoglycan was extracted and purified as described previously (24Mengin-Lecreulx D. van Heijenoort J. J. Bacteriol. 1985; 163: 208-212Crossref PubMed Google Scholar). In these conditions, about 50% of the DAP residues at the third position of the peptides was shown to be replaced by l-Lys. This peptidoglycan preparation was digested by SltY lytic transglycosylase in a reaction mixture (1 ml) consisting of 300 mm sodium acetate buffer, pH 4.5, 1 mg of PG (briefly sonicated for homogenization), and 100 μgof purified SltY enzyme (25Stenbak C.R. Ryu J.H. Leulier F. Pili-Floury S. Parquet C. Herve M. Chaput C. Boneca I.G. Lee W.J. Lemaitre B. Mengin-Lecreulx D. J. Immunol. 2004; 173: 7339-7348Crossref PubMed Scopus (128) Google Scholar). After overnight incubation at 37 °C, the reaction was stopped by adding 500 μl of 50 mm sodium phosphate buffer, pH 4.45 (HPLC eluent A), and 2 μl of phosphoric acid. The two main monomer products, Anh-GM-TetraDAP and Anh-GM-TetraLYS, were purified by HPLC on a column of nucleosyl 5C18 (4,6 × 250 mm, Alltech). Elution was performed at 0.6 ml/min with buffer A, using a gradient of methanol from 0 to 25% for 180 min. Detection was at 215 nm. The retention times of these two compounds were 67 and 80 min, respectively. They were further purified and desalted using a second HPLC step on the same column but this time using 0.1% trifluoroacetic acid and a gradient of methanol for elution. Their purity and composition were confirmed by amino acid and hexosamine analysis after acid hydrolysis of samples (6 m HCl, 16 h at 95 °C), using an Hitachi L8800 analyzer, as well as by matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Anh-M-TetraLYS was obtained by treatment of Anh-GM-TetraLYS with E. coli NagZ β N-acetylglucosaminidase. The reaction mixture (200 μl) contained 20 mm HEPES buffer, pH 7.4, 50 mm NaCl, 0.5 mm substrate, and 20 μg of purified NagZ enzyme (25Stenbak C.R. Ryu J.H. Leulier F. Pili-Floury S. Parquet C. Herve M. Chaput C. Boneca I.G. Lee W.J. Lemaitre B. Mengin-Lecreulx D. J. Immunol. 2004; 173: 7339-7348Crossref PubMed Scopus (128) Google Scholar). Anh-GM-TriLYS and Anh-M-TriLYS were generated by treatment of the corresponding tetrapeptide compounds with E. coli LdcA ld-carboxypeptidase. The reaction mixture (200 μl) contained 50 mm Tris-HCl buffer, pH 8.0, 0.5 mm substrate, and 20 μg of purified LdcA enzyme (25Stenbak C.R. Ryu J.H. Leulier F. Pili-Floury S. Parquet C. Herve M. Chaput C. Boneca I.G. Lee W.J. Lemaitre B. Mengin-Lecreulx D. J. Immunol. 2004; 173: 7339-7348Crossref PubMed Scopus (128) Google Scholar). In all cases, incubation was for overnight at 37 °C, and the products were purified by HPLC, and their identity was confirmed by the above described procedures. Cell Lines and Reagents—HEK293T cells were cultured in Dulbecco's modified Eagle's medium containing 10% fetal calf serum. Prior to transfection, HEK293T cells were seeded into 24-well plates at a density of 1 × 105 cells/ml as described previously (26Girardin S.E. Tournebize R. Mavris M. Page A.L. Li X. Stark G.R. Bertin J. DiStefano P.S. Yaniv M. Sansonetti P.J. Philpott D.J. EMBO Rep. 2001; 2: 736-742Crossref PubMed Scopus (533) Google Scholar). MDP LD (l-alanine d-glutamine) was from Calbiochem and reported to be 98% pure by TLC. Highly purified E. coli LPS (strain O55:B5) was from Invitrogen. Artificially synthesized LTA was kindly provided by Dr. Corinna Hermann (Konstanz University, Germany). Anti-Nod2 rabbit polyclonal antibody was from Cayman Chemical (Ann Harbor, MI), and anti-β-tubulin monoclonal antibody was from Sigma. Expression Plasmids and Transient Transfections—The expression plasmids for Nod1 and Nod2 were the kind gift from Gabriel Nuñez (University of Michigan Medical School, Ann Arbor, MI) and have been described previously (27Inohara N. Ogura Y. Chen F.F. Muto A. Nunez G. J. Biol. Chem. 2001; 276: 2551-2554Abstract Full Text Full Text PDF PubMed Scopus (456) Google Scholar). The expression vector for Nod2fs was from M. Giovannini (INSERM U674, CEPH, Paris, France). Constructs for Rip2 and MyD88 were kind gifts from M. Thome (ISREC, Lausanne, Switzerland) and M. Muzio (Mario Negri Institute, Milan, Italy), respectively. The NF-κB luciferase reporter plasmid was from Stratagene. Transfections and Western blotting experiments were carried out in HEK293T cells as described previously (26Girardin S.E. Tournebize R. Mavris M. Page A.L. Li X. Stark G.R. Bertin J. DiStefano P.S. Yaniv M. Sansonetti P.J. Philpott D.J. EMBO Rep. 2001; 2: 736-742Crossref PubMed Scopus (533) Google Scholar). NF-κB Activation Assays—Studies examining the synergistic activation of NF-κB by muramyl peptides in cells overexpressing Nod2 were carried out as originally described by Inohara et al. (27Inohara N. Ogura Y. Chen F.F. Muto A. Nunez G. J. Biol. Chem. 2001; 276: 2551-2554Abstract Full Text Full Text PDF PubMed Scopus (456) Google Scholar). Briefly, HEK293T cells were transfected overnight with the expression vectors of interest plus 75 ng of NF-κB luciferase reporter plasmid. At the same time, muramyl peptides were added to the cell culture medium, and the synergistic NF-κB-dependent luciferase activation was then measured following 24 h of co-incubation. NF-κB-dependent luciferase assays were performed in duplicate, and the data represent at least three independent experiments. Data show means ± S.E. Genotyping of NOD2 Variants—Blood was collected from 74 patients with Crohn disease and 10 healthy volunteers. PCR amplification of NOD2 gene fragments containing the polymorphic sites 3020insC (for Nod2fs) and C2104T (for R702W) was performed in 50-μl reaction volumes containing 100–200 ng of genomic DNA, as described previously (17Netea M.G. Kullberg B.J. de Jong D.J. Franke B. Sprong T. Naber T.H. Drenth J.P. Van der Meer J.W. Eur. J. Immunol. 2004; 34: 2052-2059Crossref PubMed Scopus (200) Google Scholar). The 3020insC polymorphism was analyzed by Genescan analysis on an ABI Prism 3100 genetic analyzer according to the protocol of the manufacturer (Applied Biosystems, Nieuwerkerk aan den IJssel, The Netherlands). Four patients with Crohn disease were found homozygous for the 3020insC mutation; one patient with Crohn disease was found homozygous for the C2104T mutation, and they were further investigated in the cytokine studies. As control groups, five patients with Crohn disease heterozygous for the 3020 insC NOD2 mutation, five patients with Crohn disease bearing the wild type allele, and five healthy volunteers homozygous for the wild type NOD2 allele were included. The cells isolated from the four groups of patients were isolated and tested at two separate occasions. The study was approved by the Ethical Committee of the Radboud University, Nijmegen, The Netherlands. Isolation of Mononuclear Cells and Stimulation of Cytokine Production—After informed consent, venous blood was drawn from the cubital vein of patients and healthy volunteers into three 10-ml EDTA tubes (Monoject, s-Hertogenbosch, The Netherlands). The PBMC fraction was obtained by density centrifugation of blood diluted 1:1 in pyrogen-free saline over Ficoll-Paque (Amersham Biosciences). Cells were washed twice in saline and suspended in culture medium (RPMI 1640 DM) supplemented with 10 μg/ml gentamicin, 10 mml-glutamine, and 10 mm pyruvate. The cells were counted in a Coulter counter (Coulter Electronics, Mijdrecht, The Netherlands), and the number was adjusted to 5 × 106 cells/ml. 5 × 105 PBMCs in a 100-μl volume were added to round-bottom 96-well plates (Greiner, Alphen aan den Rijn, The Netherlands) and were incubated with either 100 μl of culture medium (negative control) or the following various stimuli: 50 nm of the various muropeptide preparations, 10 μg/ml of the purified peptidoglycans, 100 ng/ml highly purified E. coli LPS (strain O55:B5), 5 μg/ml of artificially synthesized LTA (kindly provided by Dr. Corinna Hermann, Konstanz University, Germany), or a combination of stimuli as described under “Results and Discussion.” Cytokine Measurements—For detection of cytokine concentrations in the supernatants, BioPlex 100 system (Bio-Rad) was used. The kits were used as indicated by the manufacturer, and the sensitivity for all cytokines was <20 pg/ml. Real Time PCR Studies—Total RNA was isolated from cells using RNeasy kits (Macherey Nagel, Hoerdt, France) according to the manufacturer's instructions. RNA quantification was performed using spectrophotometry. After treatment at 37 °C for 30 min with 20–50 units of RNase-free DNase I (Roche Diagnostics), oligo(dT) primers (Roche Diagnostics) were used to synthesize single-stranded cDNA. mRNAs were quantified using SYBR green master mix (Applera, Courtaboeuf, France) with specific human oligonucleotides in a GeneAmp Abiprism 7000 (Applera, Courtaboeuf, France). The following primers were used: Nod1, sense GTAAAGGTGCTAAGCGAAGA and antisense TCTGATTCTGGATAAGCCAT; hPepT1, sense CCGCCTCCCAGGTTCAA and antisense GGTGCATGCCGCTAATCC; PGRP-S, sense GCAGCACTACCACATGAAGACACT and antisense GAGCCCGTCTTCTCCAATCA; PGRP-L, sense ACTGAGGGCTGCTGGGACCA and antisense GGCCTCAGTGAATTCCTTGG; Rip2, sense AAATGGATCATTAAATGAACTCCTACATAG and antisense TTCATGCAGGATGCGAAATC. In each assay, calibrated and no-template controls were included. Each sample was run in duplicate. SYBR green dye intensity was analyzed using the Abiprism 7000 SDS software (Applera, Courtaboeuf, France). All results were normalized to the β-actin, an unaffected housekeeping gene. Statistical Analysis—The human experiments were performed in triplicate with blood obtained from patients and volunteers. The differences between groups were analyzed by the Mann-Whitney U test and where appropriate by the Kruskal-Wallis analysis of variance test. The level of significance between groups was set at p < 0.05. The data are given as means ± S.E. In the search for MDP-derived muramyl peptides that could stimulate the Nod2 signaling pathway, we generated several molecules differing in the length of their peptidic moiety, including M-TriLys and M-TetraLys (Fig. 1A). These molecules were then tested for their ability to activate Nod2 by using co-transfection assays in HEK293T epithelial cells and measuring NF-κB activity as a read-out (Fig. 1B). By using such tests, we reported previously that the activation of Nod2 was maximal with the addition of 10 pmol of MDP/ml of culture medium (leading to a concentration of 10 nm) (4Girardin S.E. Travassos L.H. Herve M. Blanot D. Boneca I.G. Philpott D.J. Sansonetti P.J. Mengin-Lecreulx D. J. Biol. Chem. 2003; 278: 41702-41708Abstract Full Text Full Text PDF PubMed Scopus (544) Google Scholar). Here a larger range of muramyl peptide concentration was used (10–250 nm) to allow for the identification of even weak inducers of the Nod2 pathway. Through this approach, we observed that MDP and M-TriLys activated Nod2 with similar efficiency, whereas M-TetraLys represented a poor agonist (Fig. 1B). These results are consistent with our previous observations showing that the length of the muramyl peptide stem peptide is a key requirement for induction of Nod2 (4Girardin S.E. Travassos L.H. Herve M. Blanot D. Boneca I.G. Philpott D.J. Sansonetti P.J. Mengin-Lecreulx D. J. Biol. Chem. 2003; 278: 41702-41708Abstract Full Text Full Text PDF PubMed Scopus (544) Google Scholar). Because our goal was to use MDP-derived muramyl peptides to stimulate primary human PBMCs (see below), we searched for other MDP-derived molecules that could represent the optimal negative controls for M-TriLys and M-TetraLys agonists. We took advantage of our previous observation that the sugar moiety of muramyl peptides also plays a key role for optimal activation of Nod2 (4Girardin S.E. Travassos L.H. Herve M. Blanot D. Boneca I.G. Philpott D.J. Sansonetti P.J. Mengin-Lecreulx D. J. Biol. Chem. 2003; 278: 41702-41708Abstract Full Text Full Text PDF PubMed Scopus (544) Google Scholar). We generated modified forms of M-TriLys and M-TetraLys in which the MurNAc moiety is dehydrated to form anhydro-muramyl peptides (see Fig. 1A), and we observed that this subtle modification was sufficient to abolish stimulation of Nod2 (Fig. 1B). Therefore, anhydro-M-TriLys and anhydro-M-TetraLys were subsequently used as control inactive muramyl peptides for M-TriLys and M-TetraLys, respectively. Finally, M-TriDAP, the specific muramyl peptide agonist of Nod1, failed to activate Nod2, even at the highest dose (250 nm) used. The six muramyl peptides characterized above (MDP, M-TriLys, M-TetraLys, anhydro-M-TriLys, anhydro-M-TetraLys, and M-TriDAP) were used to stimulate PBMCs obtained from human blood. PBMCs from three groups of individuals were collected: healthy donors (control, CTR), Crohn disease patients without Nod2 mutations (Crohn), and Crohn disease patients carrying homozygous Nod2fs frameshift mutation (Nod2fs). Muramyl peptides were directly added to the culture medium at a final concentration of 50 nm, and supernatants were collected following overnight stimulation. IL-1β, IL-10, and TNFα were measured in the supernatant, whereas intracellular IL-1α was measured from cell lysates (Fig. 2A). First, our results identified MDP and M-TriLys as potent activators of human PBMC responses, and we confirmed that the detection of these muramyl peptides depends upon Nod2 because Nod2fs cells were not stimulated by MDP and M-TriLys (Fig. 2A). In addition, our observation that M-TetraLys was a poor inducer of Nod2 in vitro was reinforced by our findings that this agonist only marginally induced cytokine secretion from human PBMCs, and that this effect was further blunted in cells from Nod2fs patients (Fig. 2A). More importantly, our results showed that Nod2-independent Crohn disease patients still reacted to MDP and M-TriLys, thus demonstrating that the inability of cells from Nod2fs patients to detect these agonists resulted from their Nod2 mutation and was not an indirect consequence of the disease. Consequently, this observation also suggested that defects in muramyl peptide sensing is not the sole cause of Crohn disease development. Second, the conclusion that sensing of M-TriLys in PBMCs from healthy donors and non-Nod2 Crohn disease patie" @default.
• W2131208049 created "2016-06-24" @default.
• W2131208049 creator A5008373339 @default.
• W2131208049 creator A5011419822 @default.
• W2131208049 creator A5027955775 @default.
• W2131208049 creator A5035454863 @default.
• W2131208049 creator A5041156154 @default.
• W2131208049 creator A5057038887 @default.
• W2131208049 creator A5065161854 @default.
• W2131208049 creator A5068216286 @default.
• W2131208049 creator A5069666784 @default.
• W2131208049 creator A5070424975 @default.
• W2131208049 creator A5073789519 @default.
• W2131208049 creator A5078377172 @default.
• W2131208049 date "2005-10-01" @default.
• W2131208049 modified "2023-10-18" @default.
• W2131208049 title "The Frameshift Mutation in Nod2 Results in Unresponsiveness Not Only to Nod2- but Also Nod1-activating Peptidoglycan Agonists" @default.
• W2131208049 cites W1642457845 @default.
• W2131208049 cites W1670573097 @default.
• W2131208049 cites W1901118952 @default.
• W2131208049 cites W1969882466 @default.
• W2131208049 cites W1975100189 @default.
• W2131208049 cites W1988347181 @default.
• W2131208049 cites W1989303754 @default.
• W2131208049 cites W1995321760 @default.
• W2131208049 cites W2003634035 @default.
• W2131208049 cites W2003784229 @default.
• W2131208049 cites W2005148035 @default.
• W2131208049 cites W2012744652 @default.
• W2131208049 cites W2015160750 @default.
• W2131208049 cites W2018542503 @default.
• W2131208049 cites W2024451654 @default.
• W2131208049 cites W2029845836 @default.
• W2131208049 cites W2033368676 @default.
• W2131208049 cites W2040024879 @default.
• W2131208049 cites W2041170922 @default.
• W2131208049 cites W2041928346 @default.
• W2131208049 cites W2043667001 @default.
• W2131208049 cites W2044725815 @default.
• W2131208049 cites W2048000602 @default.
• W2131208049 cites W2073731887 @default.
• W2131208049 cites W2075583035 @default.
• W2131208049 cites W2079357488 @default.
• W2131208049 cites W2086607027 @default.
• W2131208049 cites W2087793279 @default.
• W2131208049 cites W2089034514 @default.
• W2131208049 cites W2100590703 @default.
• W2131208049 cites W2101830724 @default.
• W2131208049 cites W2103851237 @default.
• W2131208049 cites W2104160845 @default.
• W2131208049 cites W2110372095 @default.
• W2131208049 cites W2111900042 @default.
• W2131208049 cites W2111919009 @default.
• W2131208049 cites W2118026853 @default.
• W2131208049 cites W2119502087 @default.
• W2131208049 cites W2125309974 @default.
• W2131208049 cites W2125404055 @default.
• W2131208049 cites W2126880379 @default.
• W2131208049 cites W2130946949 @default.
• W2131208049 cites W2132482634 @default.
• W2131208049 cites W2135100507 @default.
• W2131208049 doi "https://doi.org/10.1074/jbc.m504924200" @default.
• W2131208049 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16115863" @default.
• W2131208049 hasPublicationYear "2005" @default.
• W2131208049 type Work @default.
• W2131208049 sameAs 2131208049 @default.
• W2131208049 citedByCount "73" @default.
• W2131208049 countsByYear W21312080492012 @default.
• W2131208049 countsByYear W21312080492013 @default.
• W2131208049 countsByYear W21312080492014 @default.
• W2131208049 countsByYear W21312080492015 @default.
• W2131208049 countsByYear W21312080492016 @default.
• W2131208049 countsByYear W21312080492017 @default.
• W2131208049 countsByYear W21312080492018 @default.
• W2131208049 countsByYear W21312080492020 @default.
• W2131208049 countsByYear W21312080492021 @default.
• W2131208049 countsByYear W21312080492023 @default.
• W2131208049 crossrefType "journal-article" @default.
• W2131208049 hasAuthorship W2131208049A5008373339 @default.
• W2131208049 hasAuthorship W2131208049A5011419822 @default.
• W2131208049 hasAuthorship W2131208049A5027955775 @default.
• W2131208049 hasAuthorship W2131208049A5035454863 @default.
• W2131208049 hasAuthorship W2131208049A5041156154 @default.
• W2131208049 hasAuthorship W2131208049A5057038887 @default.
• W2131208049 hasAuthorship W2131208049A5065161854 @default.
• W2131208049 hasAuthorship W2131208049A5068216286 @default.
• W2131208049 hasAuthorship W2131208049A5069666784 @default.
• W2131208049 hasAuthorship W2131208049A5070424975 @default.
• W2131208049 hasAuthorship W2131208049A5073789519 @default.
• W2131208049 hasAuthorship W2131208049A5078377172 @default.
• W2131208049 hasBestOaLocation W21312080491 @default.
• W2131208049 hasConcept C104317684 @default.
• W2131208049 hasConcept C136449434 @default.
• W2131208049 hasConcept C170493617 @default.
• W2131208049 hasConcept C185592680 @default.
• W2131208049 hasConcept C2776634448 @default.
• W2131208049 hasConcept C2777291061 @default.
• W2131208049 hasConcept C29906990 @default.

• next