FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2134653135> ?p ?o ?g. }

• W2134653135 endingPage "25672" @default.
• W2134653135 startingPage "25664" @default.
• W2134653135 abstract "Arg-Arg-Glu-Thr-Ala-Trp-Ala (RRETAWA) is a novel ligand peptide for integrin α5β1, which blocks α5β1-mediated cell adhesion to fibronectin (Koivunen, E., Wang, B., and Ruoslahti, E. (1994)J. Cell Biol. 124, 373–380). Here we have localized the binding site for RRETAWA on α5β1 using inhibitory monoclonal antibodies (mAbs) and site-directed mutagenesis. A cyclic peptide containing this sequence (*CRRETAWAC*) had little effect on the binding of most anti-α5 and anti-β1 mAbs to α5β1 but completely blocked binding of the anti-α5 mAb 16 in a directly competitive manner. Hence, the binding site of RRETAWA appears to closely overlap with the epitope of mAb 16. *CRRETAWAC* also acted as a direct competitive inhibitor of the binding of Arg-Gly-Asp (RGD)-containing fibronectin fragments to α5β1, suggesting that the binding site for RRETAWA is also closely overlapping with that for RGD. However, differences between the binding sites of RRETAWA and RGD were apparent in that (i) RGD peptides allosterically inhibited the binding of mAb 16 to α5β1, and (ii) several mAbs that perturbed binding of α5β1 to RGD had little effect on binding of α5β1 to RRETAWA. A double mutation in α5 (S156G/W157S) blocked the interaction of both RRETAWA and mAb 16 with α5β1 but had no effect on fibronectin binding or on the binding of other anti-α5 mAbs. Ser156-Trp157 is located near the apex of a putative loop region on the upper surface of a predicted β-propeller structure formed by the NH2-terminal repeats of α5. Our findings suggest that this sequence forms part of the ligand-binding pocket of α5β1. Furthermore, as Ser156-Trp157 is unique to the α5 subunit, it may be responsible for the specific recognition of RRETAWA by α5β1. Arg-Arg-Glu-Thr-Ala-Trp-Ala (RRETAWA) is a novel ligand peptide for integrin α5β1, which blocks α5β1-mediated cell adhesion to fibronectin (Koivunen, E., Wang, B., and Ruoslahti, E. (1994)J. Cell Biol. 124, 373–380). Here we have localized the binding site for RRETAWA on α5β1 using inhibitory monoclonal antibodies (mAbs) and site-directed mutagenesis. A cyclic peptide containing this sequence (*CRRETAWAC*) had little effect on the binding of most anti-α5 and anti-β1 mAbs to α5β1 but completely blocked binding of the anti-α5 mAb 16 in a directly competitive manner. Hence, the binding site of RRETAWA appears to closely overlap with the epitope of mAb 16. *CRRETAWAC* also acted as a direct competitive inhibitor of the binding of Arg-Gly-Asp (RGD)-containing fibronectin fragments to α5β1, suggesting that the binding site for RRETAWA is also closely overlapping with that for RGD. However, differences between the binding sites of RRETAWA and RGD were apparent in that (i) RGD peptides allosterically inhibited the binding of mAb 16 to α5β1, and (ii) several mAbs that perturbed binding of α5β1 to RGD had little effect on binding of α5β1 to RRETAWA. A double mutation in α5 (S156G/W157S) blocked the interaction of both RRETAWA and mAb 16 with α5β1 but had no effect on fibronectin binding or on the binding of other anti-α5 mAbs. Ser156-Trp157 is located near the apex of a putative loop region on the upper surface of a predicted β-propeller structure formed by the NH2-terminal repeats of α5. Our findings suggest that this sequence forms part of the ligand-binding pocket of α5β1. Furthermore, as Ser156-Trp157 is unique to the α5 subunit, it may be responsible for the specific recognition of RRETAWA by α5β1. Arg-Gly-Asp Arg-Arg-Glu-Thr-Ala-Trp-Ala cyclo-(Gly-Ala-Cys-Arg-Arg-Glu-Thr-Ala-Trp-Ala-Cys-Ala-Gly) monoclonal antibody phosphate-buffered saline bovine serum albumin enzyme-linked immunosorbent assay 2,2′-azino-bis(3-ethyl-benzthiazoline-6-sulfonic acid) metal ion-dependent adhesion site. Integrin α5β1 is a widely distributed cell surface receptor for the extracellular matrix glycoprotein fibronectin. The cell-binding domain of fibronectin contains a number of repeated modules termed fibronectin type III repeats. An Arg-Gly-Asp (RGD)1 sequence in the 10th type III repeat is the major binding site for α5β1 (1Pierschbacher M.D. Ruoslahti E. Nature. 1984; 309: 30-33Crossref PubMed Scopus (2820) Google Scholar, 2Yamada K.M. Kennedy D.W. J. Cell Biol. 1984; 99: 29-36Crossref PubMed Scopus (319) Google Scholar), although an additional “synergy” sequence in the ninth type III repeat is also recognized by this integrin (3Aota S. Nomizu M. Yamada K.M. J. Biol. Chem. 1994; 269: 24756-24761Abstract Full Text PDF PubMed Google Scholar, 4Mould A.P. Askari J.A. Aota S. Yamada K.M. Irie A. Takada Y. Mardon H.J. Humphries M.J. J. Biol. Chem. 1997; 272: 17283-17292Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar). Recently, a novel ligand sequence for α5β1, Arg-Arg-Glu-Thr-Ala-Trp-Ala(RRETAWA), was identified from a CX 7C phage display library (5Koivunen E. Wang B. Ruoslahti E. J. Cell Biol. 1994; 124: 373-380Crossref PubMed Scopus (293) Google Scholar). Peptides containing this sequence support cell adhesion directly, and antagonize α5β1-mediated adhesion of cells to fibronectin. RRETAWA appears to be specific to human α5β1, as it is not recognized by other RGD-dependent integrins or by murine α5β1. Although the RRETAWA sequence appears unrelated to RGD, the binding sites for RRETAWA and RGD on α5β1 were proposed to be closely overlapping because peptides containing the RRETAWA sequence blocked the recognition of RGD by α5β1 and vice versa (5Koivunen E. Wang B. Ruoslahti E. J. Cell Biol. 1994; 124: 373-380Crossref PubMed Scopus (293) Google Scholar). The NH2-terminal half of integrin α subunits consist of a seven-fold repeated unit of about 60 amino acid residues. Repeats 4–7 (or in some integrins repeats 5–7) contain putative divalent cation binding sites (6Tuckwell D.S. Brass A.M. Humphries M.J. Biochem J. 1992; 285: 325-331Crossref PubMed Scopus (93) Google Scholar). About one third of integrin α subunits contain an inserted (I or A) domain of about 200 amino acid residues between the second and third repeats. Where present, the A-domain contains the major sites involved in ligand binding (7Newham P. Humphries M.J. Mol. Med. Today. 1996; 2: 304-313Abstract Full Text PDF PubMed Scopus (83) Google Scholar, 8Humphries M.J. Newham P. Trends Cell Biol. 1998; 8: 78-83Crossref PubMed Google Scholar). Ligand binding sites in non-A-domain-containing integrins (such as α5β1) have been localized to defined regions in the NH2-terminal portions of both α and β subunits (8Humphries M.J. Newham P. Trends Cell Biol. 1998; 8: 78-83Crossref PubMed Google Scholar, 9Takada Y. Kamata T. Irie A. Puzon-McLaughlin W. Zhang X.-P. Matrix Biol. 1997; 16: 143-151Crossref PubMed Scopus (33) Google Scholar). The NH2-terminal repeats of α subunits are predicted to have a mainly β-strand secondary structure (10Tuckwell D.S. Humphries M.J. Brass A. Cell Adhes. Commun. 1994; 2: 385-402Crossref PubMed Scopus (35) Google Scholar), and to fold cooperatively into a seven-bladed β-propeller (11Springer T.A. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 65-72Crossref PubMed Scopus (385) Google Scholar). Each blade of the propeller contains four β-strands connected by loops of varying length; these strands are tilted such that the connecting loops are either on the upper or lower surfaces of the propeller. In an important recent advance, it was shown that exchanging several putative loop regions on the upper surface of the α4 subunit β-propeller with the corresponding loops in α5perturbed ligand recognition by α4β1 and also attenuated the binding of inhibitory anti-α4monoclonal antibodies (mAbs) (12Irie A. Kamata T. Takada Y. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 7198-7203Crossref PubMed Scopus (62) Google Scholar). Similarly, swapping predicted loop regions on the upper surface of the α5 subunit β-propeller with the corresponding loops from α4blocked binding of inhibitory anti-α5 mAbs (4Mould A.P. Askari J.A. Aota S. Yamada K.M. Irie A. Takada Y. Mardon H.J. Humphries M.J. J. Biol. Chem. 1997; 272: 17283-17292Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar). The region of the β subunit that participates in ligand recognition has been predicted to have a von Willebrand factor A-domain-like fold (13Lee O.-J. Rieu P. Arnaout M.A. Liddington R. Cell. 1995; 80: 631-638Abstract Full Text PDF PubMed Scopus (792) Google Scholar, 14Tozer E.C. Liddington R.C. Sutcliffe M.J. Smeeton A.H. Loftus J.C. J. Biol. Chem. 1996; 271: 21978-21984Abstract Full Text Full Text PDF PubMed Scopus (161) Google Scholar, 15Tuckwell D.S. Humphries M.J. FEBS Lett. 1997; 400: 297-303Crossref PubMed Scopus (99) Google Scholar); the top face of this domain has been suggested to mediate ligand binding through a metal ion-dependent adhesion site (MIDAS) (13Lee O.-J. Rieu P. Arnaout M.A. Liddington R. Cell. 1995; 80: 631-638Abstract Full Text PDF PubMed Scopus (792) Google Scholar, 14Tozer E.C. Liddington R.C. Sutcliffe M.J. Smeeton A.H. Loftus J.C. J. Biol. Chem. 1996; 271: 21978-21984Abstract Full Text Full Text PDF PubMed Scopus (161) Google Scholar, 15Tuckwell D.S. Humphries M.J. FEBS Lett. 1997; 400: 297-303Crossref PubMed Scopus (99) Google Scholar, 16Loftus J.C. Liddington R.C. J. Clin Invest. 1997; 99: 2302-2306Crossref PubMed Google Scholar). A model for the quaternary arrangement of the α and β subunit ligand-binding sites has recently been presented (4Mould A.P. Askari J.A. Aota S. Yamada K.M. Irie A. Takada Y. Mardon H.J. Humphries M.J. J. Biol. Chem. 1997; 272: 17283-17292Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar, 8Humphries M.J. Newham P. Trends Cell Biol. 1998; 8: 78-83Crossref PubMed Google Scholar,16Loftus J.C. Liddington R.C. J. Clin Invest. 1997; 99: 2302-2306Crossref PubMed Google Scholar). However, the precise amino acid residues that participate in ligand recognition are currently unknown. We have recently described how inhibitory mAbs can be used to map the binding interface between integrin and ligand (4Mould A.P. Askari J.A. Aota S. Yamada K.M. Irie A. Takada Y. Mardon H.J. Humphries M.J. J. Biol. Chem. 1997; 272: 17283-17292Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar, 17Newham P. Craig S.E. Clark K. Mould A.P. Humphries M.J. J. Immunol. 1998; 160: 4508-4517PubMed Google Scholar). Here we have investigated the molecular basis of RRETAWA recognition using inhibitory anti-α5 and anti-β1 mAbs, in conjunction with site-directed mutagenesis. We show that the binding site for RRETAWA is spatially overlapping with the epitope of the anti-α5 mAb 16 and also with sequences that participate in recognition of RGD. As mAb 16 does not bind to murine α5β1, we exchanged non-conserved residues in predicted loop regions on the upper surface of the human α5 β-propeller with the corresponding residues from murine α5. A double mutation (S156G/W157S) was found to specifically block binding of mAb 16. The same mutation also perturbed binding of α5β1 to RRETAWA. Our results pinpoint specific amino acid residues involved in recognition of RRETAWA and imply that residues that interact with RGD may be located in the same loop, or in a closely adjacent region of the integrin. These findings also support the proposed model of the ligand-binding pocket of α5β1 (4Mould A.P. Askari J.A. Aota S. Yamada K.M. Irie A. Takada Y. Mardon H.J. Humphries M.J. J. Biol. Chem. 1997; 272: 17283-17292Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar, 8Humphries M.J. Newham P. Trends Cell Biol. 1998; 8: 78-83Crossref PubMed Google Scholar). Rat mAbs 16 and 11 recognizing the human α5 subunit, and mAb 13 recognizing the human β1 subunit were gifts from Dr. K. Yamada (NIDR, National Institutes of Health, Bethesda, MD). Mouse anti-human α5mAbs VC5, P1D6 and JBS5 were purchased from PharMingen (San Diego, CA), Life Technologies, Inc., and Serotec (Oxford, UK), respectively. Mouse anti-human α5 mAbs SAM-1 and SAM-2 were from Serotec and Bradsure Biologicals (Loughborough, UK), respectively. Mouse anti-human β1 mAbs P4C10, 4B4, and K20 were purchased from Life Technologies, Inc. (Paisley, Scotland, UK), Coulter Corp. (Miami, FL), and The Binding Site (Birmingham, UK), respectively. All antibodies were used as purified IgG, except P4C10 (as ascites). Rabbit, mouse, and rat IgG were obtained from Sigma (Poole, UK). The synthetic peptides GRGDS and GACRRETAWACGA were synthesized using Fastmoc chemistry on an Applied Biosystems 431A peptide synthesizer and purified as outlined previously (18Humphries M.J. Akiyama S.K. Komoriya A. Olden K. Yamada K.M. J. Cell Biol. 1986; 103: 2637-2647Crossref PubMed Scopus (303) Google Scholar). GACRRETAWACGA was cyclized using 10% Me2SO according to published protocols (19Tam J.P. Wu C.-R. Liu W. Zhang J.-W. J. Am. Chem. Soc. 1991; 113: 6657-6662Crossref Scopus (455) Google Scholar), and purified by filtration on Sephadex G-10 (Sigma). Oligonucleotides were synthesized on an Applied Biosystems 392 DNA/RNA synthesizer, or were purchased from MWG Biotech (Southampton, UK). Poly-l-lysine was obtained from Sigma. Integrin α5β1 was purified from human placenta as described previously (20Mould A.P. Akiyama S.K. Humphries M.J. J. Biol. Chem. 1996; 271: 20365-20374Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar). Recombinant fragments of the cell-binding domain of fibronectin were produced as before (21Danen E.H.J. Aota S. van Kraats A.A Yamada K.M. Riuter D.J. van Muijen G.N.P. J. Biol. Chem. 1995; 270: 21612-21618Abstract Full Text Full Text PDF PubMed Scopus (148) Google Scholar) and purified using DEAE Sephacel (Amersham Pharmacia Biotech, Milton Keynes, UK) and hydroxylapatite (Bio-Rad, Hemel Hempstead, UK) chromatography, as described previously (4Mould A.P. Askari J.A. Aota S. Yamada K.M. Irie A. Takada Y. Mardon H.J. Humphries M.J. J. Biol. Chem. 1997; 272: 17283-17292Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar). mAb 11 (∼500 μg/ml in buffer A) was mixed with an equal mass of sulfo-N-hydroxysuccinimido biotin (Pierce, Chester, UK) and rotary mixed for 30–40 min at room temperature. The mixture was then dialyzed against several changes of 150 mm NaCl, 25 mm Tris-Cl, pH 7.4, to remove excess biotin. The dialysate was centrifuged at 13,000 × g for 15 min, and stored at 4 °C. Rabbit IgG (3 mg) was dissolved in 1 ml of coupling buffer (0.5 m NaCl, 0.1m NaHCO3, pH 8). To this solution, approximately 0.5 mg of bis(sulfosuccinimidyl)suberate (Pierce) dissolved in 0.1 ml of coupling buffer was added. The mixture was incubated for 5 min at room temperature, and then *CRRETAWAC* (1 mg dissolved in 0.1 ml of coupling buffer) was added. After incubation of the mixture for 5 min at room temperature, unreacted peptide and cross-linker were removed by dialysis against PBS. The dialysate was centrifuged at 13,000 × g for 15 min, and stored in aliquots at −70 °C. Purified α5β1 (at a concentration of ∼500 μg/ml) was diluted 1:500 with PBS containing 1 mm Ca2+and 0.5 mm Mg2+, and 100-μl aliquots were added to the wells of a 96-well ELISA plate (Dynatech Immulon 3). Plates were incubated overnight at room temperature, and wells were blocked for 1–3 h with 200 μl of 5% (w/v) BSA, 150 mmNaCl, 0.05% (w/v) NaN3, 25 mm Tris-Cl, pH 7.4. Wells were then washed three times with 200 μl of 150 mmNaCl, 1 mm MnCl2, 25 mm Tris-Cl, pH 7.4, containing 1 mg/ml BSA (buffer A). 100-μl aliquots of mAbs (0.3 μg/ml or 1:10,000 dilution of ascites in buffer A) were added to the wells in the presence or absence of 100 μg/ml peptides. The plate was then incubated at 37 °C for 2 h. Unbound antibody was aspirated, and the wells were washed three times with buffer A. Bound antibody was quantitated by addition of 1:1000 anti-rat or anti-mouse peroxidase conjugate (Dako A/C, Denmark) in buffer A for 20 min. Wells were then washed four times with buffer A, and color was developed using ABTS substrate (Sigma). The absorbance of each well at 405 nm was then measured using a multiscan ELISA reader (Dynatech, Billingshurst, UK). Measurements obtained were the mean ± S.D. of four replicate wells. In experiments in which the effect of replacing Mn2+ in the assay buffer with Mg2+, Ca2+, or EDTA was examined, buffer A without Mn2+ was used throughout the assay, except during the incubation of mAb with integrin where Mn2+, Mg2+, Ca2+, or EDTA were included at a concentration of 1 mm. To test if peptides behaved as direct competitive inhibitors or allosteric inhibitors of mAb 16 binding, the inhibition of antibody binding at different concentrations of peptide was measured as described above over a 10-fold range of mAb 16 concentrations (0.1, 0.3 and 1 μg/ml). The concentration of peptide required to half-maximally inhibit antibody binding, and the maximal extent of inhibition were estimated by non-linear regression analysis as described previously (20Mould A.P. Akiyama S.K. Humphries M.J. J. Biol. Chem. 1996; 271: 20365-20374Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar). Linear regression analysis of single-reciprocal plots was performed using SigmaPlot Version 6 (Jandel Scientific, Palo Alto, CA). Solid-phase receptor-ligand binding was performed using a modification of previously described assays (22Mould A.P. Akiyama S.K. Humphries M.J. J. Biol Chem. 1995; 270: 26270-26277Abstract Full Text Full Text PDF PubMed Scopus (261) Google Scholar). Here a “reverse” assay was used in which ligand (instead of integrin) was adsorbed to the solid phase support, and integrin (instead of ligand) was allowed to bind from the solution phase. ELISA plate wells were coated with III6–10(SPSDN) (50 μg/ml) or *CRRETAWAC*-IgG conjugate (50 μg/ml) for 1 h at room temperature, blocked as described above, and washed three times with 200 μl of buffer A. 100-μl aliquots of purified α5β1 (approximately 1 μg/ml) in buffer A were added to the wells, with or without mAbs (10 μg/ml or 1:1000 dilution of ascites). The plate was then incubated at 30 °C for 3 h. Unbound integrin was aspirated, and the wells were washed three times with buffer A. 100-μl aliquots of biotinylated mAb 11 (10 μg/ml) in buffer A were added to the wells for 20 min at room temperature. The wells were then aspirated, washed three times in buffer A, and 100-μl aliquots of 1:200 ExtrAvidin-peroxidase conjugate (Sigma) added in buffer A for 10 min. Wells were then washed four times with buffer A, and color was developed using ABTS. Measurements obtained were the mean ± S.D. of four replicate wells. In all the assays described above, the amount of nonspecific binding was measured by determining the level of antibody or integrin binding to wells coated with BSA alone; these values were subtracted from the corresponding values for receptor- or ligand-coated wells. Each experiment shown is representative of at least three separate experiments. A 1.8-kilobase pairKpnI/XhoI fragment of human α5 in pcDNA3 was subcloned into pUC119. Site-directed mutagenesis (23Kunkel T.A. Roberts J.D. Zakour R.A. Methods Enzymol. 1987; 154: 367-382Crossref PubMed Scopus (4540) Google Scholar) was performed using the primer CGCTCAGATTTCGGCTCGGCAGCAGGACAGG to introduce the S156G/W157S mutation. The KpnI/XhoI fragment was subcloned into pcDNA3 containing α5 to reconstruct the full-length cDNA. The presence of the mutation was verified by DNA sequencing. Chinese hamster ovary cells B2 variant (24Schreiner C.L. Bauer J.S. Danilov Y.N. Hussein S. Sczekan M. Juliano R.L. J. Cell Biol. 1989; 109: 3157-3167Crossref PubMed Scopus (113) Google Scholar) (a gift from R. L. Juliano, University of North Carolina, Chapel Hill, NC) were detached using 0.05% (w/v) trypsin, 0.02% (w/v) EDTA in PBS, washed twice in PBS, resuspended to a concentration of 1 × 107cells/ml in PBS, and 8 × 106 cells were placed into 0.4-cm electroporation cuvettes (Bio-Rad). 20 μg of wild-type or mutant α5 DNA was added and the cells were left on ice for 10 min. Cells were electroporated at 25 microfarads and 800 V, and then left on ice for another 10 min. Growth medium (Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum, 1% glutamine, and 1% non-essential amino acids) was added, and the cells were plated out and incubated at 37 °C, in a humidified atmosphere containing 5% CO2. 48 h after transfection, the medium was supplemented with 0.7 mg/ml G418 (Life Technologies, Inc.). G418-resistant colonies were harvested after 10–14 days. The cell population was incubated first with mAb 11 (a mAb that recognizes a non-functional epitope on the α5 subunit), and then with anti-rat IgG-coated magnetic beads (Dako) to select for cells expressing α5. The expression of wild-type and mutant α5 was confirmed by flow cytometric analysis in FACScan (Becton Dickinson) using mAb 11. Cells expressing mutant or wild-type α5 were then cloned by limiting dilution to obtain high level expressors. The percentage of cells reactive to a panel of anti-α5 mAbs was assessed using flow cytometry, using rat IgG or mouse IgG as controls. Chinese hamster ovary-B2 cells, or cells transfected with mutant or wild-type human α5 were detached using 0.05% (w/v) trypsin, 0.02% (w/v) EDTA in PBS, washed with 150 mm NaCl, 25 mm HEPES, pH 7.4, incubated at 37 °C for 30 min in the same buffer, and resuspended in the same buffer with 1 mm MnCl2 (buffer B) to a concentration of 2 × 106/ml. Assays were performed in 96-well microtiter plates (Costar, High Wycombe, UK). Wells were coated for 60 min at room temperature with 100-μl aliquots of III6–10 or *CRRETAWAC*-IgG diluted with Dulbecco's PBS, and then sites on the plastic for nonspecific cell adhesion were blocked for 40–60 min at 37 °C with 100 μl of 10 mg/ml heat-denatured BSA. The BSA was removed by aspiration and the wells were washed once with buffer B. 100-μl aliquots of the cells in buffer B were then added to the wells and incubated for 20 min at 37 °C in a humidified atmosphere of 5% (v/v) CO2. For experiments examining the effect of anti-α5 mAbs on cell attachment, cells were preincubated with mAbs (10 μg/ml) for 30 min at room temperature before being added to the wells. To estimate the reference value for 100% attachment, cells in quadruplicate wells coated with poly-l-lysine (500 μg/ml) were fixed immediately by direct addition of 100 μl of 5% (w/v) glutaraldehyde for 30 min at room temperature. Loosely adherent or unbound cells from experimental wells were removed by aspiration, the wells washed twice with 100 μl of buffer B, and the remaining bound cells were fixed as described above for reference wells. The fixative was aspirated, the wells were washed three times with 200 μl of H2O, and attached cells were stained with Crystal Violet (Sigma) as described previously (22Mould A.P. Akiyama S.K. Humphries M.J. J. Biol Chem. 1995; 270: 26270-26277Abstract Full Text Full Text PDF PubMed Scopus (261) Google Scholar). The absorbance of each well at 570 nm was then measured using a multiscan ELISA reader (Dynatech). Each sample was assayed in quadruplicate, and attachment to BSA (<10% of the total) was subtracted from all measurements. Each experiment shown is representative of at least three separate experiments. We have shown that recognition of fibronectin by α5β1 attenuates the binding of inhibitory anti-α5 and anti-β1mAbs (4Mould A.P. Askari J.A. Aota S. Yamada K.M. Irie A. Takada Y. Mardon H.J. Humphries M.J. J. Biol. Chem. 1997; 272: 17283-17292Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar, 20Mould A.P. Akiyama S.K. Humphries M.J. J. Biol. Chem. 1996; 271: 20365-20374Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar), and that these mAbs can be used to localize ligand contact sites. To investigate if recognition of RRETAWA causes changes in the binding of inhibitory anti-α5 or anti-β1 mAbs, we examined the effect of a high concentration of the cyclic peptide GACRRETAWACGA (*CRRETAWAC*) (5Koivunen E. Wang B. Ruoslahti E. J. Cell Biol. 1994; 124: 373-380Crossref PubMed Scopus (293) Google Scholar) on the binding of a panel of these mAbs to α5β1. VC5 and K20 were used as control (non-inhibitory) anti-α5 and anti-β1 mAbs, respectively. The results (Fig. 1) showed that binding of the anti-α5 mAb 16 to α5β1 was almost completely blocked by *CRRETAWAC*. The binding of other anti-α5 mAbs was unaffected, or slightly increased. *CRRETAWAC* had a small inhibitory effect on the binding of the anti-β1 mAbs 13, P4C10, and 4B4 (maximal extent of inhibition ≤ 25%). Inhibition of mAb 16 binding by *CRRETAWAC* was dependent on the presence of divalent cations (Fig. 2). Antibody binding was strongly inhibited only when Mn2+ or Mg2+ was present in the assay buffer. A lower level of inhibition was observed in the presence of Ca2+, and the peptide was inactive in the presence of EDTA. These findings strongly suggest that the inhibition of mAb 16 binding is due to recognition of RRETAWA by α5β1, which has been shown to be cation-dependent (5Koivunen E. Wang B. Ruoslahti E. J. Cell Biol. 1994; 124: 373-380Crossref PubMed Scopus (293) Google Scholar). The divalent cation requirements for the interaction of RRETAWA with α5β1 appear similar to those for fibronectin (22Mould A.P. Akiyama S.K. Humphries M.J. J. Biol Chem. 1995; 270: 26270-26277Abstract Full Text Full Text PDF PubMed Scopus (261) Google Scholar). To examine if the *CRRETAWAC* peptide acted as a direct competitive inhibitor or as an allosteric inhibitor of mAb 16 binding, we tested the inhibitory effect of *CRRETAWAC* on mAb 16 binding over a range of mAb concentrations. The results (Fig. 3 A) showed that antibody binding could be completely inhibited at high peptide concentrations, and that the concentration of *CRRETAWAC* required for half-maximal inhibition of mAb 16 binding increased in parallel with the antibody concentration (∼8-fold increase for a 10-fold increase in antibody concentration), as would be expected for a direct competitive inhibition. Plots of 1/(antibody binding) versus *CRRETAWAC* concentration were linear (Fig. 3 B), confirming that *CRRETAWAC* competed directly with mAb 16 for binding to α5β1. Hence, it appears that the binding site for RRETAWA on α5β1 is overlapping with the epitope of mAb 16. To examine the relationship between the binding sites for RRETAWA and RGD on α5β1, we tested the inhibitory effect of *CRRETAWAC* on the binding of a recombinant fibronectin fragment to α5β1. This fragment, III6–10 (21Danen E.H.J. Aota S. van Kraats A.A Yamada K.M. Riuter D.J. van Muijen G.N.P. J. Biol. Chem. 1995; 270: 21612-21618Abstract Full Text Full Text PDF PubMed Scopus (148) Google Scholar), contains the RGD site in the 10th type III repeat. The results (Fig. 4 A) showed that *CRRETAWAC* peptide completely blocked the binding of III6–10 to α5β1, and the concentration of *CRRETAWAC* required for half-maximal inhibition of binding increased in parallel with the concentration of recombinant fragment (∼10-fold increase for a 10-fold increase in III6–10 concentration), as would be expected if RRETAWA acted as a direct competitive inhibitor of RGD binding. Plots of 1/(III6–10 binding) versus*CRRETAWAC* concentration (Fig. 4 B) were linear, confirming that RRETAWA competes directly with fibronectin for binding to α5β1. Although the fibronectin fragment used in these experiments also contains the synergy region of the ninth type III repeat, similar results were obtained with a mutant fragment III6–10(SPSDN) (21Danen E.H.J. Aota S. van Kraats A.A Yamada K.M. Riuter D.J. van Muijen G.N.P. J. Biol. Chem. 1995; 270: 21612-21618Abstract Full Text Full Text PDF PubMed Scopus (148) Google Scholar), in which the synergy sequence is replaced with an inactive sequence from the eighth type III repeat (data not shown). Hence, it appears that the binding site for RRETAWA directly overlaps with that of RGD. This finding is consistent with the previously described ability of peptides containing the RRETAWA sequence to block the recognition of RGD by α5β1 and vice versa (5Koivunen E. Wang B. Ruoslahti E. J. Cell Biol. 1994; 124: 373-380Crossref PubMed Scopus (293) Google Scholar). To further study the relationship between RRETAWA and RGD, we examined if recognition of RGD by α5β1 affected the binding of mAb 16, or other anti-α5 mAbs. The peptide GRGDS was used as a model RGD-containing ligand, as this peptide has been shown to have similar properties to fibronectin fragments that lack the synergy sequence (4Mould A.P. Askari J.A. Aota S. Yamada K.M. Irie A. Takada Y. Mardon H.J. Humphries M.J. J. Biol. Chem. 1997; 272: 17283-17292Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar). The results (Fig. 5) showed that mAb 16 binding to α5β1 was partially inhibited by GRGDS. In agreement with our previous study (4Mould A.P. Askari J.A. Aota S. Yamada K.M. Irie A. Takada Y. Mardon H.J. Humphries M.J. J. Biol. Chem. 1997; 272: 17283-17292Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar), this peptide had no effect on the binding of other anti-α5 mAbs but did perturb the binding of inhibitory anti-β1 mAbs. To examine if RGD peptide acted as a direct competitive inhibitor or as an allosteric inhibitor of mAb 16 binding, we tested the effect of GRGDS on mAb 16 binding over a ten-fold range of antibody concentrations. The results (Fig. 6 A) showed that the concentration of RGD peptide required for half-maximal inhibition of antibody binding was approximately the same for each concentration of antibody, and the maximal extent of inhibition decreased with increasing antibody concentration. These data are inconsistent with a direct competitive inhibition and instead suggest that GRGDS is an allosteric inhibitor of mAb 16 binding. Plots of 1/(antibody binding)versus GRGDS concentration were hyperbolic (Fig. 6 B), confirming that GRGDS allosterically inhibited mAb 16 binding to α5β1. Hence, GRGDS and *CRRETAWAC* showed distinct modes of inhibition of mAb 16 binding. These distinct modes of inhibition" @default.
• W2134653135 created "2016-06-24" @default.
• W2134653135 creator A5000246031 @default.
• W2134653135 creator A5013470681 @default.
• W2134653135 creator A5038733635 @default.
• W2134653135 date "1998-10-01" @default.
• W2134653135 modified "2023-10-16" @default.
• W2134653135 title "Identification of Amino Acid Residues That Form Part of the Ligand-binding Pocket of Integrin α5β1" @default.
• W2134653135 cites W1241436880 @default.
• W2134653135 cites W1504989678 @default.
• W2134653135 cites W1550140963 @default.
• W2134653135 cites W1555059577 @default.
• W2134653135 cites W1711549471 @default.
• W2134653135 cites W1972470306 @default.
• W2134653135 cites W1978708058 @default.
• W2134653135 cites W1987817886 @default.
• W2134653135 cites W1994679410 @default.
• W2134653135 cites W2005480360 @default.
• W2134653135 cites W2012998128 @default.
• W2134653135 cites W2022980133 @default.
• W2134653135 cites W2034215768 @default.
• W2134653135 cites W2053001031 @default.
• W2134653135 cites W2066874205 @default.
• W2134653135 cites W2074619197 @default.
• W2134653135 cites W2079402693 @default.
• W2134653135 cites W2085299722 @default.
• W2134653135 cites W2091681446 @default.
• W2134653135 cites W2105300288 @default.
• W2134653135 cites W2106066638 @default.
• W2134653135 cites W2114556048 @default.
• W2134653135 cites W2134596916 @default.
• W2134653135 cites W2147791888 @default.
• W2134653135 cites W2149659861 @default.
• W2134653135 cites W2155524198 @default.
• W2134653135 cites W2158499405 @default.
• W2134653135 cites W2244726815 @default.
• W2134653135 cites W2888511473 @default.
• W2134653135 cites W4212784685 @default.
• W2134653135 cites W4313341360 @default.
• W2134653135 cites W84740065 @default.
• W2134653135 doi "https://doi.org/10.1074/jbc.273.40.25664" @default.
• W2134653135 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9748233" @default.
• W2134653135 hasPublicationYear "1998" @default.
• W2134653135 type Work @default.
• W2134653135 sameAs 2134653135 @default.
• W2134653135 citedByCount "53" @default.
• W2134653135 countsByYear W21346531352012 @default.
• W2134653135 countsByYear W21346531352013 @default.
• W2134653135 countsByYear W21346531352014 @default.
• W2134653135 countsByYear W21346531352015 @default.
• W2134653135 countsByYear W21346531352016 @default.
• W2134653135 countsByYear W21346531352017 @default.
• W2134653135 countsByYear W21346531352018 @default.
• W2134653135 countsByYear W21346531352020 @default.
• W2134653135 countsByYear W21346531352021 @default.
• W2134653135 countsByYear W21346531352022 @default.
• W2134653135 countsByYear W21346531352023 @default.
• W2134653135 crossrefType "journal-article" @default.
• W2134653135 hasAuthorship W2134653135A5000246031 @default.
• W2134653135 hasAuthorship W2134653135A5013470681 @default.
• W2134653135 hasAuthorship W2134653135A5038733635 @default.
• W2134653135 hasBestOaLocation W21346531351 @default.
• W2134653135 hasConcept C107824862 @default.
• W2134653135 hasConcept C116569031 @default.
• W2134653135 hasConcept C116834253 @default.
• W2134653135 hasConcept C170493617 @default.
• W2134653135 hasConcept C185592680 @default.
• W2134653135 hasConcept C195687474 @default.
• W2134653135 hasConcept C515207424 @default.
• W2134653135 hasConcept C55493867 @default.
• W2134653135 hasConcept C59822182 @default.
• W2134653135 hasConcept C70721500 @default.
• W2134653135 hasConcept C71240020 @default.
• W2134653135 hasConcept C86803240 @default.
• W2134653135 hasConceptScore W2134653135C107824862 @default.
• W2134653135 hasConceptScore W2134653135C116569031 @default.
• W2134653135 hasConceptScore W2134653135C116834253 @default.
• W2134653135 hasConceptScore W2134653135C170493617 @default.
• W2134653135 hasConceptScore W2134653135C185592680 @default.
• W2134653135 hasConceptScore W2134653135C195687474 @default.
• W2134653135 hasConceptScore W2134653135C515207424 @default.
• W2134653135 hasConceptScore W2134653135C55493867 @default.
• W2134653135 hasConceptScore W2134653135C59822182 @default.
• W2134653135 hasConceptScore W2134653135C70721500 @default.
• W2134653135 hasConceptScore W2134653135C71240020 @default.
• W2134653135 hasConceptScore W2134653135C86803240 @default.
• W2134653135 hasIssue "40" @default.
• W2134653135 hasLocation W21346531351 @default.
• W2134653135 hasOpenAccess W2134653135 @default.
• W2134653135 hasPrimaryLocation W21346531351 @default.
• W2134653135 hasRelatedWork W1970974546 @default.
• W2134653135 hasRelatedWork W1980377213 @default.
• W2134653135 hasRelatedWork W2006697604 @default.
• W2134653135 hasRelatedWork W2036791608 @default.
• W2134653135 hasRelatedWork W2063728635 @default.
• W2134653135 hasRelatedWork W2085955934 @default.
• W2134653135 hasRelatedWork W2117699740 @default.
• W2134653135 hasRelatedWork W2397537422 @default.

• next