FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2137633825> ?p ?o ?g. }

• W2137633825 endingPage "1343" @default.
• W2137633825 startingPage "1336" @default.
• W2137633825 abstract "Although the etiology of sarcoidosis is unknown, genetic susceptibility has been demonstrated. Granuloma formation is a key feature in the pathophysiology of sarcoidosis and Crohn’s Disease, raising the possibility that these diseases share common pathogenetic pathways. An association between sarcoidosis and the protein “CD14”, a molecule that is part of the lipopolysaccharide (LPS) cell surface receptor complex, has been suggested.In the current study we evaluated the CD14 gene promoter 159 C→T polymorphic site and soluble CD14 levels in a cohort of 74 sarcoidosis patients compared to 85 healthy controls. We further sought to identify correlations between clinical phenotype, specific genotypes and soluble CD14 levels.We found the TT genotype to be more prevalent in the sarcoidosis patient group than in controls (p=0.03). Serum levels of soluble CD14 were higher in the sarcoidosis patients (p=0.001). Within the patient cohort, CC homozygous patients presented at an older age with milder disease as assessed with the SAC score, longer time to diagnosis, and less impairment of pulmonary function tests.Our study suggests a role of CD14 in the pathogenesis of sarcoidosis, and a clinical phenotype-genotype association. Further mechanistic and epidemiologic studies are needed in order to establish the specific role of CD14 in the etiology, pathogenesis and clinical phenotype of sarcoidosis. Although the etiology of sarcoidosis is unknown, genetic susceptibility has been demonstrated. Granuloma formation is a key feature in the pathophysiology of sarcoidosis and Crohn’s Disease, raising the possibility that these diseases share common pathogenetic pathways. An association between sarcoidosis and the protein “CD14”, a molecule that is part of the lipopolysaccharide (LPS) cell surface receptor complex, has been suggested. In the current study we evaluated the CD14 gene promoter 159 C→T polymorphic site and soluble CD14 levels in a cohort of 74 sarcoidosis patients compared to 85 healthy controls. We further sought to identify correlations between clinical phenotype, specific genotypes and soluble CD14 levels. We found the TT genotype to be more prevalent in the sarcoidosis patient group than in controls (p=0.03). Serum levels of soluble CD14 were higher in the sarcoidosis patients (p=0.001). Within the patient cohort, CC homozygous patients presented at an older age with milder disease as assessed with the SAC score, longer time to diagnosis, and less impairment of pulmonary function tests. Our study suggests a role of CD14 in the pathogenesis of sarcoidosis, and a clinical phenotype-genotype association. Further mechanistic and epidemiologic studies are needed in order to establish the specific role of CD14 in the etiology, pathogenesis and clinical phenotype of sarcoidosis. Sarcoidosis is a systemic inflammatory granulomatous disease that can involve almost every organ system in the body. The course of the disease is highly variable and unpredictable, ranging from a mild self-limiting form to a severe debilitating and even fatal disease.1Costabel U. Hunninghake G.W. ATS/ERS/WASOG statement on sarcoidosis. Sarcoidosis Statement Committee. American Thoracic Society. European Respiratory Society. World Association for Sarcoidosis and Other Granulomatous Disorders.Eur Respir J. 1999; 14: 735-737Crossref PubMed Scopus (326) Google Scholar, 2Rybicki B.A. Iannuzzi M.C. Frederick M.M. Thompson B.W. Rossman M.D. Bresnitz E.A. Terrin M.L. Moller D.R. Barnard J. Baughman R.P. DePalo L. Hunninghake G. Johns C. Judson M.A. Knatterud G.L. McLennan G. Newman L.S. Rabin D.L. Rose C. Teirstein A.S. Weinberger S.E. Yeager H. Cherniack R. the A.R.G. Familial aggregation of sarcoidosis. A case–control etiologic study of sarcoidosis (ACCESS).Am J Respir Crit Care Med. 2001; 164: 2085-2091Crossref PubMed Scopus (344) Google Scholar The etiology of sarcoidosis is unknown, however, genetic susceptibility has been demonstrated, with evidence of familial aggregation and racial variance in disease incidence.3Martin II, W.J. Iannuzzi M.C. Gail D.B. Peavy H.H. Future directions in sarcoidosis research: summary of an NHLBI working group.Am J Respir Crit Care Med. 2004; 170: 567-571Crossref PubMed Scopus (53) Google Scholar, 4Schurmann M. Reichel P. Muller-Myhsok B. Schlaak M.A.X. Muller-Quernheim J. Schwinger E. Results from a genome-wide search for predisposing genes in sarcoidosis.Am J Respir Crit Care Med. 2001; 164: 840-846Crossref PubMed Scopus (180) Google Scholar, 5Pandey J.P. Frederick M. TNF-[alpha], IL1-[beta], and immunoglobulin (GM and KM) gene polymorphisms in sarcoidosis.Human Immunol. 2002; 63: 485-491Crossref PubMed Scopus (35) Google Scholar, 6Iannuzzi M.C. Maliarik M.J. Poisson L.M. Rybicki B.A. Sarcoidosis susceptibility and resistance HLA-DQB1 alleles in African Americans.Am J Respir Crit Care Med. 2003; 167: 1225-1231Crossref PubMed Scopus (97) Google Scholar The characteristic pathological feature of sarcoidosis is the non-caseating granuloma. The mechanism of granuloma formation involves the activation of Th1 helper cells by Antigen Presenting Cells (APC’s), and secretion of monocyte chemotactic cytokines.1Costabel U. Hunninghake G.W. ATS/ERS/WASOG statement on sarcoidosis. Sarcoidosis Statement Committee. American Thoracic Society. European Respiratory Society. World Association for Sarcoidosis and Other Granulomatous Disorders.Eur Respir J. 1999; 14: 735-737Crossref PubMed Scopus (326) Google Scholar, 2Rybicki B.A. Iannuzzi M.C. Frederick M.M. Thompson B.W. Rossman M.D. Bresnitz E.A. Terrin M.L. Moller D.R. Barnard J. Baughman R.P. DePalo L. Hunninghake G. Johns C. Judson M.A. Knatterud G.L. McLennan G. Newman L.S. Rabin D.L. Rose C. Teirstein A.S. Weinberger S.E. Yeager H. Cherniack R. the A.R.G. Familial aggregation of sarcoidosis. A case–control etiologic study of sarcoidosis (ACCESS).Am J Respir Crit Care Med. 2001; 164: 2085-2091Crossref PubMed Scopus (344) Google Scholar, 3Martin II, W.J. Iannuzzi M.C. Gail D.B. Peavy H.H. Future directions in sarcoidosis research: summary of an NHLBI working group.Am J Respir Crit Care Med. 2004; 170: 567-571Crossref PubMed Scopus (53) Google Scholar Formation of granulomas is also an essential process in the pathophysiology of Crohn’s Disease, raising the possibility that these two diseases share common pathogenetic pathways.3Martin II, W.J. Iannuzzi M.C. Gail D.B. Peavy H.H. Future directions in sarcoidosis research: summary of an NHLBI working group.Am J Respir Crit Care Med. 2004; 170: 567-571Crossref PubMed Scopus (53) Google Scholar, 7Knoell K.A. Hendrix Jr., J.D. Stoler M.H. Patterson J.W. Montes C.M. Absence of human herpesvirus 8 in sarcoidosis and crohn disease granulomas.Arch Dermatol. 2005; 141: 909-910Crossref PubMed Google Scholar CD14 is a myeloid-monocytic marker antigen, expressed as either a 55 kDa membrane bound protein (mCD14), or as a 48 kDa soluble plasma protein (sCD14).8Guha M. Mackman N. LPS induction of gene expression in human monocytes.Cell Signal. 2001; 13: 85-94Crossref PubMed Scopus (1864) Google Scholar It acts as part of the lipopolysaccharide (LPS) cell surface receptor complex. CD14 binding leads to the activation of NFκB, followed by up-regulation of inflammatory mediators.8Guha M. Mackman N. LPS induction of gene expression in human monocytes.Cell Signal. 2001; 13: 85-94Crossref PubMed Scopus (1864) Google Scholar Despite significant progress in understanding the origin of soluble CD14 (sCD14), its physiological function remains largely unknown.9Jacque B. Stephan K. Smirnova I. Kim B. Gilling D. Poltorak A. Mice expressing high levels of soluble CD14 retain LPS in the circulation and are resistant to LPS-induced lethality.Eur J Immunol. 2006; 36: 3007-3016Crossref PubMed Scopus (20) Google Scholar On one hand, sCD14 has been shown to induce an inflammatory response in non-myeloid cells lacking the membrane bound form of the protein.10Tapping R. Tobias P. Soluble CD14-mediated cellular responses to lipopolysaccharide.Chem Immunol. 2000; 74: 108-121Crossref PubMed Google Scholar In contrast, sCD14 has been shown to have beneficial properties in protection against LPS-induced endotoxin shock, by acting as a competitive inhibitor of LPS binding to mCD14.9Jacque B. Stephan K. Smirnova I. Kim B. Gilling D. Poltorak A. Mice expressing high levels of soluble CD14 retain LPS in the circulation and are resistant to LPS-induced lethality.Eur J Immunol. 2006; 36: 3007-3016Crossref PubMed Scopus (20) Google Scholar The presence of a single nucleotide polymorphism (SNP) in the proximal promoter of the CD14 gene, 159 C→T, has been shown to be related to higher plasma levels of sCD14 (TT), and lower levels of IgE.11Baldini M. Carla Lohman I. Halonen M. Erickson R.P. Holt P.G. Martinez F.D. A Polymorphism* in the 5’ flanking region of the CD14 gene is associated with circulating soluble CD14 levels and with total serum immunoglobulin E.Am J Respir Cell Mol Biol. 1999; 20: 976-983Crossref PubMed Scopus (754) Google Scholar This suggests a role for CD14 in diverting the immune response from a Th2 towards Th1 phenotype.11Baldini M. Carla Lohman I. Halonen M. Erickson R.P. Holt P.G. Martinez F.D. A Polymorphism* in the 5’ flanking region of the CD14 gene is associated with circulating soluble CD14 levels and with total serum immunoglobulin E.Am J Respir Cell Mol Biol. 1999; 20: 976-983Crossref PubMed Scopus (754) Google Scholar, 12Leung T.-F. Tang N.L.S. Wong G.W.K. Fok T.-F. CD14 and toll-like receptors: potential contribution of genetic factors and mechanisms to inflammation and allergy.Curr Drug Targets – Inflamm Allergy. 2005; 4: 169-175Crossref PubMed Scopus (36) Google Scholar An increased frequency of the T allele has been reported in Crohn’s disease.13Klein W. Tromm A. Griga T. Folwaczny C. Hocke M. Eitner K. Marx M. Duerig N. Epplen J.T. Interaction of polymorphisms in the CARD15 and CD14 genes in patients with Crohn disease.Scand J Gastroenterol. 2003; 38: 834Crossref PubMed Scopus (30) Google Scholar, 14Gazouli M. Mantzaris G. Kotsinas A. Zacharatos P. Papalambros E. Archimandritis A. Ikonomopoulos J. Gorgoulis V. Association between polymorphisms in the Toll-like receptor 4, CD14, and CARD15/NOD2 and inflammatory bowel disease in the Greek population.World J Gastroenterol. 2005; 11: 681-685PubMed Google Scholar, 15Klein W. Tromm A. Griga T. Fricke H. Folwaczny C. Hocke M. Eitner K. Marx M. Duerig N. Epplen J.T. A polymorphism in the CD14 gene is associated with Crohn disease.Scand J Gastroenterol. 2002; 37: 189-191Crossref PubMed Scopus (86) Google Scholar A possible relationship between Sarcoidosis and CD14 has been suggested previously.16Striz I. Zheng l. Wang Y. Pokorna H. Bauer P. Costabel U. Soluble CD14 is increased in bronchoalveolar lavage of active sarcoidosis and correlates with alveolar macrophage membrane-bound CD14.Am J Respir Crit Care Med. 1995; 151: 544-547Crossref PubMed Scopus (37) Google Scholar, 17Pforte A. Schiessler A. Gais P. Beer B. Ehlers M. Schutt C. Ziegler-Heitbrock H. Expression of CD14 correlates with lung function impairment in pulmonary sarcoidosis.Chest. 1994; 105: 349-354Crossref PubMed Scopus (28) Google Scholar, 18Gazouli M. Koundourakis A. Ikonomopoulos J. Gialafos E.J. Rapti A. Gorgoulis V.G. Kittas C. CARD15/NOD2, CD14, and toll-like receptor 4 gene polymorphisms in Greek patients with sarcoidosis.Sarcoidosis Vasc Diffuse Lung Dis. 2006; 23: 23-29PubMed Google Scholar, 19Kelly D.M. Greene C.M. Meachery G. O’Mahony M. Gallagher P.M. Taggart C.C. O’Neill S.J. McElvaney N.G. Endotoxin up-regulates interleukin-18: potential role for gram-negative colonization in sarcoidosis.Am J Respir Crit Care Med. 2005; 172: 1299-1307Crossref PubMed Scopus (27) Google Scholar DNA from Gram-negative bacteria and elevated levels of LPS in Bronchoalveolar Lavage (BAL) have been observed in sarcoidosis patients.19Kelly D.M. Greene C.M. Meachery G. O’Mahony M. Gallagher P.M. Taggart C.C. O’Neill S.J. McElvaney N.G. Endotoxin up-regulates interleukin-18: potential role for gram-negative colonization in sarcoidosis.Am J Respir Crit Care Med. 2005; 172: 1299-1307Crossref PubMed Scopus (27) Google Scholar Furthermore, The −159 C→T polymorphism in the CD14 gene has been shown to increase TNF-α production in response to LPS and Gram-positive and Gram-negative bacteria.20Temple S.E.L. Cheong K.Y. Almeida C.M. Price P. Waterer G.W. Polymorphisms in lymphotoxin alpha and CD14 genes influence TNF[alpha] production induced by gram-positive and gram-negative bacteria.Genes Immun. 2003; 4: 283-288Crossref PubMed Scopus (42) Google Scholar In the current study we evaluated the CD14 159 C→T polymorphic site and determined soluble CD14 levels in a cohort of 74 sarcoidosis patients and compared these to a cohort of 85 healthy controls. We further sought to identify the presence of correlations between clinical phenotype, specific genotypes (TT, CT, CC) and soluble CD14 levels. Patients were recruited from a 12-year database (1995–2006), of patients diagnosed with Sarcoidosis by the pathology service at the Hadassah Medical Center Jerusalem, Israel and from patients attending a large outpatient pulmonary clinic in Jerusalem. Charts of patients with a biopsy from lung, lymph nodes or skin compatible with sarcoidosis (non-caseating granulomata), were evaluated. Patients with a compatible clinical picture as determined by symptoms, laboratory abnormalities and/or imaging and without another identified cause of granulomatous disease were included in the initial cohort. Clinical and demographic information was gathered from a patient questionnaire, hospital medical records and a treating physician questionnaire. Where we found discrepancies between the data reported by the patient and that found in physician’s questionnaires or in medical records, we used the latter. Blood samples were obtained from patients for DNA analysis. A cohort of healthy subjects with no significant medical background, and no regular medications was recruited as a control group (n=85). All participants signed an Informed Consent Form and the study was approved by the institutional Ethics Committee. Duration of symptoms prior to diagnosis was evaluated from patient reports and documented medical records. Cases in which duration of symptoms could not be accurately evaluated were excluded from analysis. Determination of which organ systems were involved in the disease was evaluated based on patient records and physician questionnaires. The severity assessment of sarcoidosis was done using the modified Sarcoidosis Activity (SAC) Score.21Wasfi Y.S. Rose C.S. Murphy J.R. Silveira L.J. Grutters J.C. Inoue Y. Judson M.A. Maier L.A. A new tool to assess sarcoidosis severity.Chest. 2006; 129: 1234-1245Crossref PubMed Scopus (50) Google Scholar This score assesses disease severity using the following equation:Score=11.46+3.9C+2.56N+1.56(IS)−0.051(FVC % predicted)+1.75(AA)−0.054(FEV1/FVC)where C=cardiac involvement (0/1), N=Neurologic Involvement, IS=non-steroid immunosuppression (0/1), AA=African American. Plasma was separated from the blood samples obtained, and immediately frozen at −20 °C. sCD14 levels in the plasma were measured using the commercially available CD14 DuoSet ELISA development Kit, according to the protocol supplied by the manufacturer (R&D Systems, Minneapolis, MN). Genomic DNA was extracted from anticoagulated whole blood collected in EDTA from patients and controls. Isolation of DNA was done by phenol–chloroform extraction and alcohol precipitation as previously described.22Kochl S. Niederstatter H. Parson W. DNA extraction and quantitation of forensic samples using the phenol-chloroform method and real-time PCR.Methods Mol Biol. 2005; 297: 13-30PubMed Google Scholar The CD14 –159C→T polymorphism was assessed by Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP), as previously described.23Nishimura S. Zaitsu M. Hara M. Yokota G. Watanabe M. Ueda Y. Imayoshi M. Ishii E. Tasaki H. Hamasaki Y. A polymorphism in the promoter of the CD14 gene (CD14/-159) is associated with the development of coronary artery lesions in patients with Kawasaki disease.J Pediatrics. 2003; 143: 357-362Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar PCR amplification was performed using the following primers: Forward: 5’GCCTCTGACAGTTTATGTAATC3’. Reverse: 5’GTGCCAACAGATGAGGTTCAC3’. (Sigma, Israel). The PCR product was then digested by the restriction enzyme AVAII (New England Biolabs, Ipswich, MA) in 37 °C for 10 h, resolved by electrophoresis on 1.8% Agarose Gel (SeaKem LE Agarose, Cambrex) and stained with Ethidium Bromide (Sigma, Israel). The presence of the T allele creates a restriction site for AVAII, yielding a 144-bp and 353-bp bands, whereas the C allele, which remains uncut, yields a single 497-bp band. For this analysis, we used only lung function tests (LFT) that were performed at the time of diagnosis when patients were on no treatment. Patients that did not have available LFT at the time of diagnosis were excluded from this analysis. Spirometry was performed using a pneumotachograph-based system. The reference equations and corrections used for the measurements of spirometry, lung volumes and DLCO were those published by the European Community for Coal and Steel (ECCS).24Quanjer P.H. Tammeling G.J. Cotes J.E. Pedersen O.F. Peslin R. Yernault J.C. Lung volumes and forced ventilatory flows. Report working party standardization of lung function tests, European community for steel and coal. Official statement of the European respiratory society.Eur Respir J Suppl. 1993; 16: 5-40PubMed Google Scholar No ethnic correction factors are used for our patients. Differences in demographic parameters in the study groups, the frequencies of the polymorphic genotypes and clinical differences between them were analyzed using the proper χ2-test (either 2×2 or 2×3 according to the question tested). The difference between sCD14 levels in controls vs. Sarcoidosis patients, and the comparisons of continuous parameters (i.e. lung function tests) comparing the CC genotype to the non-CC genotype were analyzed using Student’s t-test. To evaluate the level of sCD14 in the different genotypes, we used ANOVA with appropriate post hoc testing. p<0.05 was considered to be statistically significant. A total of 350 sarcoidosis patients were identified. Of these, seventy-four patients together with 85 control subjects were recruited for this study. 32.4% of the patients and 42.8% of the controls were males, 77% of the patients and 82.4% of the controls were of Jewish origin (both differences - NS). Remaining subjects in both groups were of Arab origin. Table 1 presents the clinical data of the sarcoidosis patients. The average age at diagnosis was 52.7±11.5 years. Most patients in this cohort (82%) were diagnosed by endobronchial and/or transbronchial biopsies performed via fiberoptic bronchoscopy. In only one patient a surgical lung biopsy was required for diagnosis. The most common symptoms at presentation were cough (60%) and dyspnea (66%) and 77% of the patients had at-least one of these two respiratory symptoms. An additional 12% of patients, who did not have respiratory symptoms, were found to have pulmonary involvement on biopsy or imaging studies. Thoracic lymph nodes were enlarged in 85% of the patients, as noted by imaging. Pulmonary parenchymal involvement was noted in 85% of the patients. Interstitial markings in the lung parenchyma were reported in 47%, and nodular patterns in 47%. The majority of the patients (61%) had the Scadding radiographic score of 2. About half the patients required treatment with systemic corticosteroids during the course of their disease and 17.6% received additional treatment. 8.1% of patients were treated with methotrexate.Table 1Demographic and clinical characteristics of the sarcoidosis patients.% of patients (n)Age at diagnosis (years)52.7±11.5GenderMale32.4 (24)Female67.6 (50)SymptomsDyspnea59.5 (44)Cough66.2 (49)Any respiratory symptom77 (57)Fever16.2 (12)Weight loss16.2 (12)Arthralgia/arthritis25.7 (19)Ocular symptoms4.1 (3)Skin13.5 (10)Asymptomatic14.9 (11)Others12.2 (9)Duration of symptoms prior to diagnosis (n=54)<1 m15 (8)1–3 m38.9 (21)4–6 m3.7 (2)7–12 m20.4 (11)>12 m22.2 (12)Pathological involvement shown (granulomata)Lung83.8 (62)Thoracic LN4.1 (3)Extra Thoracic LN4.1 (3)Liver2.7 (2)Bone marrow1.4 (1)Skin2.7 (2)Others1.4 (1)Extent of disease (Objective and/or subjective)Pulmonary89.2 (66)Thoracic LN87.8 (65)Extra-thoracic LN23 (17)Parenchymal Disease20.3 (15)Ocular14.9 (11)Joints27 (20)Hypercalcemia/hypercalciuria5.4 (4)Skin14.9 (11)neurologic2.7 (2)Cardiac2.7 (2)Others2.7 (2)Radiology findingsThoracic LN85.1 (63)Interstitial markings47.3(35)Nodular opacities47.3 (35)Cervical/axillary/supra-clavicular LN6.8 (5)Retroperitoneal/mesenteric LN10.8 (8)Hepato-splenic involvement20.3 (15)Unknown2.7 (2)Scadding chest radiographic class02.7 (2)113.5 (10)268.9 (51)38.1 (6)46.8 (5)Pulmonary function tests (% of predicted±SD)Total lung capacity (TLC)92.9±14.5Functional residual capacity (FRC)92.8±18Vital capacity (VC)92.4±20.6Residual volume (RV)106.4±26.3Forced expiratory volume 1.0 s (FEV1)85.5±21.6Forced vital capacity (FVC)89±19.7FEV1/FVC79.1±10.3DLCO80.4±18.5Treatment (tx)Methotrexate8.11 (6)Ever Required Steroids48.6 (36)Treated – not with steroids/cytotoxics9.5 (7)No Tx or unknown33.8 (25) Open table in a new tab Fig. 1 shows the frequency of the different genotypes of CD14 in the sarcoidosis patients and the healthy controls. The distribution of the genotypes was not significantly different between patients with sarcoidosis and controls. However, we noted a trend toward more of the sarcoidosis patients being homozygous for the T allele (genotype TT, 29.7% vs. 20% in controls), and less being homozygous for the CC allele (Genotype CC, 23% vs. 32%). Mean serum levels of sCD14 were 1.9±0.96 μg/ml in the sarcoidosis patients, and 1.31±0.77 μg/ml in the healthy control group (p=0.001) (Fig. 2). We noted a trend that in the sarcoidosis patients with sCD14>1.9 (mean level), the percentage of patients with the CC genotype was 29.4% (10/34) compared to 17.5% only (7/40) in the patients with sCD14 levels below that level (p=0.09). We did not find clear correlation between any specific genotype and sCD14 serum levels in either the patients (Fig. 2b) or healthy control subjects (data not shown). In order to factor in the effect of corticosteroid treatment at the time of sCD14 evaluation, we compared the level of sCD14 between patients that were not treated at all (n=24), and patients that were treated with corticosteroids at any time (n=37). The level of sCD14 was 1.87±0.15 without treatment, and 1.82±0.18 with corticosteroids (NS). The level of sCD14 in sarcoidosis patients that were never treated was significantly higher than in healthy controls (p<0.05). In order to evaluate the influence of CD14 genotypes, we compared the clinical characteristics of the patients according to different genotypes. Our first impression was that the patients with the CC phenotype had milder disease. This premise was supported by assessing the severity of the disease using the SAC score.21Wasfi Y.S. Rose C.S. Murphy J.R. Silveira L.J. Grutters J.C. Inoue Y. Judson M.A. Maier L.A. A new tool to assess sarcoidosis severity.Chest. 2006; 129: 1234-1245Crossref PubMed Scopus (50) Google Scholar As can be seen in Fig. 3, the mean score in the CC homozygous group (patients lacking the T allele, 17/74, 23% of patients) was 2.19±0.24. This was significantly different than the mean score in the TT homozygous group (3.44±0.31, p<0.05), and from the mean score in the TC heterozygous group (3.30±0.39, p<0.05). There was no significant difference between the TC and the TT groups. Furthermore, similar to the trend in our data, it has been shown that the presence of the T allele (e.g. TC and TT) is associated with increased susceptibility for developing sarcoidosis,18Gazouli M. Koundourakis A. Ikonomopoulos J. Gialafos E.J. Rapti A. Gorgoulis V.G. Kittas C. CARD15/NOD2, CD14, and toll-like receptor 4 gene polymorphisms in Greek patients with sarcoidosis.Sarcoidosis Vasc Diffuse Lung Dis. 2006; 23: 23-29PubMed Google Scholar and developing Crohn’s disease,13Klein W. Tromm A. Griga T. Folwaczny C. Hocke M. Eitner K. Marx M. Duerig N. Epplen J.T. Interaction of polymorphisms in the CARD15 and CD14 genes in patients with Crohn disease.Scand J Gastroenterol. 2003; 38: 834Crossref PubMed Scopus (30) Google Scholar, 14Gazouli M. Mantzaris G. Kotsinas A. Zacharatos P. Papalambros E. Archimandritis A. Ikonomopoulos J. Gorgoulis V. Association between polymorphisms in the Toll-like receptor 4, CD14, and CARD15/NOD2 and inflammatory bowel disease in the Greek population.World J Gastroenterol. 2005; 11: 681-685PubMed Google Scholar, 15Klein W. Tromm A. Griga T. Fricke H. Folwaczny C. Hocke M. Eitner K. Marx M. Duerig N. Epplen J.T. A polymorphism in the CD14 gene is associated with Crohn disease.Scand J Gastroenterol. 2002; 37: 189-191Crossref PubMed Scopus (86) Google Scholar which has some pathophysiological similarities to sarcoidosis. Based on these findings, we evaluated the clinical differences between the CC patient group and the rest of the patients. The SAC score in all non-CC genotypes was 3.39±0.24, significantly higher than in the patients with the CC genotype (p<0.01). There was a greater predominance of females (82.4% vs. 63.2%, p=0.04) and the age at diagnosis was significantly higher in the CC group (57.8±8.3 vs. 51.1±12.9, p=0.006). CC patients were less likely to present with acute disease. From the patients in whom relevant information prior to diagnosis could be found, 0/15 of CC patients were diagnosed within one month of onset of symptoms vs. 8/39 (21%) in the other genotypes (p=0.049). Pulmonary function tests (PFTs) at diagnosis were significantly better in the CC patients. The greatest difference was found in forced vital capacity (100.6±21.6% of predicted in the CC patients vs. 85.6±18.1 % in the other patients: (p<0.04)). Significant differences between CC and other patients were also observed for TLC, and FEV1. The percentage of patients with an abnormality in pulmonary function tests (either Total Lung capacity (TLC)<80%, Forced Vital Capacity (FVC)<80% or Forced Expiratory Volume in 1 sec. (FEV1)<70%) was significantly lower in CC patients (17.6%) as compared to the other patients (42.6%). The major differences between the patients carrying the allele T and those who don’t are summarized in Table 2. When comparing patients with the TT genotype to “non-TT” patients, the only significant finding was a lower incidence of ocular involvement with the TT genotype (4.5%) vs. the other patients (19.2%) (p=0.001).Table 2Sarcoidosis patients with CC genotype in the –159C/T polymorphic site of the CD14 gene compared to patients carrying the T allele (TC or TT).CC genotype % (n)All other patients % (n)p-valueAge at diagnosis (years)57.8±8.351.1±12.90.006GenderMale17.6% (3)36.8% (21)0.04Female82.4% (14)63.2% (36)Symptoms prior to diagnosis<1 month022% (8)0.048Skin involvement29.4% (5)10.5% (6)0.006Radiological findingsInterstitial markings68.7% (11)42.1% (24)0.02Retroperitoneal/mesenteric LN014.5% (8)0.09Scadding chest radiographic class06. 2% (1)1.8% (1)NS1015.8% (9)281.3% (13)66.6% (38)312.5% (2)7% (4)408.8 %(5)Pulmonary function tests at diagnosis (% of predicted±SD)Total lung capacity (TLC)98.9±14.691.3±14.20.04Vital capacity (VC)104.7±19.888.5±19.70.02Residual volume (RV)102.2±25.1107.3±26.2NSForced expiratory volume 1.0 s (FEV1)95.8±2182.5±20.90.04Forced vital capacity (FVC)100.6±21.685.6±18.10.04DLCO82.1±19.679.8±18.5NSAbnormalities in pulmonary function testsFVC<80%12.5 % (2)24.3 % (17)0.07TLC<80%6.7 % (1)26.1 % (12)0.09FEV1<70%5.9 % (1)9.3 % (5)NSEither 1 of the 3 above17.6 % (3)42.6 % (23)0.001 Open table in a new tab Sarcoidosis is an inflammatory disease in which an aberrant immune response directed against an unknown antigen or infection in a genetically susceptible host is the most likely etiological mechanism of disease.3Martin II, W.J. Iannuzzi M.C. Gail D.B. Peavy H.H. Future directions in sarcoidosis research: summary of an NHLBI working group.Am J Respir Crit Care Med. 2004; 170: 567-571Crossref PubMed Scopus (53) Google Scholar, 4Schurmann M. Reichel P. Muller-Myhsok B. Schlaak M.A.X. Muller-Quernheim J. Schwinger E. Results from a genome-wide search for predisposing genes in sarcoidosis.Am J Respir Crit Care Med. 2001; 164: 840-846Crossref PubMed Scopus (180) Google Scholar In the current study, we found an association between genotype at the polymorphic site of the CD14 proximal promoter at the –159 site, and both disease prevalence and clinical phenotype in an Israeli cohort of sarcoidosis patients. We also found that serum levels of soluble CD14 were significantly higher in patients compared to controls. The demographic characteristics of our cohort were similar to a previous report of sarcoidosis in Israel in terms of age and gender distribution with a female to male ratio of 2:1.25Yigla M. Badarna-Abu-Ria N. Tov N. Ravell-Weiller D. Rubin A.-H.E. Sarcoidosis in northern Israel; clinical characteristics of 120 patients.Sarcoidosis Vasc Diffuse Lung Dis. 2002; 19: 220-226PubMed Google Scholar Most of the patients in our cohort were diagnosed by flexible bronchoscopy and lung biopsy, and in the vast majority of cases, the lungs and thoracic lymph nodes were involved in the disease, a finding similar to previous studies.1Costabel U. Hunninghake G.W. ATS/ERS/WASOG statement on sarcoidosis. Sarcoidosis Statement Committee. American Thoracic Society. European Respiratory Society. World Association for Sarcoidosis and Other Granulomatous Dis" @default.
• W2137633825 created "2016-06-24" @default.
• W2137633825 creator A5014630788 @default.
• W2137633825 creator A5022633507 @default.
• W2137633825 creator A5049345954 @default.
• W2137633825 creator A5072593907 @default.
• W2137633825 creator A5073916303 @default.
• W2137633825 creator A5078709669 @default.
• W2137633825 date "2010-09-01" @default.
• W2137633825 modified "2023-09-28" @default.
• W2137633825 title "Association between CD14 gene polymorphisms and disease phenotype in sarcoidosis" @default.
• W2137633825 cites W1561093084 @default.
• W2137633825 cites W1602907103 @default.
• W2137633825 cites W1869195861 @default.
• W2137633825 cites W1939403027 @default.
• W2137633825 cites W1946135709 @default.
• W2137633825 cites W1970714608 @default.
• W2137633825 cites W1994364404 @default.
• W2137633825 cites W2013113978 @default.
• W2137633825 cites W2013221211 @default.
• W2137633825 cites W2016675470 @default.
• W2137633825 cites W2018202283 @default.
• W2137633825 cites W2043459788 @default.
• W2137633825 cites W2049754653 @default.
• W2137633825 cites W2061536714 @default.
• W2137633825 cites W2067394045 @default.
• W2137633825 cites W2081510407 @default.
• W2137633825 cites W2086659274 @default.
• W2137633825 cites W2094338449 @default.
• W2137633825 cites W2105758949 @default.
• W2137633825 cites W2133392185 @default.
• W2137633825 cites W2135212145 @default.
• W2137633825 cites W2140283734 @default.
• W2137633825 cites W2144939236 @default.
• W2137633825 cites W2151210309 @default.
• W2137633825 cites W2151708186 @default.
• W2137633825 cites W2158820172 @default.
• W2137633825 cites W2165626477 @default.
• W2137633825 cites W2994597783 @default.
• W2137633825 doi "https://doi.org/10.1016/j.rmed.2010.03.029" @default.
• W2137633825 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/20430603" @default.
• W2137633825 hasPublicationYear "2010" @default.
• W2137633825 type Work @default.
• W2137633825 sameAs 2137633825 @default.
• W2137633825 citedByCount "7" @default.
• W2137633825 countsByYear W21376338252015 @default.
• W2137633825 countsByYear W21376338252016 @default.
• W2137633825 countsByYear W21376338252017 @default.
• W2137633825 countsByYear W21376338252022 @default.
• W2137633825 crossrefType "journal-article" @default.
• W2137633825 hasAuthorship W2137633825A5014630788 @default.
• W2137633825 hasAuthorship W2137633825A5022633507 @default.
• W2137633825 hasAuthorship W2137633825A5049345954 @default.
• W2137633825 hasAuthorship W2137633825A5072593907 @default.
• W2137633825 hasAuthorship W2137633825A5073916303 @default.
• W2137633825 hasAuthorship W2137633825A5078709669 @default.
• W2137633825 hasBestOaLocation W21376338251 @default.
• W2137633825 hasConcept C104317684 @default.
• W2137633825 hasConcept C126322002 @default.
• W2137633825 hasConcept C127716648 @default.
• W2137633825 hasConcept C203014093 @default.
• W2137633825 hasConcept C2779134260 @default.
• W2137633825 hasConcept C2781301800 @default.
• W2137633825 hasConcept C54355233 @default.
• W2137633825 hasConcept C71924100 @default.
• W2137633825 hasConcept C86803240 @default.
• W2137633825 hasConceptScore W2137633825C104317684 @default.
• W2137633825 hasConceptScore W2137633825C126322002 @default.
• W2137633825 hasConceptScore W2137633825C127716648 @default.
• W2137633825 hasConceptScore W2137633825C203014093 @default.
• W2137633825 hasConceptScore W2137633825C2779134260 @default.
• W2137633825 hasConceptScore W2137633825C2781301800 @default.
• W2137633825 hasConceptScore W2137633825C54355233 @default.
• W2137633825 hasConceptScore W2137633825C71924100 @default.
• W2137633825 hasConceptScore W2137633825C86803240 @default.
• W2137633825 hasIssue "9" @default.
• W2137633825 hasLocation W21376338251 @default.
• W2137633825 hasLocation W21376338252 @default.
• W2137633825 hasOpenAccess W2137633825 @default.
• W2137633825 hasPrimaryLocation W21376338251 @default.
• W2137633825 hasRelatedWork W138964897 @default.
• W2137633825 hasRelatedWork W1530402712 @default.
• W2137633825 hasRelatedWork W1946787458 @default.
• W2137633825 hasRelatedWork W2104622833 @default.
• W2137633825 hasRelatedWork W2125731289 @default.
• W2137633825 hasRelatedWork W2132993604 @default.
• W2137633825 hasRelatedWork W2143066563 @default.
• W2137633825 hasRelatedWork W2157166663 @default.
• W2137633825 hasRelatedWork W2276789630 @default.
• W2137633825 hasRelatedWork W3179054707 @default.
• W2137633825 hasVolume "104" @default.
• W2137633825 isParatext "false" @default.
• W2137633825 isRetracted "false" @default.
• W2137633825 magId "2137633825" @default.
• W2137633825 workType "article" @default.