FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2139278344> ?p ?o ?g. }

• W2139278344 endingPage "1331" @default.
• W2139278344 startingPage "1324" @default.
• W2139278344 abstract "Ileal bile acid-binding protein (I-BABP) is a cytosolic protein that binds bile acid (BA) specifically. In the ileum, it is thought to be implied in their enterohepatic circulation. Because the fecal excretion of BA represents the main physiological way of elimination for cholesterol (CS), the I-BABP gene could have a major function in CS homeostasis. Therefore, the I-BABP gene expression might be controlled by CS. I-BABP mRNA levels were significatively increased when the human enterocyte-like CaCo-2 cells were CS-deprived and repressed when CS were added to the medium. A highly conserved sterol regularory element-like sequence (SRE) and a putative GC box were found in human I-BABP gene promoter. Different constructs of human I-BABP promoter, cloned upstream of a chloramphenicol acetyltransferase (CAT) reporter gene, have been used in transfections studies. CAT activity of the wild type promoter was increased in presence of CS-deprived medium, and conversely, decreased by a CS-supplemented medium. The inductive effect of CS depletion was fully abolished when the putative SRE sequence and/or GC box were mutated or deleted. Co-transfections experiments with the mature isoforms of human sterol responsive element-binding proteins (SREBPs) and Sp1 demonstrate that the CS-mediated regulation of I-BABP gene was dependent of these transcriptional factors. Paradoxically, mice subjected to a standard chow supplemented with 2% CS for 14 days exhibited a significant rise in both I-BABP and SREBP1c mRNA levels. We show that in vivo, this up-regulation could be explained by a recently described regulatory pathway involving a positive regulation of SREBP1c by liver-X-receptor following a high CS diet. Ileal bile acid-binding protein (I-BABP) is a cytosolic protein that binds bile acid (BA) specifically. In the ileum, it is thought to be implied in their enterohepatic circulation. Because the fecal excretion of BA represents the main physiological way of elimination for cholesterol (CS), the I-BABP gene could have a major function in CS homeostasis. Therefore, the I-BABP gene expression might be controlled by CS. I-BABP mRNA levels were significatively increased when the human enterocyte-like CaCo-2 cells were CS-deprived and repressed when CS were added to the medium. A highly conserved sterol regularory element-like sequence (SRE) and a putative GC box were found in human I-BABP gene promoter. Different constructs of human I-BABP promoter, cloned upstream of a chloramphenicol acetyltransferase (CAT) reporter gene, have been used in transfections studies. CAT activity of the wild type promoter was increased in presence of CS-deprived medium, and conversely, decreased by a CS-supplemented medium. The inductive effect of CS depletion was fully abolished when the putative SRE sequence and/or GC box were mutated or deleted. Co-transfections experiments with the mature isoforms of human sterol responsive element-binding proteins (SREBPs) and Sp1 demonstrate that the CS-mediated regulation of I-BABP gene was dependent of these transcriptional factors. Paradoxically, mice subjected to a standard chow supplemented with 2% CS for 14 days exhibited a significant rise in both I-BABP and SREBP1c mRNA levels. We show that in vivo, this up-regulation could be explained by a recently described regulatory pathway involving a positive regulation of SREBP1c by liver-X-receptor following a high CS diet. cholesterol bile acid 25-hydroxycholesterol chenodeoxycholic acid ileal bile acid-binding protein ileal sodium-dependent bile acid transporter 3-hydroxy-3-methylglutaryl coenzyme A farnesoid-X-receptor liver-X-receptor 9-cis-retinoic acid receptor sterol regulatory element-binding proteins sterol-responsive element Dulbecco's modified Eagle's medium fetal calf serum reverse transcriptase chloramphenicol acetyltransferase wild type Cholesterol (CS)1 exerts essential physiological functions as a constituent of biological membranes and precursor of steroid hormones and bile acids (BAs). CS balance is the result of an equilibrium between dietary and biliary CS absorption, cellular de novo synthesis, and hepatic catabolism into BAs. A dysregulation of these input and output pathways produces metabolic disorders leading to gallstones formation and the development of atherosclerosis. Molecular mechanisms contributing to CS homeostasis are progressively elucidated. They are supported by a set of transcriptional factors directly activated by both CS and its metabolic derivatives, BA and oxysterols. CS modulates the transcription rate of target genes through the action of specific transcriptional factors termed sterol regulatory element-binding proteins (SREBPs) (1Brown M.S. Goldstein J.L. Cell. 1997; 89: 331-340Google Scholar). In contrast to the other members of the basic helix-loop-helix zipper family, SREBPs are synthesized as inactive precursors bound to endoplasmic reticulum membrane and nucleus envelope. In cultured cells, CS depletion triggers the proteolytic release of an active NH2-terminal domain, which after translocation into the nucleus, induces the transcription rate of sterol target genes. Conversely, the proteolytic activation of SREBPs and the transcriptional activity of target genes are low, when the cellular CS levels are increased (1Brown M.S. Goldstein J.L. Cell. 1997; 89: 331-340Google Scholar, 2Horton J.D. Shimomura I. Curr. Opin. Lipidol. 1999; 10: 143-150Google Scholar). BAs and oxysterols also affect the CS balance through regulatory pathways recently depicted that involve different nuclear hormone receptors. BAs are the natural agonists of the farnesoid-X-receptor (FXR) (NR1H4) (3Makishima M. Okamoto A.Y. Repa J.J. Tu H. Learned R.M. Luk A. Hull M.V. Lustig K.D. Mangelsdorf D.J. Shan B. Science. 1999; 284: 1362-1365Google Scholar, 4Parks D.J. Blanchard S.G. Bledsoe R.K. Chandra G. Consler T.G. Kliewer S.A. Stimmel J.B. Willson T.M. Zavacki A.M. Moore D.D. Lehmann J.M. Science. 1999; 284: 1365-1368Google Scholar), whereas oxysterols specifically activate the liver-X-receptor α and β (LXRs) (NR1H3 and NR1H2) (5Peet J. Janowski B.A. Mangelsdorf D.J. Curr. Opin. Genet. Dev. 1998; 8: 571-575Google Scholar). Once activated, these nuclear receptors bind, as heterodimers with 9-cis-retinoic acid receptor (RXR), specific responsive elements located in the promoter of target genes (6Repa J.J. Mangelsdorf D.J. Curr. Opin. Biotechnol. 1999; 10: 557-563Google Scholar, 7Repa J.J. Mangelsdorf D.J. Annu. Rev. Cell Dev. Biol. 2000; 16: 459-481Google Scholar). BA synthesis and elimination are major determinants for body CS homeostasis. Primary BAs are synthesized from CS in the liver where they are conjugated with glycine or taurine prior to be secreted into bile. More than 90% BAs are reabsorbed along the small intestine and return to the liver to be secreted again into bile. This enterohepatic BAs circulation is essential for the maintenance of CS balance. Indeed, BAs not reclaimed by intestinal absorption constitute the main way to eliminate a CS excess. If the regulation of hepatic BA biosynthetic pathway is presently well understood (7Repa J.J. Mangelsdorf D.J. Annu. Rev. Cell Dev. Biol. 2000; 16: 459-481Google Scholar), by contrast, the molecular mechanisms responsible for intestinal BA reabsorption/elimination are poorly known. Conjugated BA are efficiently reabsorbed in the ileum by an active transport system constituted by a couple of BA transporters, the ileal sodium-dependent bile acid transporter (I-BAT) and ileal bile acid-binding protein (I-BABP). I-BAT is a 38-kDa integral brush border membrane protein that co-transports sodium and BAs (8Wong M.H. Oelkers P. Dawson P.A. J. Biol. Chem. 1995; 270: 27228-27234Google Scholar). The expression of I-BAT is restricted to the ileum, the biliary ductal system, and the proximal tubules of the kidney. Its involvment in ileal BA absorption is supported by the fact that patients with a mutation in the I-BAT gene or with a diminished expression level of I-BAT, as in familial hypertriglyceridemia, fail to absorb BAs efficiently (9Oelkers P. Kirby L.C. Heubi J.E. Dawson P.A. J. Clin. Invest. 1997; 99: 1880-1887Google Scholar, 10Duane W.C. Hartich L.A. Bartman A.E. Ho S.B. J. Lipid Res. 2000; 41: 1384-1389Google Scholar). Once into the cell, BAs are reversibly bound to I-BABP, also termed ileal lipid-binding protein. It is an abundant soluble 14-kDa protein that belongs to the fatty acid-binding protein superfamily (11Bernlohr D.A. Simpson M.A. Hertzel A.V. Banaszak L.J. Annu. Rev. Nutr. 1997; 17: 277-303Google Scholar). As with the other members of this multigenic family, the tertiary structure of I-BABP consists of 10 antiparallel β strands organized into two orthogonal β sheets forming an hydrophobic pocket (12Lücke C. Zhang F. Rüterjans H. Hamilton J.A. Sacchettini J.C. Structure (Lond.). 1996; 4: 785-800Google Scholar). Specificities in the I-BABP structure (high volume cavity, great flexibility of the backbone structure) account for its preferential binding of bulky hydrophobic and rigid ligands such as unconjugated and conjugated BAs (13Lucke C. Zhang F. Hamilton J.A. Sacchettini J.C. Ruterjans H. Eur. J. Biochem. 2000; 267: 2929-2938Google Scholar). In the digestive tract, I-BABP is found in both small intestine and liver, in which its expression is strictly restricted to the ileocytes (14Sacchettini J.C. Hauft S.M. Van Camp S.L. Cistola D.P. Gordon J.I. J. Biol. Chem. 1990; 265: 19199-19207Google Scholar, 15Gong Y.Z. Everett E.T. Schwartz D.A. Norris J.S. Wilson F.A. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 4741-4745Google Scholar) and large cholangiocytes (16Alpini G. Glaser S.S. Rodgers R. Phinizy J.L. Robertson W.E. Lasater J. Caligiuri A. Tretjak Z. LeSage G.D. Gastroenterology. 1997; 113: 1734-1740Google Scholar), respectively. The physiological function of I-BABP is not yet clearly established. However, its ligand binding properties, its abundance and strict localization in cells in which BA flux is substantial, and its physical interactions with I-BAT (17Kramer W. Girbig F. Gutjahr U. Kowalewski S. Jouvenal K. Müller G. Tripier D. Wess G. J. Biol. Chem. 1993; 268: 18035-18046Google Scholar, 18Kramer W. Biochim. Biophys. Acta. 1995; 1257: 230-238Google Scholar) strongly suggest that I-BABP plays a role in cellular BA uptake, trafficking, and/or protection against the detergent effect of free BAs. Such functions suggest that the expression of I-BABP gene is crucial for the BAs circulation and hence for CS balance. Therefore, it was tempting to speculate that the expression of I-BABP gene is subjected to a tight regulation. In agreement with this assumption, we have recently demonstrated that BAs up-regulate the human I-BABP gene expression (19Kanda T. Foucaud L. Nakamura Y. Niot I. Besnard P. Fujita M. Sakai Y. Hatakeyama K. Ono T. Fujii H. Biochem. J. 1998; 330: 261-265Google Scholar) through the interaction of FXR/RXR heterodimer with a BA-responsive element located in the proximal part of promoter (20Grober J. Zaghini I. Fujii H. Jones S.A. Kliewer S.A. Willson T.M. Ono T. Besnard P. J. Biol. Chem. 1999; 274: 29749-29754Google Scholar). In the current report, we show that the positive feedback of the I-BABP gene in response to CS feeding is because of an indirect pathway involving the LXR-mediated induction of SREBP1c. The implication of different CS sensors (FXR, LXR/SREBP1c) in the regulation of the I-BABP gene in the ileum strongly suggest that this soluble BA carrier contributes to CS balance. French guidelines for the use and care of laboratory animals were followed. Male Swiss mice (30 ± 2 g) from the Center d'Elevage Dépré(Saint Doulchard, France) were used. Animals were housed individually in a controlled environment (constant temperature and humidity, darkness from 8 p.m. to 8 a.m.) and fed ad libitum a standard chow (UAR A04, Usine d'Alimentation Rationnelle, France). To explore the effects of a high CS diet on I-BABP gene expression, mice were fed for 14 days a standard chow supplemented with 2% CS (w/w). Controls were fed the standard chow containing <0.02% CS. In the second set of experiments, mice were either sacrified 24 h after a gavage with a specific LXR agonist (36 mg/kg GW3965). Controls received by force feeding the vehicle alone (0.9% carboxymethylcellulose, 9% polyethylene glycol 400, and 0.05% Tween 80). After sacrifice, the ileal mucosa corresponding to the 5-cm intestinal segment before the cecum were scraped, snap-frozen in liquid nitrogen, then stored at −80 °C until RNAs extraction. Caco-2 cells (passages 55–60) were cultured in controlled environment (37 °C, 5% CO2) in medium A (Dulbecco's modified Eagle's medium (DMEM), 4 mmglutamine, 1% non-essential amino acids, 100 units/ml penicillin, 100 μg/ml streptomycin) supplemented with 20% fetal calf serum (FCS). Medium was changed every 2 days. At the first day of confluence, cells were incubated for 24 h in the medium A containing 10% fetal calf serum (v/v) in presence of 50 μm chenodeoxycholic acid (CDCA) alone (control) or associated with either 5 μg/ml simvastatin (sterols −) or 10 μg/ml CS and 1 μg/ml 25-hydroxy-cholesterol (25-(OH)CS) (sterols +). Control cultures received the vehicle alone (2 μl/ml ethanol). Male Swiss mice were fasted overnight and ileal explants were prepared then cultured as described previously (21Mallordy A. Poirier H. Besnard P. Niot I. Carlier H. Eur. J. Biochem. 1995; 227: 801-807Google Scholar). In brief, ileal samples were rapidly removed, washed, then sliced into strips whom serosa was stripped off. Ileal explants were precultured for 4 h at 37 °C under an oxygenated atmosphere in Hepes-buffered DMEM containing 10% NCTC-135, 10% fetal calf serum, 1% fungizone, and 0.1 mg/ml gentamycin (all from Invitrogen). Then, the explants were cultured for 16 h in the same medium supplemented with 5% in lipoprotein free medium in presence of 50 μm GW3965 (LXR agonist). Control cultures received the vehicle alone (2 μl/ml Me2SO). Total RNAs were isolated following the method of Chomczynski and Sacchi (22Chomczynski P. Sacchi N. Anal. Biochem. 1987; 162: 156-159Google Scholar) or with RNeasy mini kit (Qiagen) for organ cultures of ileal explants. The RNAs (10–30 μg) were electrophoresed on a 1% agarose gel and transferred to GeneScreen membrane (PerkinElmer Life Sciences) using previously published procedures (20Grober J. Zaghini I. Fujii H. Jones S.A. Kliewer S.A. Willson T.M. Ono T. Besnard P. J. Biol. Chem. 1999; 274: 29749-29754Google Scholar). cDNA from human I-BABP were used as probes (23Fujita M. Fujii H. Kanda T. Sato E. Hatakeyama K. Ono T. Eur. J. Biochem. 1995; 233: 406-413Google Scholar). The cDNA from murine 18 S rRNA was used to ensure that equivalent amounts of RNAs were loaded and transferred. Probes were labeled with [α-32P]dCTP (3000 Ci/mmol; ICN) by a megaprime kit (Amersham Biosciences, Inc.). cDNA was synthesized from 5 μg of total RNA in 20 μl using random hexamers and murine Moloney leukemia virus reverse transcriptase (Invitrogen). Real-time quantitative RT-PCR analyzes were performed starting with 50 ng of reverse-transcribed total RNA (diluted in 5 μl of 1× Sybr Green buffer), with 200 nm of both sense and antisense primers (Genset) in a final volume of 25 μl using the Sybr Green PCR core reagents in a ABI PRISM 7700 Sequence Detection System instrument (Applied Biosystems). Because we used Sybr Green in measurements of amplification-associated fluorescence for real-time quantitative RT-PCR, it was important to verify that generated fluorescence was not overestimated by contaminations resulting from residual genomic DNA amplification (using controls without reverse transcriptase) and/or from primer dimers formation (controls with no DNA template nor reverse transcriptase). RT-PCR products were also analyzed on ethidium bromide stained agarose to ensure that a single amplicon of the expected size was indeed obtained. 18 S rRNA and GAPDH amplifications were used to account for variability in the initial quantities of cDNA. Relative quantitation for any given gene, expressed as-fold variation over control, was calculated after determination of the difference between cycle threshold (CT) of the given gene in both control (A) and treated (B) samples using the 2−Δ(CTA− CTB)formula according to manufacturer's protocol. Individual CT values are means of triplicate measurements. Sense and antisense primers were: GGCCATCCACAGTCTTCTGG and ACCACAGTCCATGCCATCACTGCCA for GAPDH, GGGAGCCTGAGAAACGGC and GGGTCGGGAGTGGGTAATTT for 18 S, GCGCCATGGACGAGCTG and TTGGCACCTGGGCTGCT for SREBP1a, GGAGCCATGGATTGCACATT and GCTTCCAGAGAGGAGGCCAG for SREBP1c, CCCTTGACTTCCTTGCTGCA and GCGTGAGTGTGGGCGAATC for SREBP2, GGGAAGGACATTCGCTCGG and TTGCTTTTCAGCTTGCTCGG for ABCA1, GAGTGGCAGGACCCCTTTG and GTTTCGAGCCAGGCTTTCAC for HMG-CoA reductase. Wild type −2769/+44 (2769 I-BABPwt) and −148/+44 (148 I-BABPwt) bp fragments of the human I-BABP promoter were cloned upstream from the chloramphenicol acetyltransferase (CAT) gene in the pCAT3-basic vector (Promega, Madison, WI). Mutations of the sterol-responsive element (SRE; 148 I-BABPmut1) and the GC box (148 I-BABPmut2) were generated by site-directed mutagenesis (QuickchangeTM site-directed mutagenesis kit, Stratagene) using the following oligonucleotides 5′-ggagggagaagaaGTGGGATATCttaggggctgagcc-3′ (SRE sequence in capital letters, mutations in bold letters) and 5′ ggagaagaagtggggtgacttCTAGACtgagcctcagcaactggg-3′ (CG box sequence in capital letters, mutation in bold letters). Deletion of these sequences (148 I-BABPdel) was realized using the following primer 5′-caggacaggagggagaagaagcctcagcaactgggagag-3′. All constructs were confirmed prior to use by restriction digestions. CaCo-2 cells were used for the transfection studies. They were plated in six-well plates in DMEM supplemented with 10% FCS at 40–50% confluence. Transfection mixes contained 4 μg of I-BABP-CAT reporter plasmid and 500 ng of β-galactosidase expression vector. Co-transfection mixes contained 4 μg of I-BABP-CAT reporter plasmid, 10 or 100 ng of human SREBP1a, SREBP1c, or SREBP2 expression vectors (generous gift from Dr T. F. Osborne, University of California, Irvine, CA) or 4 μg of human Sp1 expression vector (generous gift from Dr R. Tjian, Howard Hughes Medical Institute, Department of Molecular and Cell Biology, University of California, Berkeley, CA) and 500 ng of β-galactosidase expression vector. Cells were transfected overnight by the calcium phosphate precipitation method. In transfection studies, the medium was changed by DMEM supplemented with 1% of lipoprotein-depleted serum (sterols −) or 10 μg/ml CS and 1 μg/ml 25-(OH)CS (sterols +). In co-transfections studies, the medium was changed by DMEM supplemented with 10% FCS associated with 10 μg/ml CS and 1 μg/ml 25-(OH)CS to inhibit maturation of endogenous SREBPs. The cells were incubated for an additional 24 h. Cell extracts were prepared and assayed for CAT and β-galactosidase activities. SREBP1c (24Tontonoz P. Kim J.B. Graves R.A. Spiegelman B.M. Mol. Cell. Biol. 1993; 13: 4753-4759Google Scholar) was synthesized in vitro using the TNT rabbit reticulocyte lysate coupled in vitro transcription/translation system (Promega) according to the manufacturer's instructions. Gel mobility shift assays (20 μl) contained 20 mm HEPES (pH 7.8), 120 mm KCl, 0.4% Nonidet P-40, 12% glycerol, 2 mm dithiothreitol, 0.2 μg of poly(dI-dC), and freshly synthesized SREBP1c protein (5 μl). Competitor oligonucleotides, including the wild type SRELDL(gatcaaaATCACCCCACtgc), wild type SREI-BABP(gatcccctaaGTCACCCCACttcttc), mutated SREI-BABP(gatcccctaaGATATCCCACttcttc, mutations indicated in bold letters), were included at a 500-fold excess. After a 10-min incubation on ice, 10 ng of 5′ end-labeled [γ-32P]ATP oligonucleotide (wild type SREI-BABP) was added and the incubation continued for an additional 10 min. DNA-protein complexes were resolved on a 4% polyacrylamide gel in 0.5 m TBE (90 mm Tris, 90 mm boric acid, 2 mmEDTA). Gels were dried and subjected to autoradiography at −70 °C. The results were expressed as means ± S.E. The significance of the differences between groups was determined by Student's t test. Statistical significance for real-time quantitative RT-PCR was assessed by analysis of variance followed by Newman-Keuls comparison tests (Statistica, StatSoft Inc.). In undifferentiated Caco-2 cells cultured under standard conditions, I-BABP mRNA levels are too low to detect a putative inhibitory effect. Because CDCA is known to be a strong I-BABP gene inducer (19Kanda T. Foucaud L. Nakamura Y. Niot I. Besnard P. Fujita M. Sakai Y. Hatakeyama K. Ono T. Fujii H. Biochem. J. 1998; 330: 261-265Google Scholar), the effect of a sterol addition (10 μg/ml CS + 1 μg/ml 25-(OH)CS) or depletion (5 μg/ml HMG-CoA reductase inhibitor, simvastatin) on I-BABP mRNA levels was studied on cells simultaneously subjected to 50 μm CDCA. According to previously published data (19Kanda T. Foucaud L. Nakamura Y. Niot I. Besnard P. Fujita M. Sakai Y. Hatakeyama K. Ono T. Fujii H. Biochem. J. 1998; 330: 261-265Google Scholar), CDCA alone led to a 2-fold increase in I-BABP transcripts as compared with the control culture (data not shown). As shown in the Fig.1, the I-BABP mRNA levels were significantly increased when Caco-2 were sterol-deprived and repressed when the sterols were added to the medium. Similar modifications in mRNA levels have also been found for the 3-HMG-CoA reductase, which is known to be a typical sterol target gene (data not shown). To determine whether the sterol-mediated effects on I-BABP mRNA levels might be secondary to a direct gene regulation, Caco-2 cells were transiently transfected either with a long (2769 I-BABPwt) or a short (148 I-BABPwt) human I-BABP promoter fragments cloned into a CAT reporter vector in presence or in absence of sterols. Lipoprotein deprivation resulted in a 4-fold rise in CAT activity as compared with sterol-treated cells. Additional transactivation occurred in cells cultured in sterol-depleted medium in which cholesterol synthesis was inhibited by the HMG-CoA reductase inhibitor, simvastatin (Fig. 2). This finding brings the first demonstration that the human I-BABP gene is a sterol target gene. The fact that the short promoter construct was always sterol-sensitive strongly suggests a proximal localization for the sterol-responsive sequence. According with this assumption, the sequence inspection of human I-BABP promoter revealed the decamer (5′-GTGGGGTGAC-3′) at the position −72/−62 exhibiting a high homology with the SREBP-binding site-1 (SRE-1) found in the promoters of LDL receptor (25Yokoyama C. Wang X. Briggs M.R. Admon A. Wu J. Hua X. Goldstein J.L. Brown M.S. Cell. 1993; 75: 187-197Google Scholar), HMG-CoA synthase (26Wang X. Sato R. Brown M.S. Hua X. Goldstein J.L. Cell. 1994; 77: 53-62Google Scholar), and glycerol-3-phosphate acyltransferase (27Ericsson J. Jackson S.M. Kim J.B. Spiegelman B.M. Edwards P.A. J. Biol. Chem. 1997; 272: 7298-7305Google Scholar). To function efficiently, SREBPs require the additional transcription factors NF-Y or Sp-1 (28Schoonjans K. Brendel C. Mangelsdorf D. Auwerx J. Biochim. Biophys. Acta. 2000; 1529: 114-125Google Scholar). A putative Sp-1-binding site (GC box−58/−54) flanking the SRE−72/−62sequence was also identified in the human I-BABP promoter. Sequence alignment of the proximal promoter of human, rabbit, and mouse I-BABP genes demonstrated that the SRE sequence and GC box are highly conserved in these different mammalian species (Fig.3). Deletion/mutation analyzes of the short promoter confirmed the importance of these sequences (Fig.4). Indeed, the strong induction of the CAT activity triggered by sterol depletion in the wild type promoter (148 I-BABPwt) was fully abolished when SRE−72/−62 or GC box−58/−54 were mutated (148 I-BABPmut1 and 148 I-BABPmut2) or deleted (148 I-BABPdel). Interestingly, similar results were also found in the context of the large promoter (2800 bp), demonstrating that only the proximal sequence −72/−54 is critical for CS response (data not shown).Figure 3A conserved putative SRE sequence in the human, rabbit and mouse I-BABP gene promoters. The first 200 bp of the human, rabbit, and mouse gene I-BABP promoters were aligned using the Multalin algorithm. Numbering starts from the transcription start site of each promoter.View Large Image Figure ViewerDownload (PPT)Figure 4Characterization of a SRE sequence in the human I-BABP gene reporter by mutation-deletion analysis. CaCo-2 cells were transiently tranfected with the different I-BABP promoter-reporter gene constructs and then cultured for 24 h in presence or in absence of sterols. Lane 1, 148 I-BABPwt construct containing the native SRE−72/−62 and GC box−58/−54 sequence;lane 2, 148 I-BABPmut1 construct containing a muted SRE−72/−62 and native GC box−58/−54sequence; lane 3, 148 I-BABPmut2 construct containing a native SRE−72/−62 and a muted GC box−58/−54 sequence; lane 4, 148 I-BABPdel construct in which SRE−72/−62 and GC box−58/−54 sequence was deleted. Condition sterols (+) = DMEM + 1% lipoprotein free serum + 10 μg/ml CS + 1 μg/ml 25-(OH)CS; condition sterols (−) = DMEM + 1% lipoprotein-free serum. Means ± S.E., n = 3.View Large Image Figure ViewerDownload (PPT) In cultured cells sterol-depleted conditions lead to the proteolytic activation of SREBPs that bind to SRE in the promoter of sterol target genes. To determine the involvment of SREBPs on sterol-mediated regulation of I-BABP gene, Caco-2 cells were co-transfected with the wild type version of the short I-BABP promoter-CAT plasmid and expression vectors expressing mature SREBP1a, SREBP1c, or SREBP2. As shown in Fig.5A, CAT activity driven by the 148 I-BABPwt promoter was similarly induced by both SREBP1a and SREBP2 in dose-dependent manner. A lower, but significant, effect was also found in presence of 100 ng of SREBP1c expression vector (Fig. 5A). This observation is in good agreement with the fact that SREBP1c isoform is a much weaker transcription activator than SREBP1a in cultured cells (29Shimano H. Horton J.D. Shimomura I. Hammer R.E. Brown M.S. Goldstein J.L. J. Clin. Invest. 1997; 99: 846-854Google Scholar). Constructs in which SRE−72/−62 was mutated or deleted were unresponsive to SREBPs (Fig. 5B). To function efficiently SREBPs must be activated by co-factors such as Sp-1 or NF-Y. To explore the functional role of the putative Sp-1-binding site (GC box−58/−54) identified in the close proximity of the SRE-1 (Fig. 3), Caco-2 cells were co-transfected with different constructs of the short I-BABP promoter in the presence of a Sp-1 expression vector or empty plasmid (CMV5). The 4-fold induction of CAT activity mediated by Sp-1 in wild type promoter was not affected by the mutation of SRE-1 sequence (148 I-BABPmut1). By contrast, it was substantially decreased when mutations were introduced in the GC box (148 I-BABP mut2), suggesting that the nucleotide sequence −58/−54 is a Sp-1-binding site (Fig.5C). It is noteworthy that the different modifications introduced in the sequence of the proximal promoter of human I-BABP gene do not alter its functional activity. Indeed, the mutation or deletion of the SRE−72/−62 sequence and GC box−58/−54 in a promoter construct containing the BA-responsive element did not abrogate the FXR/CDCA-mediated transactivation of the CAT reporter gene (data not shown). Taken together, the current in vitroexperiments demonstrate that I-BABP gene expression might be regulated by SREBPs in response to alteration of cellular sterol levels. To assess the physiological pertinence of this finding, I-BABP expression was explored in mice fed for 14 days a standard chow supplemented with 2% CS. Surprisingly, the I-BABP mRNA levels were significantly higher in the ileum from mice subjected to the CS supplementation than in animal fed the control diet (Fig.6A). Interestingly, ileal SREBP1c mRNA levels were also significantly increased by the high CS diet, whereas the transcripts encoding SREBP1a were unchanged (Fig.6B), and as previously reported, SREBP2 mRNA levels were reduced by the CS feeding (30Shimomura I. Bashmakov Y. Shimano H. Horton J.D. Goldstein J.L. Brown M.S. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 12354-12359Google Scholar, 31Repa J.J. Liang G. Ou J. Bashmakov Y. Lobaccaro J.M. Shimomura I. Shan B. Brown M.S. Goldstein J.L. Mangelsdorf D.J. Genes Dev. 2000; 14: 2819-2830Google Scholar). To determine whether the SREBP1c isoform can specifically bind to the SREI-BABP motif, electrophoretic mobility shift assays were performed using the32P-labeled SRE from the human I-BABP promoter as probe. In the presence of SREBP1c, a shift was found (Fig.7, lane 12). The binding specificity of SREBP1c to wild type SREI-BABP was demonstrated by the existence of a competitive inhibition in presence of an excess of either wild type SREI-BABP or SRELDL sequences (Fig. 7, lanes 13 and14), not reproduced with mutated SREI-BABP (Fig.7, lane 15). No binding was obtained when mutated SREI-BABP was used as probe (Fig. 7, lanes 15–20). LDL receptor SRE was also used as positive control probe (Fig. 7, lanes 1–10).Figure 7SREBP1c specifically binds the humanSRE. Electrophoretic mobility shift assay was performed in presence of in vitro translated SREBP1c and wild type (WT) I-BABP SRE (WT SREI-BABP) as probe. LDL receptor SRE (WT SRELDL and Mut SRELDL) were used as control probes. Competition analysis was performed with an excess of WT SREI-BABP, WT SRELDL, or mutated I-BABP SRE (Mut SREI-BABP).View Large Image Figure ViewerDownload (PPT) Because, first, it has been recently demonstrate" @default.
• W2139278344 created "2016-06-24" @default.
• W2139278344 creator A5005226721 @default.
• W2139278344 creator A5005955072 @default.
• W2139278344 creator A5020193087 @default.
• W2139278344 creator A5020235630 @default.
• W2139278344 creator A5033529457 @default.
• W2139278344 creator A5041530478 @default.
• W2139278344 creator A5049950620 @default.
• W2139278344 creator A5053413688 @default.
• W2139278344 creator A5061850393 @default.
• W2139278344 creator A5062829357 @default.
• W2139278344 creator A5065504041 @default.
• W2139278344 date "2002-01-01" @default.
• W2139278344 modified "2023-10-15" @default.
• W2139278344 title "Sterol Regulatory Element-binding Protein-1c Is Responsible for Cholesterol Regulation of Ileal Bile Acid-binding Protein Gene in Vivo" @default.
• W2139278344 cites W1484090198 @default.
• W2139278344 cites W1539287055 @default.
• W2139278344 cites W1567895808 @default.
• W2139278344 cites W1750420534 @default.
• W2139278344 cites W1954350862 @default.
• W2139278344 cites W1974930928 @default.
• W2139278344 cites W1978017146 @default.
• W2139278344 cites W1989887371 @default.
• W2139278344 cites W2004168108 @default.
• W2139278344 cites W2004367786 @default.
• W2139278344 cites W2009624930 @default.
• W2139278344 cites W2013019095 @default.
• W2139278344 cites W2021632088 @default.
• W2139278344 cites W2023719883 @default.
• W2139278344 cites W2024526388 @default.
• W2139278344 cites W2024851295 @default.
• W2139278344 cites W2030026755 @default.
• W2139278344 cites W2032399154 @default.
• W2139278344 cites W2038655486 @default.
• W2139278344 cites W2039664177 @default.
• W2139278344 cites W2039999119 @default.
• W2139278344 cites W2040417680 @default.
• W2139278344 cites W2040641918 @default.
• W2139278344 cites W2051040521 @default.
• W2139278344 cites W2053581007 @default.
• W2139278344 cites W2054462517 @default.
• W2139278344 cites W2055837207 @default.
• W2139278344 cites W2063969584 @default.
• W2139278344 cites W2078600472 @default.
• W2139278344 cites W2085909854 @default.
• W2139278344 cites W2086072924 @default.
• W2139278344 cites W2090980946 @default.
• W2139278344 cites W2096294040 @default.
• W2139278344 cites W2099765837 @default.
• W2139278344 cites W2124615340 @default.
• W2139278344 cites W2127909718 @default.
• W2139278344 cites W2137319749 @default.
• W2139278344 cites W2149174371 @default.
• W2139278344 cites W2151780486 @default.
• W2139278344 cites W2157038552 @default.
• W2139278344 cites W2169783090 @default.
• W2139278344 cites W2171398834 @default.
• W2139278344 cites W36612387 @default.
• W2139278344 cites W4238191426 @default.
• W2139278344 cites W4251988075 @default.
• W2139278344 cites W4294216491 @default.
• W2139278344 doi "https://doi.org/10.1074/jbc.m106375200" @default.
• W2139278344 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11684682" @default.
• W2139278344 hasPublicationYear "2002" @default.
• W2139278344 type Work @default.
• W2139278344 sameAs 2139278344 @default.
• W2139278344 citedByCount "28" @default.
• W2139278344 countsByYear W21392783442015 @default.
• W2139278344 countsByYear W21392783442017 @default.
• W2139278344 countsByYear W21392783442018 @default.
• W2139278344 countsByYear W21392783442019 @default.
• W2139278344 countsByYear W21392783442022 @default.
• W2139278344 crossrefType "journal-article" @default.
• W2139278344 hasAuthorship W2139278344A5005226721 @default.
• W2139278344 hasAuthorship W2139278344A5005955072 @default.
• W2139278344 hasAuthorship W2139278344A5020193087 @default.
• W2139278344 hasAuthorship W2139278344A5020235630 @default.
• W2139278344 hasAuthorship W2139278344A5033529457 @default.
• W2139278344 hasAuthorship W2139278344A5041530478 @default.
• W2139278344 hasAuthorship W2139278344A5049950620 @default.
• W2139278344 hasAuthorship W2139278344A5053413688 @default.
• W2139278344 hasAuthorship W2139278344A5061850393 @default.
• W2139278344 hasAuthorship W2139278344A5062829357 @default.
• W2139278344 hasAuthorship W2139278344A5065504041 @default.
• W2139278344 hasBestOaLocation W21392783441 @default.
• W2139278344 hasConcept C104317684 @default.
• W2139278344 hasConcept C185592680 @default.
• W2139278344 hasConcept C207001950 @default.
• W2139278344 hasConcept C2778163477 @default.
• W2139278344 hasConcept C2778718757 @default.
• W2139278344 hasConcept C2779399885 @default.
• W2139278344 hasConcept C51639874 @default.
• W2139278344 hasConcept C54355233 @default.
• W2139278344 hasConcept C553089730 @default.
• W2139278344 hasConcept C55493867 @default.
• W2139278344 hasConcept C85051948 @default.
• W2139278344 hasConcept C86803240 @default.

• next