FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2137356688> ?p ?o ?g. }

• W2137356688 endingPage "4803" @default.
• W2137356688 startingPage "4795" @default.
• W2137356688 abstract "The vacuolar membrane H+-ATPase (V-ATPase) of the yeast Saccharomyces cerevisiae is composed of peripheral catalytic (V1) and integral membrane (V0) domains. The 17-kDa proteolipid subunit (VMA3 gene product; Vma3p) is predicted to constitute at least part of the proton translocating pore of V0. Recently, two VMA3 homologues, VMA11 and VMA16 (PPA1), have been identified in yeast, and VMA11 has been shown to be required for the V-ATPase activity. Cells disrupted for the VMA16 gene displayed the same phenotypes as those lacking either Vma3p or Vma11p; the mutant cells lost V-ATPase activity and failed to assemble V-ATPase subunits onto the vacuolar membrane. Epitope-tagged Vma11p and Vma16p were detected on the vacuolar membrane by immunofluorescence microscopy. Density gradient fractionation of the solubilized vacuolar proteins demonstrated that the tagged proteins copurified with the V-ATPase complex. We conclude that Vma11p and Vma16p are essential subunits of the V-ATPase. Vma3p contains a conserved glutamic acid residue (Glu137) whose carboxyl side chain is predicted to be important for proton transport activity. Mutational analysis of Vma11p and Vma16p revealed that both proteins contain a glutamic acid residue (Vma11p Glu145 and Vma16p Glu108) functionally similar to Vma3p Glu137. These residues could only be functionally substituted by an aspartic acid residue, because other mutations we examined inactivated the enzyme activity. Assembly and vacuolar targeting of the enzyme complex was not inhibited by these mutations. These results suggest that the three proteolipid subunits have similar but not redundant functions, each of which is most likely involved in proton transport activity of the enzyme complex. Yeast cells contain V0 and V1 subcomplexes in the vacuolar membrane and in the cytosol, respectively, that can be assembled into the active V0V1 complex in vivo. Surprisingly, loss-of-function mutations of either Vma11p Glu145 or Vma16p Glu108 resulted in a higher degree of assembly of the V1 subunits onto the V0 subcomplex in the vacuolar membrane. The vacuolar membrane H+-ATPase (V-ATPase) of the yeast Saccharomyces cerevisiae is composed of peripheral catalytic (V1) and integral membrane (V0) domains. The 17-kDa proteolipid subunit (VMA3 gene product; Vma3p) is predicted to constitute at least part of the proton translocating pore of V0. Recently, two VMA3 homologues, VMA11 and VMA16 (PPA1), have been identified in yeast, and VMA11 has been shown to be required for the V-ATPase activity. Cells disrupted for the VMA16 gene displayed the same phenotypes as those lacking either Vma3p or Vma11p; the mutant cells lost V-ATPase activity and failed to assemble V-ATPase subunits onto the vacuolar membrane. Epitope-tagged Vma11p and Vma16p were detected on the vacuolar membrane by immunofluorescence microscopy. Density gradient fractionation of the solubilized vacuolar proteins demonstrated that the tagged proteins copurified with the V-ATPase complex. We conclude that Vma11p and Vma16p are essential subunits of the V-ATPase. Vma3p contains a conserved glutamic acid residue (Glu137) whose carboxyl side chain is predicted to be important for proton transport activity. Mutational analysis of Vma11p and Vma16p revealed that both proteins contain a glutamic acid residue (Vma11p Glu145 and Vma16p Glu108) functionally similar to Vma3p Glu137. These residues could only be functionally substituted by an aspartic acid residue, because other mutations we examined inactivated the enzyme activity. Assembly and vacuolar targeting of the enzyme complex was not inhibited by these mutations. These results suggest that the three proteolipid subunits have similar but not redundant functions, each of which is most likely involved in proton transport activity of the enzyme complex. Yeast cells contain V0 and V1 subcomplexes in the vacuolar membrane and in the cytosol, respectively, that can be assembled into the active V0V1 complex in vivo. Surprisingly, loss-of-function mutations of either Vma11p Glu145 or Vma16p Glu108 resulted in a higher degree of assembly of the V1 subunits onto the V0 subcomplex in the vacuolar membrane. The vacuolar membrane ATPase (V-ATPase) 1The abbreviations used are: V-ATPaseS. cerevisiae vacuolar membrane ATPaseHAinfluenza virus hemagglutinin proteinVma11p-HAHA-tagged Vma11p, V-type ATPase, vacuolar-type ATPasePAGEpolyacrylamide gel electrophoresisDPAP-Bdipeptidyl aminopeptidase Bkbkilobase(s)ZW3-14zwitterionic detergent, N-tetradecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate. of the yeast Saccharomyces cerevisiae belongs to the vacuolar-type (V-type) proton pump (1Anraku Y. Umemoto N. Hirata R. Ohya Y. J. Bioenerg. Biomembr. 1992; 24: 395-405Google Scholar, 2Kakinuma Y. Ohsumi Y. Anraku Y. J. Biol. Chem. 1981; 256: 10859-10863Google Scholar, 3Kane P.M. Yamashiro C.T. Stevens T.H. J. Biol. Chem. 1989; 264: 19236-19244Google Scholar, 4Anraku Y. Konings W.N. Kaback H.R. Lolkema J.S. Handbook of Biological Physics. 2. Elsevier Science Publishing Co., Inc., New York1996: 93-109Google Scholar, 5Uchida E. Ohsumi Y. Anraku Y. J. Biol. Chem. 1985; 260: 1090-1095Google Scholar, 6Anraku Y. Hirata R. Wada Y. Ohya Y. J. Exp. Biol. 1992; 172: 67-81Google Scholar, 7Stevens T.H. J. Exp. Biol. 1992; 172: 47-55Google Scholar). The V-type ATPase acidifies various endomembrane organelles in eucaryotic cells, including the Golgi apparatus, lysosomes, coated vesicles, and chromaffin granules (8Forgac M. Physiol. Rev. 1989; 69: 765-796Google Scholar). This type of proton pump is also found in the plasma membrane of certain specialized cells (9Gluck S. J. Exp. Biol. 1992; 172: 29-37Google Scholar). Organelle acidification and/or membrane energization by the V-type ATPase is important for such processes as receptor-mediated endocytosis, protein sorting, zymogen activation, and solute uptake into a specific organelle (8Forgac M. Physiol. Rev. 1989; 69: 765-796Google Scholar, 10Wada Y. Anraku Y. J. Bioenerg. Biomembr. 1994; 26: 631-637Google Scholar, 11Mellman I. J. Exp. Biol. 1992; 172: 39-45Google Scholar). S. cerevisiae vacuolar membrane ATPase influenza virus hemagglutinin protein HA-tagged Vma11p, V-type ATPase, vacuolar-type ATPase polyacrylamide gel electrophoresis dipeptidyl aminopeptidase B kilobase(s) zwitterionic detergent, N-tetradecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate. The V-type ATPase consists of two structural domains, V1 and V0, both of which are composed of several different subunits (4Anraku Y. Konings W.N. Kaback H.R. Lolkema J.S. Handbook of Biological Physics. 2. Elsevier Science Publishing Co., Inc., New York1996: 93-109Google Scholar, 7Stevens T.H. J. Exp. Biol. 1992; 172: 47-55Google Scholar, 12Forgac M. J. Exp. Biol. 1992; 172: 155-169Google Scholar). The peripheral V1 domain possesses the nucleotide binding site(s) required for ATP hydrolysis (5Uchida E. Ohsumi Y. Anraku Y. J. Biol. Chem. 1985; 260: 1090-1095Google Scholar, 7Stevens T.H. J. Exp. Biol. 1992; 172: 47-55Google Scholar, 12Forgac M. J. Exp. Biol. 1992; 172: 155-169Google Scholar, 13Uchida E. Ohsumi Y. Anraku Y. J. Biol. Chem. 1988; 263: 45-51Google Scholar). The integral V0 domain translocates protons across the membrane and anchors the peripheral V1 domain to the membrane (4Anraku Y. Konings W.N. Kaback H.R. Lolkema J.S. Handbook of Biological Physics. 2. Elsevier Science Publishing Co., Inc., New York1996: 93-109Google Scholar, 7Stevens T.H. J. Exp. Biol. 1992; 172: 47-55Google Scholar, 12Forgac M. J. Exp. Biol. 1992; 172: 155-169Google Scholar). The yeast V-ATPase is composed of at least seven V1 subunits (69, 60, 54, 42, 32, 27, and 14 kDa) and three V0 subunits (100, 36, and 17 kDa) (14Manolson M.F. Proteau D. Preston R.A. Stenbit A. Roberts B.T. Hoyt M.A. Preuss D. Mulholland J. Botstein D. Jones E.W. J. Biol. Chem. 1992; 267: 14294-14303Google Scholar, 15Hirata R. Ohsumi Y. Nakano A. Kawasaki H. Suzuki K. Anraku Y. J. Biol. Chem. 1990; 265: 6726-6733Google Scholar, 16Nelson H. Mandiyan S. Nelson N. J. Biol. Chem. 1989; 264: 1775-1778Google Scholar, 17Yamashiro C.T. Kane P.M. Wolczyk D.F. Preston R.A. Stevens T.H. Mol. Cell. Biol. 1990; 10: 3737-3749Google Scholar, 8Forgac M. Physiol. Rev. 1989; 69: 765-796Google Scholar, 19Ho M.N. Hill K.J. Lindorfer M.A. Stevens T.H. J. Biol. Chem. 1993; 268: 221-227Google Scholar, 20Bauerle C. Ho M.N. Lindorfer M.A. Stevens T.H. J. Biol. Chem. 1993; 268: 12749-12757Google Scholar, 21Foury F. J. Biol. Chem. 1990; 265: 18554-18560Google Scholar, 22Graham L.A. Hill K.J. Stevens T.H. J. Biol. Chem. 1994; 269: 25974-25977Google Scholar, 23Graham L.A. Hill K.J. Stevens T.H. J. Biol. Chem. 1995; 270: 15037-15044Google Scholar, 24Nelson H. Nelson N. FEBS Lett. 1989; 247: 147-153Google Scholar, 25Umemoto N. Yoshihisa T. Hirata R. Anraku Y. J. Biol. Chem. 1990; 265: 18447-18453Google Scholar, 26Beltrán C. Kopecky J. Pan Y.-C.E. Nelson H. Nelson N. J. Biol. Chem. 1992; 267: 774-779Google Scholar). The 36-kDa subunit is not an integral membrane protein but stably associates with the V0 subcomplex and thus is considered to be a nonintegral component of the V0 domain (20Bauerle C. Ho M.N. Lindorfer M.A. Stevens T.H. J. Biol. Chem. 1993; 268: 12749-12757Google Scholar, 27Kane P.M. J. Biol. Chem. 1995; 270: 17025-17032Google Scholar). Recently, another essential subunit of 13 kDa was identified (28Supekova L. Supek F. Nelson N. J. Biol. Chem. 1995; 270: 13726-13732Google Scholar). The membrane disposition of this subunit has not yet been unambiguously determined. Yeast cells also express genes that encode proteins with sequence similarity to the 100-kDa (Vph1p) and the 17-kDa (Vma3p) 2In this paper, Vma3p and Vma11p are used to indicate the protein products of the respective genes. The term “the 17 kDa subunit” is reserved mainly for referring to the polypeptide biochemically identified in the V-ATPase complex. V-ATPase subunits (29Manolson M.F. Wu B. Proteau D. Taillon B.E. Roberts B.T. Hoyt M.A. Jones E.W. J. Biol. Chem. 1994; 269: 14064-14074Google Scholar, 30Umemoto N. Ohya Y. Anraku Y. J. Biol. Chem. 1991; 266: 24526-24532Google Scholar, 31Apperson M. Jensen R.E. Suda K. Witte C. Yaffe M.P. Biochem. Biophys. Res. Commun. 1990; 168: 574-579Google Scholar). STV1 encodes a polypeptide of 102 kDa with 54% amino acid identity to Vph1p (14Manolson M.F. Proteau D. Preston R.A. Stenbit A. Roberts B.T. Hoyt M.A. Preuss D. Mulholland J. Botstein D. Jones E.W. J. Biol. Chem. 1992; 267: 14294-14303Google Scholar, 29Manolson M.F. Wu B. Proteau D. Taillon B.E. Roberts B.T. Hoyt M.A. Jones E.W. J. Biol. Chem. 1994; 269: 14064-14074Google Scholar). Stv1p is localized to nonvacuolar membranes, possibly endosomal and/or Golgi membrane, and is not required for vacuolar membrane V-ATPase activity. Overexpression of Stv1p induces mislocalization of this protein to the vacuolar membrane and can partially complement the phenotypes associated with the loss of V-ATPase activity in Δvph1 mutant cells (29Manolson M.F. Wu B. Proteau D. Taillon B.E. Roberts B.T. Hoyt M.A. Jones E.W. J. Biol. Chem. 1994; 269: 14064-14074Google Scholar). From these observations, it has been proposed that yeast cells possess another V-type ATPase acidifying organelles (containing Stv1p) other than vacuoles and that the 100-kDa subunit isoforms are responsible for targeting of the V-type ATPases to different organelles (29Manolson M.F. Wu B. Proteau D. Taillon B.E. Roberts B.T. Hoyt M.A. Jones E.W. J. Biol. Chem. 1994; 269: 14064-14074Google Scholar). VMA11 and VMA16 genes can encode polypeptides of 17 and 23 kDa with 56 and 35% amino acid identity to Vma3p, respectively (24Nelson H. Nelson N. FEBS Lett. 1989; 247: 147-153Google Scholar, 25Umemoto N. Yoshihisa T. Hirata R. Anraku Y. J. Biol. Chem. 1990; 265: 18447-18453Google Scholar, 30Umemoto N. Ohya Y. Anraku Y. J. Biol. Chem. 1991; 266: 24526-24532Google Scholar, 31Apperson M. Jensen R.E. Suda K. Witte C. Yaffe M.P. Biochem. Biophys. Res. Commun. 1990; 168: 574-579Google Scholar). Vma3p is a hydrophobic polypeptide chemically characterized as a proteolipid (soluble in chloroform/methanol) and is thought to constitute all or part of the proton translocating pore in V0 (5Uchida E. Ohsumi Y. Anraku Y. J. Biol. Chem. 1985; 260: 1090-1095Google Scholar, 24Nelson H. Nelson N. FEBS Lett. 1989; 247: 147-153Google Scholar, 25Umemoto N. Yoshihisa T. Hirata R. Anraku Y. J. Biol. Chem. 1990; 265: 18447-18453Google Scholar). Homologous subunits are found universally in V-type ATPase complexes characterized from various membrane sources, and all amino acid sequences determined for the subunits contain a conserved glutamic acid residue predicted to be critical for proton transport activity (32Nelson N. J. Bioenerg. Biomembr. 1992; 24: 407-414Google Scholar). VMA11 was cloned by complementation of the growth defect of a calcium sensitive mutant, cls9 (30Umemoto N. Ohya Y. Anraku Y. J. Biol. Chem. 1991; 266: 24526-24532Google Scholar, 33Ohya Y. Umemoto N. Tanida I. Ohta A. Iida H. Anraku Y. J. Biol. Chem. 1991; 266: 13971-13977Google Scholar). Unlike STV1, VMA11 is required for the activity and assembly of the vacuolar membrane V-ATPase complex (30Umemoto N. Ohya Y. Anraku Y. J. Biol. Chem. 1991; 266: 24526-24532Google Scholar, 33Ohya Y. Umemoto N. Tanida I. Ohta A. Iida H. Anraku Y. J. Biol. Chem. 1991; 266: 13971-13977Google Scholar). VMA16 was originally identified as PPA1, an open reading frame adjacent to the MAS2 gene (31Apperson M. Jensen R.E. Suda K. Witte C. Yaffe M.P. Biochem. Biophys. Res. Commun. 1990; 168: 574-579Google Scholar). Initial gene disruption analysis demonstrated that Vma16p is important for cell growth (31Apperson M. Jensen R.E. Suda K. Witte C. Yaffe M.P. Biochem. Biophys. Res. Commun. 1990; 168: 574-579Google Scholar), but the physiological function of this protein remained unclear. In this work, the function of Vma11p and Vma16p was studied by examining the cellular localization of these proteins and by characterizing phenotypes of the cells carrying mutant forms of each protein. Our results indicate that Vma11p and Vma16p are novel V0 subunits of the V-ATPase complex essential for enzyme activity. We also report here that both proteins contain a glutamic acid residue important for their function as found for Vma3p (34Noumi T. Beltrán C. Nelson H. Nelson N. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 1938-1942Google Scholar), and inactivating mutations of these residues influence the assembly status of the enzyme complex. Yeast strains used in this study are listed in Table I. RHA374, LGY11, and LGY10 are VMA3::HA, VMA11:: HA, and VMA16::HA derivatives, respectively, of SF838-1D (35Rothman J.H. Stevens T.H. Cell. 1986; 47: 1041-1051Google Scholar). YRH11a and RHP110 are isogenic to YPH499 (36Sikorski R.S. Hieter P. Genetics. 1989; 122: 19-27Google Scholar) except Δvma11:: TRP1 and Δvma16::TRP1, respectively. RHA115 (VMA11::TRP1) was constructed by inserting a TRP1 gene fragment in the upstream region of the VMA11 in YPH499. RHA115 is Trp+ and Vma+. RHA116 (E145D), RHA117 (E145L), and RHA118 (E145Q) are vma11 mutant derivatives of RHA115. RHP1100-RHP1107 are isogenic to RHP110, except that each carries a wild type or mutant vma16 gene on a yeast low copy, centromere-based plasmid, pRS316 (36Sikorski R.S. Hieter P. Genetics. 1989; 122: 19-27Google Scholar). RHP1108 is RHP110 harboring pRS316.Table IStrains and plasmids used in this studyStrainsGenotypeReferencesSF838-1DMATα ura3-52 his4-519 ade6 leu2-3,112 pep4-3 gal235Rothman J.H. Stevens T.H. Cell. 1986; 47: 1041-1051Google ScholarYPH499MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ136Sikorski R.S. Hieter P. Genetics. 1989; 122: 19-27Google ScholarYPH501MATa/MATα ura3-52/ura3-52 lys2-801/lys2-801 ade2-101/ade2-101 trp1-Δ63/trp1-Δ63 his3-Δ200/his3-Δ200 leu2-Δ1/leu2-Δ136Sikorski R.S. Hieter P. Genetics. 1989; 122: 19-27Google ScholarYRH11aMATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 Δvma11::TRP1This studyRHP110MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 Δvma16::TRP1This studyRHA374MATα ura3-52 his4-519 ade6 leu2-3,112 pep4-3 gal2 VMA3::HAThis studyLGY11MATα ura3-52 his4-519 ade6 leu2-3,112 pep4-3 gal2 VMA11::HAThis studyLGY10MATα ura3-52 his4-519 ade6 leu2-3,112 pep4-3 gal2 VMA16::HAThis studyRHA115MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 VMA11::TRP1This studyRHA116MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 vma11(E145D)::TRP1This studyRHA117MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 vma11(E145L)::TRP1This studyRHA118MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 vma11(E145Q)::TRP1This studyRHP1100RHP110 carrying pRHP111 (VMA16)This studyRHP1101RHP110 carrying pRHP131 (vma16 E108D)This studyRHP1102RHP110 carrying pRHP132 (vma16 E108V)This studyRHP1103RHP110 carrying pRHP133 (vma16 E188D)This studyRHP1104RHP110 carrying pRHP134 (vma16 E188V)This studyRHP1105RHP110 carrying pRHP135 (vma16 E108L)This studyRHP1106RHP110 carrying pRHP136 (vma16 E108Q)This studyRHP1107RHP110 carrying pRHP137 (vma16 E188Q)This studyRHP1108RHP110 carrying pRS316This studyPlasmidsDescriptionReferencespRS316centromere-based, low copy plasmid (pCEN-URA3)36Sikorski R.S. Hieter P. Genetics. 1989; 122: 19-27Google ScholarpRHA1501.8-kb EcoRV-SpeI VMA11 gene fragment cloned into pBluescript KS+This studypRHP1113.4-kb XbaI-EcoRI VMA16 gene fragment cloned into pRS316This studypRHP131same as pRHP111 except vma16 E108DThis studypRHP132same as pRHP111 except vma16 E108VThis studypRHP133same as pRHP111 except vma16 E188DThis studypRHP134same as pRHP111 except vma16 E188VThis studypRHP135same as pRHP111 except vma16 E108LThis studypRHP136same as pRHP111 except vma16 E108QThis studypRHP137same as pRHP111 except vma16 E188QThis study Open table in a new tab Yeast cells were grown in YPD medium (1% yeast extract (Difco), 2% Bactopeptone (Difco), and 2% glucose), YPG medium (1% yeast extract, 2% Bactopeptone, and 3% glycerol), or YNBD medium (0.67% yeast nitrogen base (Difco) and 2% glucose). YPD medium was buffered at pH 5.0 or 7.5 with 50 mM phosphate/succinate buffer as described previously (17Yamashiro C.T. Kane P.M. Wolczyk D.F. Preston R.A. Stevens T.H. Mol. Cell. Biol. 1990; 10: 3737-3749Google Scholar). Calcium sensitivity of the cells was examined on YPD medium supplemented with 100 mM CaCl2 (33Ohya Y. Umemoto N. Tanida I. Ohta A. Iida H. Anraku Y. J. Biol. Chem. 1991; 266: 13971-13977Google Scholar). Null vma11 mutants were constructed as follows. A 1.8-kb EcoRV-SpeI fragment containing the VMA11 gene was cloned into pBluescript KS+ (Stratagene), creating pRHA150. pRHA150 was digested with XhoI and HindIII, blunted with Klenow, and religated to remove the ClaI and HincII sites originating from the multicloning site of pBluescript KS+. The 0.6-kb HincII-ClaI (blunt) fragment of pRHA151 was replaced with a 0.85-kb EcoRI-BglII (blunt) fragment of pJJ280 (TRP1) (37Jones J.S. Prakash L. Yeast. 1990; 6: 363-366Google Scholar) to create Δvma11::TRP1 (pRHA163). The Δvma11 fragment in pRHA163 was isolated from the plasmid by digestion with EcoRV and SpeI and used to construct the disruption strain YRH11a by the method as described previously (38Kaiser C. Michaelis S. Mitchell A. Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1994Google Scholar). Two oligonucleotide primers, atcgaagttgttttcagtctc and acatgtatctcagatatctca were synthesized based on the reported sequence of the VMA16 (PPA1) gene (31Apperson M. Jensen R.E. Suda K. Witte C. Yaffe M.P. Biochem. Biophys. Res. Commun. 1990; 168: 574-579Google Scholar) and used to amplify the gene fragment by polymerase chain reaction from yeast chromosomal DNA in the presence of digoxigenin-11-dUTP. A yeast genomic DNA library (18Ho M.N. Hirata R. Umemoto N. Ohya Y. Takatsuki A. Stevens T.H. Anraku Y. J. Biol. Chem. 1993; 268: 18286-18292Google Scholar) was screened by hybridization with the digoxigenin-labeled VMA16 fragment to isolate the full-length VMA16 gene. A 2.0-kb NcoI (blunt ended)-EcoRI fragment containing the VMA16 gene was cloned into the SmaI-EcoRI site of pUC119 (39Vieira J. Messing J. Methods Enzymol. 1987; 153: 3-11Google Scholar) to yield pRHP152. A 0.6-kb BamHI-EcoRV fragment within the VMA16 gene was replaced with a 0.94-kb BamHI-HincII TRP1 fragment from pJJ281 (37Jones J.S. Prakash L. Yeast. 1990; 6: 363-366Google Scholar) to create pRHP165. The Δvma16::TRP1 fragment was liberated from the plasmid by HpaI-BglI digestion and used to disrupt the chromosomal VMA16 gene by the method as described in Ref. 38Kaiser C. Michaelis S. Mitchell A. Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1994Google Scholar. VMA3::HA gene fragment was constructed as follows. A 1.6-kb EcoRI fragment containing the VMA3 open reading frame was cloned into pBluescript KS+, and the resultant plasmid was mutagenized to introduce AatII and NheI restriction sites near the 3′ end of the VMA3 open reading frame with a mutagenic primer, ctagctagcagacgacgtcttgagtagccctggagttca (40Sayers J.R. Schmidt W. Eckstein F. Nucleic Acids Res. 1988; 16: 791-802Google Scholar). Then the AatII-NheI fragment, encoding the last four amino acids of Vma3p, was replaced with a synthetic oligonucleotide duplex coding for the last four amino acids followed by a nine amino acid HA epitope (YPYDVPDYA) (41Kolodziej P.A. Young R.A. Methods Enzymol. 1991; 194: 508-519Google Scholar). A 1-kb AgeI-EcoRI fragment containing a part of the VMA3::HA gene fragment was cloned into a yeast integrating vector pRS306 (36Sikorski R.S. Hieter P. Genetics. 1989; 122: 19-27Google Scholar), digested with HindIII, and used to substitute for the chromosomal VMA3 gene by two step gene replacement (38Kaiser C. Michaelis S. Mitchell A. Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1994Google Scholar). Site-directed mutagenesis following the method of Kunkel (42Kunkel T.A. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 488-492Google Scholar) was performed to epitope tag VMA11 at the extreme C terminus. The primer ttttaaacttttgactcacgcatagtcaggaacatcatatgggtattcagagcctc was used to introduce the sequence encoding the HA epitope just prior to the stop codon of VMA11. The generation of pLG36 (pRS316-VMA11::HA) was determined by the introduction of a unique NdeI site within the oligonucleotide sequence (underlined). A 2-kb KpnI-SacI fragment from pLG36 containing VMA11::HA was subcloned into pRS306 creating pLG40. The chromosomal copy of VMA11 was replaced by VMA11::HA to generate the yeast strain LGY11 by transformation of SF838-1D with linearized pLG40 (BglII) and two-step gene replacement. The sequence encoding the HA epitope was introduced into VMA16 before the stop codon by site-directed mutagenesis using the primer tggtttgagcgcttacgcatagtcaggaacatcatatgggtactgaaattcagaagc. The creation of pLG32 (pRS316-VMA16::HA) was confirmed by the presence of a unique NdeI restriction enzyme site (underlined). pLG34 was generated by subcloning a 1.9-kb SacI-KpnI fragment from pLG32 containing VMA16::HA into pRS306. The chromosomal copy of VMA16 was replaced by VMA16::HA to generate the yeast strain LGY10 by transformation with linearized pLG34 (BstUI) as described above. vma11 genes with a mutation at the glutamic acid at position 145 (Glu145) were constructed by site-directed mutagenesis of pRHA150. Mutagenic primers used were, accatataaccctaacacgtcagagaaaattaga (E145D), tataaccctaaaactagtgagaaaattagaat (E145L), and taccatataaccctagtacttgagagaaaattagaat (E145Q). Each primer introduces a unique restriction site (underlined) to screen for the introduced mutation. A 0.85-kb EcoRI-BglII (blunt) fragment from pJJ280 (TRP1) (37Jones J.S. Prakash L. Yeast. 1990; 6: 363-366Google Scholar) was inserted at the SnaBI site of the resultant mutant plasmids as a marker for mutant selection. The SnaBI site is located ∼450 base pairs 5′ of the initiating ATG, and insertion of the TRP1 gene into the wild type VMA11 gene at this position did not affect the cell growth or the V-ATPase activity (data not shown). The mutant vma11 fragments were used to substitute for the chromosomal VMA11 gene in YPH499 to yield RHA116-118. vma11 mutants were selected by Trp+ phenotype, and introduction of the mutations was confirmed by Southern blot analysis of chromosomal DNA. A 3.4-kb XbaI-EcoRI fragment containing the VMA16 gene was cloned into pRS316 (36Sikorski R.S. Hieter P. Genetics. 1989; 122: 19-27Google Scholar) to create pRHP111. Site-directed mutagenesis of the VMA16 gene was done by two sequential polymerase chain reaction reactions with pRHP111 and overlapping forward and reverse mutagenic primers as described (40Sayers J.R. Schmidt W. Eckstein F. Nucleic Acids Res. 1988; 16: 791-802Google Scholar). Nucleotide sequences of the mutant gene fragments were confirmed by DNA sequence analysis. The wild type and mutant vma16 plasmids (listed in Table I) were introduced into RHP110 (Δvma16::TRP1) to yield RHP1100 (pRHP111, wild type), RHP1101 (pRHP131, E108D), RHP1102 (pRHP132, E108V), RHP1103 (pRHP133, E188D), RHP1104 (pRHP134, E188V), RHP1105 (pRHP135, E108L), RHP1106 (pRHP136, E108Q), and RHP1107 (pRHP137, E188Q). Preparation of vacuolar membrane fractions and purification of the V-ATPase were previously described (3Kane P.M. Yamashiro C.T. Stevens T.H. J. Biol. Chem. 1989; 264: 19236-19244Google Scholar, 5Uchida E. Ohsumi Y. Anraku Y. J. Biol. Chem. 1985; 260: 1090-1095Google Scholar). When vacuolar membranes were prepared from strains (RHP1100-RHP1108) expressing Vma16p from pRS316 (URA3+)-based plasmids, cells were grown in YNBD (−uracil) supplemented with 0.5% casamino acids (Difco). Each vacuolar membrane fraction was assayed for the vacuolar membrane marker, dipeptidyl aminopeptidase B (DPAP-B) (43Roberts C.J. Pohlig G. Rothman J.H. Stevens T.H. J. Cell Biol. 1989; 108: 1363-1373Google Scholar), and a purification index, which was expressed as the ratio of the specific DPAP-B activity in the vacuolar membrane to the activity in spheroplast lysate, was determined. Vacuolar membrane fractions with a purification index of >30 (5Uchida E. Ohsumi Y. Anraku Y. J. Biol. Chem. 1985; 260: 1090-1095Google Scholar) were used throughout this study. Protein extracts of whole cell and vacuolar membrane fractions were prepared as described by Hill and Stevens (44Hill K.J. Stevens T.H. Mol. Biol. Cell. 1994; 5: 1039-1050Google Scholar). Proteolipid subunits were purified by chloroform/methanol extraction of whole cell extracts or vacuolar membranes (45Hirata R. Umemoto N. Ho M.N. Ohya Y. Stevens T.H. Anraku Y. J. Biol. Chem. 1993; 268: 961-967Google Scholar). Crude membrane and cytosolic fractions were prepared as follows. Yeast cells were spheroplasted and lysed with a Dounce homogenizer in a buffer containing 50 mM Tris-HCl, pH 7.5, 0.2 M Sorbitol, 1 mM EDTA, 2 μg/ml each of antipain, aprotinin, leupeptin, chymostatin, pepstatin, and 0.5 mM phenylmethanesulfonyl fluoride. The homogenate was centrifuged at 500 × g for 5 min to remove unbroken cells and then fractionated into membrane and cytosolic fractions by centrifugation at 100,000 × g for 1 h. Proteins were solubilized and subjected to SDS-PAGE analysis as described in Ref. 20Bauerle C. Ho M.N. Lindorfer M.A. Stevens T.H. J. Biol. Chem. 1993; 268: 12749-12757Google Scholar. Immunoblots were prepared and probed as described (46Hill K.J. Stevens T.H. J. Biol. Chem. 1995; 270: 22329-22336Google Scholar). Monoclonal antibodies for the 100- (7B1), 69- (R70), and 42-kDa (7A2) subunits and polyclonal antisera for the 60-, 54-, 36-, and 27-kDa subunits were used under the conditions as described (46Hill K.J. Stevens T.H. J. Biol. Chem. 1995; 270: 22329-22336Google Scholar). Affinity purified antibodies that recognize the 12CA5 epitope peptide (YPYDVPDYA) were prepared and used as described (22Graham L.A. Hill K.J. Stevens T.H. J. Biol. Chem. 1994; 269: 25974-25977Google Scholar). Recombinant DNA manipulations were performed as described (38Kaiser C. Michaelis S. Mitchell A. Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1994Google Scholar, 47Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). Fluorescence microscopy was done essentially as described (44Hill K.J. Stevens T.H. Mol. Biol. Cell. 1994; 5: 1039-1050Google Scholar). Affinity purified anti-HA polyclonal serum was used at a 1:40 dilution. Vacuolar acidification in vivo was examined by quinacrine staining of the cells (25Umemoto N. Yoshihisa T. Hirata R. Anraku Y. J. Biol. Chem. 1990; 265: 18447-18453Google Scholar). V-ATPase activity (ATPase activity sensitive to 0.1 μM bafilomycin A1) of wild type and site-directed mutants was assayed at 30°C as described (5Uchida E. Ohsumi Y. Anraku Y. J. Biol. Chem. 1985; 260: 1090-1095Google Scholar). The reaction mixture (100 μl) contained 25 mM Tris-Mes (pH 6.9), 5 mM MgCl2, 25 mM KCl, 5 mM ATP-2Na+, and vacuolar membrane vesicles (10-20 μg of protein). Prior to the assay of ATPase activity, the reaction mixture (without ATP) was incubated with or without 0.1 μM bafilomycin A1 for 20 min on ice, and then the reaction was started by adding ATP. Bafilomycin A1 was added as an ethanolic solution, and control activities were determined in the presence of an equivalent amount of ethanol. All samples contained 1% ethanol, and this concentration of ethanol did not inhibit the enzyme activity. V-ATPase activity of the membrane fractions from LGY11 (VMA11::HA), LGY10 (VMA16::H" @default.
• W2137356688 created "2016-06-24" @default.
• W2137356688 creator A5026009753 @default.
• W2137356688 creator A5039130332 @default.
• W2137356688 creator A5049690827 @default.
• W2137356688 creator A5051850457 @default.
• W2137356688 creator A5065979182 @default.
• W2137356688 date "1997-02-01" @default.
• W2137356688 modified "2023-10-17" @default.
• W2137356688 title "VMA11 and VMA16 Encode Second and Third Proteolipid Subunits of the Saccharomyces cerevisiae Vacuolar Membrane H+-ATPase" @default.
• W2137356688 cites W1481801182 @default.
• W2137356688 cites W1494174270 @default.
• W2137356688 cites W1497077766 @default.
• W2137356688 cites W1497289365 @default.
• W2137356688 cites W1501217717 @default.
• W2137356688 cites W1509504914 @default.
• W2137356688 cites W1519338837 @default.
• W2137356688 cites W1521277810 @default.
• W2137356688 cites W1535401962 @default.
• W2137356688 cites W1537141010 @default.
• W2137356688 cites W1555021163 @default.
• W2137356688 cites W1556265505 @default.
• W2137356688 cites W1556766638 @default.
• W2137356688 cites W1567706221 @default.
• W2137356688 cites W1573088096 @default.
• W2137356688 cites W1574501720 @default.
• W2137356688 cites W1578803116 @default.
• W2137356688 cites W1580000922 @default.
• W2137356688 cites W1582076669 @default.
• W2137356688 cites W1592537807 @default.
• W2137356688 cites W1625553880 @default.
• W2137356688 cites W1643128520 @default.
• W2137356688 cites W1659491860 @default.
• W2137356688 cites W1871807437 @default.
• W2137356688 cites W1936682549 @default.
• W2137356688 cites W1940939086 @default.
• W2137356688 cites W1953650076 @default.
• W2137356688 cites W1970705112 @default.
• W2137356688 cites W1972620810 @default.
• W2137356688 cites W1974750678 @default.
• W2137356688 cites W1989324307 @default.
• W2137356688 cites W1997682893 @default.
• W2137356688 cites W1998301733 @default.
• W2137356688 cites W1999091522 @default.
• W2137356688 cites W2014234644 @default.
• W2137356688 cites W2036931150 @default.
• W2137356688 cites W2039037981 @default.
• W2137356688 cites W2044804894 @default.
• W2137356688 cites W2046818599 @default.
• W2137356688 cites W2054490545 @default.
• W2137356688 cites W2062872843 @default.
• W2137356688 cites W2091241727 @default.
• W2137356688 cites W2123982967 @default.
• W2137356688 cites W2124006800 @default.
• W2137356688 cites W2132042764 @default.
• W2137356688 cites W2158561703 @default.
• W2137356688 cites W2169333620 @default.
• W2137356688 cites W2231864270 @default.
• W2137356688 cites W2410071986 @default.
• W2137356688 cites W4212897402 @default.
• W2137356688 cites W4318971819 @default.
• W2137356688 cites W43340927 @default.
• W2137356688 cites W5404037 @default.
• W2137356688 doi "https://doi.org/10.1074/jbc.272.8.4795" @default.
• W2137356688 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9030535" @default.
• W2137356688 hasPublicationYear "1997" @default.
• W2137356688 type Work @default.
• W2137356688 sameAs 2137356688 @default.
• W2137356688 citedByCount "188" @default.
• W2137356688 countsByYear W21373566882012 @default.
• W2137356688 countsByYear W21373566882013 @default.
• W2137356688 countsByYear W21373566882014 @default.
• W2137356688 countsByYear W21373566882015 @default.
• W2137356688 countsByYear W21373566882016 @default.
• W2137356688 countsByYear W21373566882017 @default.
• W2137356688 countsByYear W21373566882018 @default.
• W2137356688 countsByYear W21373566882019 @default.
• W2137356688 countsByYear W21373566882020 @default.
• W2137356688 countsByYear W21373566882021 @default.
• W2137356688 countsByYear W21373566882023 @default.
• W2137356688 crossrefType "journal-article" @default.
• W2137356688 hasAuthorship W2137356688A5026009753 @default.
• W2137356688 hasAuthorship W2137356688A5039130332 @default.
• W2137356688 hasAuthorship W2137356688A5049690827 @default.
• W2137356688 hasAuthorship W2137356688A5051850457 @default.
• W2137356688 hasAuthorship W2137356688A5065979182 @default.
• W2137356688 hasBestOaLocation W21373566881 @default.
• W2137356688 hasConcept C104292427 @default.
• W2137356688 hasConcept C104317684 @default.
• W2137356688 hasConcept C181199279 @default.
• W2137356688 hasConcept C185592680 @default.
• W2137356688 hasConcept C23265538 @default.
• W2137356688 hasConcept C2777576037 @default.
• W2137356688 hasConcept C2779222958 @default.
• W2137356688 hasConcept C41625074 @default.
• W2137356688 hasConcept C55493867 @default.
• W2137356688 hasConcept C86803240 @default.
• W2137356688 hasConcept C95444343 @default.

• next