FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2138012016> ?p ?o ?g. }

• W2138012016 endingPage "182" @default.
• W2138012016 startingPage "178" @default.
• W2138012016 abstract "Malonyl coenzyme A (CoA) decarboxylase (E.C.4. 1.1.9) catalyzes the conversion of malonyl CoA to acetyl CoA. The metabolic role of malonyl CoA decarboxylase has not been fully defined, but deficiency of the enzyme has been associated with mild mental retardation, seizures, hypotonia, cardiomyopathy, vomiting, hypoglycemia, metabolic acidosis, and malonic aciduria. Here we report the isolation and sequencing of the human gene encoding malonyl CoA decarboxylase, and the identification of a mutation causing malonyl CoA decarboxylase deficiency. Human malonyl CoA decarboxylase cDNA sequences were identified by homology to the goose gene, and the intron/exon boundaries were determined by direct sequencing of a PAC clone containing the entire human gene. The 1479 basepair human cDNA is 70 percent identical to the goose sequence, and the intron/exon boundaries are completely conserved between the two species. The genetic mutation underlying malonyl CoA decarboxylase deficiency was determined in a patient with clinical features of this defect, malonic aciduria, and markedly reduced malonyl CoA decarboxylase activity.—Gao, J., L. Waber, M. J. Bennett, K. M. Gibson, and J. C. Cohen. Cloning and mutational analysis of human malonyl-coenzyme A decarboxylase. J. Lipid Res. 1999. 40: 178–182. Malonyl coenzyme A (CoA) decarboxylase (E.C.4. 1.1.9) catalyzes the conversion of malonyl CoA to acetyl CoA. The metabolic role of malonyl CoA decarboxylase has not been fully defined, but deficiency of the enzyme has been associated with mild mental retardation, seizures, hypotonia, cardiomyopathy, vomiting, hypoglycemia, metabolic acidosis, and malonic aciduria. Here we report the isolation and sequencing of the human gene encoding malonyl CoA decarboxylase, and the identification of a mutation causing malonyl CoA decarboxylase deficiency. Human malonyl CoA decarboxylase cDNA sequences were identified by homology to the goose gene, and the intron/exon boundaries were determined by direct sequencing of a PAC clone containing the entire human gene. The 1479 basepair human cDNA is 70 percent identical to the goose sequence, and the intron/exon boundaries are completely conserved between the two species. The genetic mutation underlying malonyl CoA decarboxylase deficiency was determined in a patient with clinical features of this defect, malonic aciduria, and markedly reduced malonyl CoA decarboxylase activity. —Gao, J., L. Waber, M. J. Bennett, K. M. Gibson, and J. C. Cohen. Cloning and mutational analysis of human malonyl-coenzyme A decarboxylase. J. Lipid Res. 1999. 40: 178–182. Malonyl coenzyme A (CoA) decarboxylase (E.C.4.1.1.9) activity has been detected in extracts from a wide variety of animal (1Kim Y.S. Kolattukudy P.E. Malonyl-CoA decarboxylase from the mammary gland of lactating rat. Purification, properties and subcellular localization.Biochim. Biophys. Acta. 1978; 531: 187-196Google Scholar, 2Kim Y.S. Kolattukudy P.E. Malonyl-CoA decarboxylase from the uropygial gland of waterfowl: purification, properties, immunological comparison, and role in regulating the synthesis of multimethyl-branched fatty acids.Arch. Biochem. Biophys. 1978; 190: 585-597Google Scholar, 3Kim Y.S. Kolattukudy P.E. Purification and properties of malonyl-CoA decarboxylase from rat liver mitochondria and its immunological comparison with the enzymes from rat brain, heart, and mammary gland.Arch. Biochem. Biophys. 1978; 190: 234-246Google Scholar) and bacterial cells (4Kim Y.S. Kolattukudy P.E. Boos A. Malonyl-CoA decarboxylase from Mycobacterium tuberculosis and Pseudomonas fluorescens.Arch. Biochem. Biophys. 1979; 196: 543-551Google Scholar). The enzyme catalyzes the conversion of malonyl CoA to acetyl CoA, but the metabolic role of this reaction has not been fully defined. In most animal tissues, malonyl CoA decarboxylase is located in mitochondria (5Scholte H.R. The intracellular and intramitochondrial distribution of malonyl-CoA decarboxylase and propionyl-CoA carboxylase in rat liver.Biochim. Biophys. Acta. 1969; 178: 137-144Google Scholar, 6Kim Y.S. Kolattukudy P.E. Boos A. Dual sites of occurrence of malonyl-CoA decarboxylase and their possible functional significance in avian tissues.Comp. Biochem. Physiol. [B.]. 1979; 62: 443-447Google Scholar, 7Kim Y.S. Kolattukudy P.E. Boos A. Malonyl-CoA decarboxylase in rat brain mitochondria.Int. J. Biochem. 1979; 10: 551-555Google Scholar). Accordingly it has been suggested that malonyl CoA decarboxylase protects key mitochondrial enzymes such as pyruvate carboxylase and methylmalonyl-CoA mutase from inhibition by malonyl CoA (3Kim Y.S. Kolattukudy P.E. Purification and properties of malonyl-CoA decarboxylase from rat liver mitochondria and its immunological comparison with the enzymes from rat brain, heart, and mammary gland.Arch. Biochem. Biophys. 1978; 190: 234-246Google Scholar, 5Scholte H.R. The intracellular and intramitochondrial distribution of malonyl-CoA decarboxylase and propionyl-CoA carboxylase in rat liver.Biochim. Biophys. Acta. 1969; 178: 137-144Google Scholar). In humans, deficiency of malonyl CoA decarboxylase has been associated with mild mental retardation, seizures, hypotonia, cardiomyopathy, vomiting, hypoglycemia, metabolic acidosis, and malonic aciduria (8Brown G.K. Scholem R.D. Bankier A. Danks D.M. Malonyl coenzyme A decarboxylase deficiency.J. Inherit. Metab. Dis. 1984; 7: 21-26Google Scholar, 9Haan E.A. Scholem R.D. Croll H.B. Brown G.K. Malonyl coenzyme A decarboxylase deficiency. Clinical and biochemical findings in a second child with a more severe enzyme defect.Eur. J. Pediatr. 1986; 144: 567-570Google Scholar, 10MacPhee G.B. Logan R.W. Mitchell J.S. Howells D.W. Tsotsis E. Thorburn D.R. Malonyl coenzyme A decarboxylase deficiency.Arch. Dis. Child. 1993; 69: 433-436Google Scholar, 11Matalon R. Michaels K. Kaul R. Whitman V. Rodriguez-Novo J. Goodman S. Thorburn D. Malonic aciduria and cardiomyopathy.J. Inherit. Metab. Dis. 1993; 16: 571-573Google Scholar, 12Krawinkel M.B. Oldigs H.D. Santer R. Lehnert W. Wendel U. Schaub J. Association of malonyl-CoA decarboxylase deficiency and heterozygote state for haemoglobin C disease.J. Inherit. Metab. Dis. 1994; 17: 636-637Google Scholar, 13Yano S. Sweetman L. Thorburn D.R. Mofidi S. Williams J.C. A new case of malonyl coenzyme A decarboxylase deficiency presenting with cardiomyopathy.Eur. J. Pediatr. 1997; 156: 382-383Google Scholar). Treatment with a fat-restricted diet (12Krawinkel M.B. Oldigs H.D. Santer R. Lehnert W. Wendel U. Schaub J. Association of malonyl-CoA decarboxylase deficiency and heterozygote state for haemoglobin C disease.J. Inherit. Metab. Dis. 1994; 17: 636-637Google Scholar, 13Yano S. Sweetman L. Thorburn D.R. Mofidi S. Williams J.C. A new case of malonyl coenzyme A decarboxylase deficiency presenting with cardiomyopathy.Eur. J. Pediatr. 1997; 156: 382-383Google Scholar) and with carnitine (13Yano S. Sweetman L. Thorburn D.R. Mofidi S. Williams J.C. A new case of malonyl coenzyme A decarboxylase deficiency presenting with cardiomyopathy.Eur. J. Pediatr. 1997; 156: 382-383Google Scholar) has lead to improved general health in two patients. The human gene encoding the enzyme has not been cloned, however, and the molecular basis for malonyl CoA decarboxylase deficiency has not been determined. As a first step towards elucidating the metabolic function of malonyl CoA decarboxylase in humans, we cloned and sequenced the human gene encoding the enzyme. Here we report i) the genomic and complementary DNA sequences of the human malonyl CoA decarboxylase gene, and ii) a mutation in the gene in a new case of malonyl CoA decarboxylase deficiency. Inspection of the derived amino acid sequence of human malonyl CoA decarboxylase revealed sequence motifs that may have implications for the metabolic function of the enzyme. The proband was the firstborn son of unrelated parents, and was born at term after an unremarkable pregnancy (birth weight was 8 lb, 3 oz). Micropenis and hypotonia were noted at birth, and he remained in the hospital for 12 days after birth for poor respirations. At 10 months of age he was readmitted and was found to have malonic aciduria, hypertrophic cardiomyopathy, and renal dysplasia. His extended chromosomes were normal. Malonyl CoA decarboxylase activity in his primary cultured fibroblasts was less than ten percent of control values. During surgery to have a gastrostomy feeding tube placed, the patient had a cardiac arrest and could not be revived. Malonyl CoA decarboxylase activity was assayed in fibroblasts from the patient and in control fibroblasts by following the release of 14CO2 from [1,3-14C]malonyl CoA as described by Brown et al. (8Brown G.K. Scholem R.D. Bankier A. Danks D.M. Malonyl coenzyme A decarboxylase deficiency.J. Inherit. Metab. Dis. 1984; 7: 21-26Google Scholar). A search of the Expressed Sequence Tags database (dbests) of the National Center for Biotechnology Information, Bethesda, MD, identified 22 human cDNA clones with homology to the goose malonyl CoA decarboxylase cDNA sequence (14Jang S.H. Cheesbrough T.M. Kolattukudy P.E. Molecular cloning, nucleotide sequence, and tissue distribution of malonyl-CoA decarboxylase.J. Biol. Chem. 1989; 264: 3500-3505Google Scholar). Oligonucleotides were derived from the human EST sequences ATCC#135110 and IMAGE Consortium cDNA clone #127540. RNA was prepared from a human liver cell line (huh7), and from primary fibroblasts from the patient, and reverse transcribed using SuperScript reverse transcriptase (Life Technologies, Gaithersburg, MD). Human cDNA corresponding to exons 2 through 5 was PCR amplified using oligonucleotides MCD8 (5′ GGTT TACTGTCAGAGCTTGCTGTTC 3′) and MCD4 (5′ GGGTTC CTGAACCTAGAACG 3′), and sequenced using a standard cycle sequencing protocol (Protocol # 402078, Applied Biosystems Inc. Foster City, CA). Partial exon 1 sequence was obtained by 5′ RACE (5′ RACE System Version 2.0, Life Technologies, Gaithersburg, MD) but no transcripts corresponding to the full length goose sequence were identified. A human PAC clone containing the entire malonyl CoA decarboxylase gene was identified by PCR screening using oligonucleotides MCD3 (5′ AGTTTTTTACAGGATGCACAGCCTC 3′) and MCD4. PAC DNA was prepared using KB-100 columns (Genome-Systems, St. Louis, MO) and the sequences of exon 1 and the intron/exonboundaries were obtained by direct sequencing using oligonucleotides derived from the cDNA as primers. Oligonucleotides MCD3 and MCD4 were used to PCR amplify DNA from a mouse/human hybrid cell line (CY18) that contains human chromosome 16 (kindly provided by Dr. Roger Schultz, UT Southwestern Med. Ctr.), and from the YAC My772D12 (kindly provided by Dr. Norman Doggett, Los Alamos National Laboratory). Genomic DNA samples from mouse liver, and from a second mouse/human hybrid (A15) that does not contain human chromosome 16 sequences was used as negative controls. A cDNA for the human malonyl CoA decarboxylase was cloned into pCMV6 (kindly provided by Dr. David Russell at UT South-western Medical Center) and transiently transfected into in a human hepatoma (huh7) cell line. After 24 h the cells were lysed and the activity of the expressed enzyme was assayed by a carnitine acetyltransferase-linked assay as described by Antinozzi et al. (15Antinozzi P.A. Segall L. Prentki M. McGarry J.D. Newgard C.B. Molecular or pharmacologic perturbation of the link between glucose and lipid metabolism is without effect on glucose-stimulated insulin secretion. A re-evaluation of the long-chain acyl-CoA hypothesis.J. Biol. Chem. 1998; 273: 16146-16154Google Scholar). Malonyl CoA decarboxylase activity in primary cultured fibroblasts from the patient was assayed on five separate occasions. On each occasion, the activity of the enzyme was less than 10% of the activity measured in fibroblasts from five normal patients. The activity of a control enzyme (mevalonate kinase) was similar in fibroblasts from the patient and in fibroblasts from the control subjects. Direct sequencing of the PAC revealed two in-frame ATG sequences in exon 1 that are completely conserved between human and goose. The 1479 nucleotide open reading frame (Fig. 1) extending from the upstream ATG codon to the stop codon (TGA) in the human sequence is 70% identical to the homologous sequence in goose, and the intron/exon boundaries are completely conserved between the two species. The deduced amino acid sequence is 68% identical (82% similar) between the two species (Fig. 2). BLAST searches of GenBank and SwissProt indicated that the human and goose malonyl CoA decarboxylase enzymes do not have significant homology to other known proteins. Interestingly, a putative gene (F35G12.1) identified on a cosmid from the nematode C. elegans (Gen-Bank Accession number Z46242) encodes a 360 amino acid protein with 44% sequence identity to the goose malonyl CoA decarboxylase protein.Fig. 2Alignment of the deduced amino acid sequences of the human and goose malonyl coA decarboxylase proteins. The 18 amino acids that comprise the mitochondrial targeting sequence in the goose and the conserved canonical peroxisomal targeting sequence are indicated in bold type.View Large Image Figure ViewerDownload (PPT) Sequencing of cDNA prepared from the patient's fibroblastsindicated that four nucleotides at the 3′ end of exon 2 were deleted (c.638–641delGTGA, see Fig. 1 and Fig. 3). The resulting frame shift introduced a premature stop codon eight codons downstream of the deletion. The protein translated from the mutant mRNA would lack 272 carboxy terminal amino acids, therefore the mutation almost certainly abolishes malonyl CoA decarboxylase activity. The mutation was confirmed by direct sequencing of PCR amplified genomic DNA. No other mutations were identified in the coding region or in the intron exon boundaries of the gene. Genomic DNA sequencing indicated that both parents were heterozygotes for the c.638–641delGTGA mutation, therefore the patient is homozygous for this mutation. A human EST (IMAGE clone #127540) with strong homology to goose malonyl CoA decarboxylase cDNA has been previously mapped to 331.9 cR. from the top of chromosome 16 linkage group (Unigene Collection, National Center for Biotechnology Information). To confirm this map position, DNA from a mouse/human hybrid cell line (CY18) containing human chromosome 16 and from megaYAC My772D12 was amplified by PCR. These results indicate that the human malonyl CoA decarboxylase genelies in a ~450 kb interval between D16S402 and D16S422 on chromosome 16q24. Transfection of the human malonyl CoA decarboxylase cDNA into huh7 cells increased malonyl CoA decarboxylase activity by about 4-fold (Fig. 4). Malonyl CoA decarboxylase deficiency is a rare inborn error of metabolism (8Brown G.K. Scholem R.D. Bankier A. Danks D.M. Malonyl coenzyme A decarboxylase deficiency.J. Inherit. Metab. Dis. 1984; 7: 21-26Google Scholar, 9Haan E.A. Scholem R.D. Croll H.B. Brown G.K. Malonyl coenzyme A decarboxylase deficiency. Clinical and biochemical findings in a second child with a more severe enzyme defect.Eur. J. Pediatr. 1986; 144: 567-570Google Scholar, 10MacPhee G.B. Logan R.W. Mitchell J.S. Howells D.W. Tsotsis E. Thorburn D.R. Malonyl coenzyme A decarboxylase deficiency.Arch. Dis. Child. 1993; 69: 433-436Google Scholar, 11Matalon R. Michaels K. Kaul R. Whitman V. Rodriguez-Novo J. Goodman S. Thorburn D. Malonic aciduria and cardiomyopathy.J. Inherit. Metab. Dis. 1993; 16: 571-573Google Scholar, 12Krawinkel M.B. Oldigs H.D. Santer R. Lehnert W. Wendel U. Schaub J. Association of malonyl-CoA decarboxylase deficiency and heterozygote state for haemoglobin C disease.J. Inherit. Metab. Dis. 1994; 17: 636-637Google Scholar). To elucidate the molecular basis of this condition we cloned the human gene encoding malonyl CoA decarboxylase, and sequenced genomic and complementary DNA from a patient with clinical and biochemical features consistent with the disorder. Analysis of complementary and genomic DNA indicated that human malonyl CoA decarboxylase is a 493 amino acid protein. Transfection of the cDNA into a human hepatoma cell line confirmed that this gene encodes a protein with malonyl CoA decarboxylase activity. The cDNA and deduced amino acid sequences are highly conserved (~70% identical) between human and goose, and the locations of the intron/exon boundaries are identical between the two species. Partial sequencing (1001 nucleotides) of the mouse malonyl CoA decarboxylase gene (J. C. Cohen, unpublished results) revealed 83% identity between the human and mouse cDNA sequences. The high degree of sequence identity between the malonyl CoA decarboxylase genes from these three species indicates strong evolutionary conservation. DNA sequence from the proband revealed a four nucleotide deletion in the gene encoding malonyl CoA decarboxylase that introduced a premature stop codon and deleted the 272 carboxy terminal amino acids of the protein. This mutation almost certainly abolishes malonyl CoA decarboxylase activity. The same mutation was identified in both parents, therefore the proband is a true homozygote. The absence of any detectable chromosomal abnormality in the proband strongly indicates that his unusual phenotype was due entirely to malonyl CoA decarboxylase deficiency. Some of the clinical features observed in this individual and in previously described patients with malonyl CoA decarboxylase deficiency (e.g., seizures, hypotonia, cardiomyopathy), have also been observed in patients with mitochondrial disorders (see ref. 15Antinozzi P.A. Segall L. Prentki M. McGarry J.D. Newgard C.B. Molecular or pharmacologic perturbation of the link between glucose and lipid metabolism is without effect on glucose-stimulated insulin secretion. A re-evaluation of the long-chain acyl-CoA hypothesis.J. Biol. Chem. 1998; 273: 16146-16154Google Scholar for review). Defective mitochondrial function may therefore account for some or all of the clinical sequelae of malonyl CoA decarboxylase deficiency. Inspection of the derived amino acid sequence of human malonyl CoA decarboxylase revealed sequence motifs that may indicate alternative metabolic functions for the enzyme. In the goose, the mitochondrial and cytoplasmic forms of malonyl CoA decarboxylase are transcribed from alternate, in-frame initiation codons separated by 146 nucleotides in exon 1 (16Courchesne-Smith C. Jang S.H. Shi Q. DeWille J. Sasaki G. Kolattukudy P.E. Cytoplasmic accumulation of a normally mitochondrial malonyl-CoA decarboxylase by the use of an alternate transcription start site.Arch. Biochem. Biophys. 1992; 298: 576-586Google Scholar). Transcripts from the upstream codon include an 18 amino acid N-terminal motif that forms an amphipathic alpha helix (16Courchesne-Smith C. Jang S.H. Shi Q. DeWille J. Sasaki G. Kolattukudy P.E. Cytoplasmic accumulation of a normally mitochondrial malonyl-CoA decarboxylase by the use of an alternate transcription start site.Arch. Biochem. Biophys. 1992; 298: 576-586Google Scholar) constituting the mitochondrial targeting sequence. Both AUG codons are conserved in the human sequence, and both are in an appropriate sequence context for efficient initiation of translation as determined by Kozak (17Kozak M. Interpreting cDNA sequences: some insights from studies on translation.Mamm. Genome. 1996; 7: 563-574Google Scholar). However, the putative mitochondrial targeting sequence identified in the goose protein is poorly conserved in humans (see Fig. 2). Secondary structure modeling of the N-terminus of the human protein (using the computer program Protean, DNAstar) suggests that this region does not form an amphipathic alpha helix and does not correspond to a canonical mitochondrial targeting sequence. Therefore further studies will be required to determine whether malonyl CoA decarboxylase is a mitochondrial enzyme in humans, and the extent to which the phenotype of malonyl CoA decarboxylase deficiency reflects impaired mitochondrial function. Interestingly, a canonical peroxisomal-matrix targeting sequence (SKL) at the carboxy terminus of the protein (18McNew J.A. Goodman J.M. The targeting and assembly of peroxisomal proteins: some old rules do not apply.Trends Biochem. Sci. 1996; 21: 54-58Google Scholar) is strictly conserved in human, goose, and mouse (J. C. Cohen, unpublished results). This sequence is sufficient to direct some (though not all) carrier proteins to peroxisomes (18McNew J.A. Goodman J.M. The targeting and assembly of peroxisomal proteins: some old rules do not apply.Trends Biochem. Sci. 1996; 21: 54-58Google Scholar). Therefore the human malonyl CoA decarboxylase may be targeted to peroxisomes in addition to (or possibly instead of) mitochondria. We thank Sijing Niu and Liangcai Nie for excellent technical assistance, and Peter Antinozzi for assistance with the malonyl CoA decarboxylase assay in huh7 cells. This work was supported by NIH grant HL53917." @default.
• W2138012016 created "2016-06-24" @default.
• W2138012016 creator A5019797356 @default.
• W2138012016 creator A5031711759 @default.
• W2138012016 creator A5040770905 @default.
• W2138012016 creator A5043796550 @default.
• W2138012016 creator A5088772562 @default.
• W2138012016 date "1999-01-01" @default.
• W2138012016 modified "2023-10-17" @default.
• W2138012016 title "Cloning and mutational analysis of human malonyl-coenzyme A decarboxylase" @default.
• W2138012016 cites W1528877240 @default.
• W2138012016 cites W1543589576 @default.
• W2138012016 cites W1966348307 @default.
• W2138012016 cites W1971024458 @default.
• W2138012016 cites W1987606713 @default.
• W2138012016 cites W1992709343 @default.
• W2138012016 cites W1995006001 @default.
• W2138012016 cites W2023354078 @default.
• W2138012016 cites W2038881580 @default.
• W2138012016 cites W2042342410 @default.
• W2138012016 cites W2047388563 @default.
• W2138012016 cites W2056467041 @default.
• W2138012016 cites W2071579812 @default.
• W2138012016 cites W2074952408 @default.
• W2138012016 cites W2079653458 @default.
• W2138012016 cites W2095072823 @default.
• W2138012016 cites W2101431784 @default.
• W2138012016 doi "https://doi.org/10.1016/s0022-2275(20)33354-x" @default.
• W2138012016 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9869665" @default.
• W2138012016 hasPublicationYear "1999" @default.
• W2138012016 type Work @default.
• W2138012016 sameAs 2138012016 @default.
• W2138012016 citedByCount "56" @default.
• W2138012016 countsByYear W21380120162012 @default.
• W2138012016 countsByYear W21380120162013 @default.
• W2138012016 countsByYear W21380120162015 @default.
• W2138012016 countsByYear W21380120162017 @default.
• W2138012016 countsByYear W21380120162019 @default.
• W2138012016 countsByYear W21380120162020 @default.
• W2138012016 countsByYear W21380120162021 @default.
• W2138012016 countsByYear W21380120162023 @default.
• W2138012016 crossrefType "journal-article" @default.
• W2138012016 hasAuthorship W2138012016A5019797356 @default.
• W2138012016 hasAuthorship W2138012016A5031711759 @default.
• W2138012016 hasAuthorship W2138012016A5040770905 @default.
• W2138012016 hasAuthorship W2138012016A5043796550 @default.
• W2138012016 hasAuthorship W2138012016A5088772562 @default.
• W2138012016 hasBestOaLocation W21380120161 @default.
• W2138012016 hasConcept C121050878 @default.
• W2138012016 hasConcept C134651460 @default.
• W2138012016 hasConcept C181199279 @default.
• W2138012016 hasConcept C185592680 @default.
• W2138012016 hasConcept C197957613 @default.
• W2138012016 hasConcept C199360897 @default.
• W2138012016 hasConcept C2779123261 @default.
• W2138012016 hasConcept C41008148 @default.
• W2138012016 hasConcept C54355233 @default.
• W2138012016 hasConcept C55493867 @default.
• W2138012016 hasConcept C70721500 @default.
• W2138012016 hasConcept C86803240 @default.
• W2138012016 hasConceptScore W2138012016C121050878 @default.
• W2138012016 hasConceptScore W2138012016C134651460 @default.
• W2138012016 hasConceptScore W2138012016C181199279 @default.
• W2138012016 hasConceptScore W2138012016C185592680 @default.
• W2138012016 hasConceptScore W2138012016C197957613 @default.
• W2138012016 hasConceptScore W2138012016C199360897 @default.
• W2138012016 hasConceptScore W2138012016C2779123261 @default.
• W2138012016 hasConceptScore W2138012016C41008148 @default.
• W2138012016 hasConceptScore W2138012016C54355233 @default.
• W2138012016 hasConceptScore W2138012016C55493867 @default.
• W2138012016 hasConceptScore W2138012016C70721500 @default.
• W2138012016 hasConceptScore W2138012016C86803240 @default.
• W2138012016 hasIssue "1" @default.
• W2138012016 hasLocation W21380120161 @default.
• W2138012016 hasOpenAccess W2138012016 @default.
• W2138012016 hasPrimaryLocation W21380120161 @default.
• W2138012016 hasRelatedWork W1523595220 @default.
• W2138012016 hasRelatedWork W1594976371 @default.
• W2138012016 hasRelatedWork W2042635832 @default.
• W2138012016 hasRelatedWork W2046104507 @default.
• W2138012016 hasRelatedWork W2197530792 @default.
• W2138012016 hasRelatedWork W2383949092 @default.
• W2138012016 hasRelatedWork W2437621386 @default.
• W2138012016 hasRelatedWork W3176405776 @default.
• W2138012016 hasRelatedWork W4380364036 @default.
• W2138012016 hasRelatedWork W4384079555 @default.
• W2138012016 hasVolume "40" @default.
• W2138012016 isParatext "false" @default.
• W2138012016 isRetracted "false" @default.
• W2138012016 magId "2138012016" @default.
• W2138012016 workType "article" @default.