FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2141430858> ?p ?o ?g. }

• W2141430858 endingPage "12420" @default.
• W2141430858 startingPage "12414" @default.
• W2141430858 abstract "To find novel cytoplasmic binding partners of the α1D-adrenergic receptor (AR), a yeast two-hybrid screen using the α1D-AR C terminus as bait was performed on a human brain cDNA library. α-Syntrophin, a protein containing one PDZ domain and two pleckstrin homology domains, was isolated in this screen as an α1D-AR-interacting protein. α-Syntrophin specifically recognized the C terminus of α1D- but not α1A- or α1B-ARs. In blot overlay assays, the PDZ domains of syntrophin isoforms α, β1, and β2 but not γ1 or γ2 showed strong selective interactions with the α1D-AR C-tail fusion protein. In transfected human embryonic kidney 293 cells, full-length α1D- but not α1A- or α1B-ARs co-immunoprecipitated with syntrophins, and the importance of the receptor C terminus for the α1D-AR/syntrophin interaction was confirmed using chimeric receptors. Mutation of the PDZ-interacting motif at the α1D-AR C terminus markedly decreased inositol phosphate formation stimulated by norepinephrine but not carbachol in transfected HEK293 cells. This mutation also dramatically decreased α1D-AR binding and protein expression. In addition, stable overexpression of α-syntrophin significantly increased α1D-AR protein expression and binding but did not affect those with a mutated PDZ-interacting motif, suggesting that syntrophin plays an important role in maintaining receptor stability by directly interacting with the receptor PDZ-interacting motif. This direct interaction may provide new information about the regulation of α1D-AR signaling and the role of syntrophins in modulating G protein-coupled receptor function. To find novel cytoplasmic binding partners of the α1D-adrenergic receptor (AR), a yeast two-hybrid screen using the α1D-AR C terminus as bait was performed on a human brain cDNA library. α-Syntrophin, a protein containing one PDZ domain and two pleckstrin homology domains, was isolated in this screen as an α1D-AR-interacting protein. α-Syntrophin specifically recognized the C terminus of α1D- but not α1A- or α1B-ARs. In blot overlay assays, the PDZ domains of syntrophin isoforms α, β1, and β2 but not γ1 or γ2 showed strong selective interactions with the α1D-AR C-tail fusion protein. In transfected human embryonic kidney 293 cells, full-length α1D- but not α1A- or α1B-ARs co-immunoprecipitated with syntrophins, and the importance of the receptor C terminus for the α1D-AR/syntrophin interaction was confirmed using chimeric receptors. Mutation of the PDZ-interacting motif at the α1D-AR C terminus markedly decreased inositol phosphate formation stimulated by norepinephrine but not carbachol in transfected HEK293 cells. This mutation also dramatically decreased α1D-AR binding and protein expression. In addition, stable overexpression of α-syntrophin significantly increased α1D-AR protein expression and binding but did not affect those with a mutated PDZ-interacting motif, suggesting that syntrophin plays an important role in maintaining receptor stability by directly interacting with the receptor PDZ-interacting motif. This direct interaction may provide new information about the regulation of α1D-AR signaling and the role of syntrophins in modulating G protein-coupled receptor function. α1-Adrenergic receptors (α1-ARs) 2The abbreviations used are: AR, adrenergic receptor; NE, norepinephrine; HRP, horseradish peroxidase; HA, hemagglutinin; HEK, human embryonic kidney; PDZ, PSD95/Discs-large/ZO-1 homology; RT, room temperature; PSD95, post-synaptic density protein of 95 kDa; MAGI2, membrane-associated guanylate kinase inverted 2; PH, pleckstrin homology; aa, amino acids; GST, glutathione S-transferase; InsP, inositol phosphate; hα-syn, human α-syntrophin. are G protein-coupled receptors that mediate various important physiological functions of norepinephrine (NE) and epinephrine, particularly in the cardiovascular system where they are responsible for regulating vascular tone and peripheral resistance. Three α1-AR subtypes have been cloned (α1A-, α1B-, and α1D-AR) and display differences in sequence homology and affinities for subtype selective ligands (1Zhong H. Minneman K.P. Eur. J. Pharmacol. 1999; 375: 261-276Crossref PubMed Scopus (335) Google Scholar). Upon agonist stimulation, all three α1-AR subtypes signal through Gαq/11 to increase phospholipase C activity and intracellular Ca2+ mobilization (1Zhong H. Minneman K.P. Eur. J. Pharmacol. 1999; 375: 261-276Crossref PubMed Scopus (335) Google Scholar, 2Hague C. Chen Z. Uberti M. Minneman K.P. Life Sci. 2003; 74: 411-418Crossref PubMed Scopus (37) Google Scholar). In addition, recent studies using α1-AR transgenic and knock-out mice have now revealed that all three α1-AR subtypes are important for the regulation of blood pressure (2Hague C. Chen Z. Uberti M. Minneman K.P. Life Sci. 2003; 74: 411-418Crossref PubMed Scopus (37) Google Scholar, 3Tanoue A. Koshimizu T.A. Tsujimoto G. Life Sci. 2002; 71: 2207-2215Crossref PubMed Scopus (53) Google Scholar). Therefore, it remains unclear if specific functional differences exist between the α1-AR subtypes. Increasing evidence now suggests that α1-AR subtypes display differences in their ability to interact with specific protein binding partners. The first α1-AR subtype-selective binding partner identified was tissue transglutaminase II, which selectively associates with α1B- and α1D-ARs (4Nakaoka H. Perez D.M. Baek K.J. Das T. Husain A. Misono K. Im M.J. Graham R.M. Science. 1994; 264: 1593-1596Crossref PubMed Scopus (531) Google Scholar, 5Chen S. Lin F. Iismaa S. Lee K.N. Birckbichler P.J. Graham R.M. J. Biol. Chem. 1996; 271: 32385-32391Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar). Since then, other proteins found to selectively associate with α1-ARs include gC1qR (6Xu Z. Hirasawa A. Shinoura H. Tsujimoto G. J. Biol. Chem. 1999; 274: 21149-21154Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar), adaptor protein complex-2 (7Diviani D. Lattion A.L. Abuin L. Staub O. Cotecchia S. J. Biol. Chem. 2003; 278: 19331-19340Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar), regulators of G protein signaling-2 (8Hague C. Bernstein L.S. Ramineni S. Chen Z. Minneman K.P. Hepler J.R. J. Biol. Chem. 2005; 280: 27289-27295Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar), and spinophilin (9Wang X. Zeng W. Soyombo A.A. Tang W. Ross E.M. Barnes A.P. Milgram S.L. Penninger J.M. Allen P.B. Greengard P. Muallem S. Nat. Cell Biol. 2005; 7: 405-411Crossref PubMed Scopus (128) Google Scholar). These interactions were shown to be important for the signaling (8Hague C. Bernstein L.S. Ramineni S. Chen Z. Minneman K.P. Hepler J.R. J. Biol. Chem. 2005; 280: 27289-27295Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar, 9Wang X. Zeng W. Soyombo A.A. Tang W. Ross E.M. Barnes A.P. Milgram S.L. Penninger J.M. Allen P.B. Greengard P. Muallem S. Nat. Cell Biol. 2005; 7: 405-411Crossref PubMed Scopus (128) Google Scholar), trafficking (6Xu Z. Hirasawa A. Shinoura H. Tsujimoto G. J. Biol. Chem. 1999; 274: 21149-21154Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar), and internalization (7Diviani D. Lattion A.L. Abuin L. Staub O. Cotecchia S. J. Biol. Chem. 2003; 278: 19331-19340Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar) properties of the α1-ARs. Therefore, these differential interactions may contribute to subtype-specific differences between the members of the α1-AR family. Previously, the α1D-AR was the least studied of the α1-AR subtypes due to difficulties in obtaining significant cell surface expression and poor signaling in heterologous systems. Recent studies have reported that this is due to the primary intracellular localization of this receptor (10Chalothorn D. McCune D.F. Edelmann S.E. Garcia-Cazarin M.L. Tsujimoto G. Piascik M.T. Mol. Pharmacol. 2002; 61: 1008-1016Crossref PubMed Scopus (122) Google Scholar, 11Hague C. Chen Z. Pupo A.S. Schulte N. Toews M.L. Minneman K.P. J. Pharmacol. Exp. Ther. 2004; 309: 388-397Crossref PubMed Scopus (63) Google Scholar). Subsequent findings indicated that N-terminal truncation (11Hague C. Chen Z. Pupo A.S. Schulte N. Toews M.L. Minneman K.P. J. Pharmacol. Exp. Ther. 2004; 309: 388-397Crossref PubMed Scopus (63) Google Scholar, 12Pupo A.S. Uberti M.A. Minneman K.P. Eur. J. Pharmacol. 2003; 462: 1-8Crossref PubMed Scopus (44) Google Scholar) or heterodimerization with α1B-ARs (13Uberti M. Hall R.A. Minneman K.P. Mol. Pharmacol. 2003; 64: 1379-1390Crossref PubMed Scopus (97) Google Scholar, 14Hague C. Uberti M.A. Chen Z. Hall R.A. Minneman K.P. J. Biol. Chem. 2004; 279: 15541-15549Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar) or β2-ARs (15Uberti M.A. Hague C. Oller H. Minneman K.P. Hall R.A. J. Pharmacol. Exp. Ther. 2005; 313: 16-23Crossref PubMed Scopus (122) Google Scholar) promotes α1D-AR cell surface expression and increases coupling to functional responses. However, it remains unknown if there are any α1D-AR accessory proteins involved in α1D-AR function and/or expression. In this study, we have identified several closely related syntrophin family isoforms (α, β1, and β2) as novel α1D-AR binding partners using a combination of yeast two-hybrid screening and biochemical techniques. We report that syntrophins directly interact with α1D-ARs through a PDZ domain-mediated interaction. The specificity of this association and its potential role in regulating α1D-AR expression and signaling were examined. Materials and Reagents—Materials used in this study were obtained from the following sources. Components for yeast two-hybrid screening (Clontech, Palo Alto, CA): YPD agar and YPD broth (Qbiogene, Irvine, CA); 425–600 μm glass beads (acid-washed, G8772), anti-FLAG M2 affinity gel (A2220), and horseradish peroxidase (HRP)-conjugated anti-FLAG M2 antibody (Sigma-Aldrich). Cell culture media: trypsin (Mediatech, Herndon, VA), fetal bovine serum, Lipofectamine 2000, 4–20% Tris-glycine SDS-PAGE gel (Invitrogen); goat anti-mouse κ HRP-conjugate (Southern Biotechnology Associate, Birmingham, AL); human embryonic kidney 293 (HEK293) cells (ATCC, Manassas, VA); n-dodecyl-β-d-maltoside (Calbiochem); QIAprep Spin Miniprep kit (Qiagen, Valencia, CA); ProTran nitrocellulose (Schleicher & Schuell); ECL (PerkinElmer Life Sciences); HRP-conjugated S protein (Novagen, San Diego, CA); mouse anti-syntrophins antibody (MA1–745, Affinity BioReagents, Golden, CO). Yeast Two-hybrid Screening—Plasmid pGBKT7/α1D-C-tail (aa 480–572) was used as bait to screen a human brain pretransformed cDNA library (in pACT2) by using the standard yeast mating protocol stated in the manual. Yeast were plated on high stringency selective medium (SD/–Leu/–Trp/–His/–Ade) and incubated for 7 days at 30 °C. Positive colonies were restreaked on selective medium (SD/–Leu/–Trp/–His/-Ade). Yeast DNA extracts were obtained by using QIAprep Spin Miniprep kit supplemented with 250 μl of 425–600 μm glass beads in buffer P1 by vortexing for 5 min. Library plasmid DNA was rescued from positive colonies by transforming yeast DNA extracts into Escherichia coli TOP10F′ cells and selected by 30 μg/ml ampicillin. Meanwhile, yeast DNA extracts were used as the template for PCR using MATCHMAKER 5′AD and 3′AD LD-insert screening amplimers as primers and subjected to further sequence analysis. To test the specificity of the interaction, isolated library cDNAs were co-transformed into yeast strain AH109 together with a bait plasmid, either pGBKT7/α1D-C-tail, empty vector pGBKT7, or other plasmids as indicated. Transformed yeast were subjected to growth tests on high stringency selective medium. Plasmid Construction—Mouse α-syntrophin in pBluescript II SK(–) was kindly given by Dr. Stanley Froehner (University of Washington, Seattle, WA). α-Syntrophin in pDT mammalian expression plasmid was constructed by cloning an α-syntrophin fragment from pBluescript/α-syntrophin into HindIII/BamHI sites of pDT vector. The N-terminal FLAG-tagged or HA-tagged α1-AR constructs were constructed as previously described (12Pupo A.S. Uberti M.A. Minneman K.P. Eur. J. Pharmacol. 2003; 462: 1-8Crossref PubMed Scopus (44) Google Scholar, 16Vicentic A. Robeva A. Rogge G. Uberti M. Minneman K.P. J. Pharmacol. Exp. Ther. 2002; 302: 58-65Crossref PubMed Scopus (50) Google Scholar). The α1D-AR construct with the PDZ-interacting motif substituted with alanine residues was generated by PCR using the full-length α1D-AR as template and the primers CAACCGCCACCTGCAGACCGTCACCAACTA (forward) and GCCGACTACAGCAACCTAGCAGCAGCAGCTGCTTAAACGCGTGCT (reverse), digested with AgeI and MluI, and ligated with HA-Ntrα1D construct (Δ1–79 truncation) (12Pupo A.S. Uberti M.A. Minneman K.P. Eur. J. Pharmacol. 2003; 462: 1-8Crossref PubMed Scopus (44) Google Scholar) to replace the corresponding normal C-terminal domain. The resultant α1D-AR construct was sequenced to confirm the alanine substitution at the PDZ-interacting motif. The chimeric α1B-AR construct with the α1D-AR C terminus was constructed by the following. A silent mutation forming an EcoRI site (GAATTC) was introduced to the conserved EFK motifs at the α1B-AR (1062G→A) and the α1D-AR construct (1224G→A), respectively. The C-terminal regions of those two mutated constructs were swapped by EcoRI and MluI to generate the C-terminal chimeric receptor constructs. Fusion Protein Construction—To construct GST-tagged receptor C-terminal fusion protein plasmids, β1-C-tail (the C-terminal 100 aa of the human β1-AR (17Xu J. Paquet M. Lau A.G. Wood J.D. Ross C.A. Hall R.A. J. Biol. Chem. 2001; 276: 41310-41317Abstract Full Text Full Text PDF PubMed Scopus (106) Google Scholar)) and α1D-C-tail (the C-terminal 93 aa of the human α1D-AR) were amplified by PCR and then subcloned into pGEX-4T1 using the EcoRI and XhoI sites. To construct hexahistidine-tagged and S protein-tagged PDZ domain fusion protein plasmids, α-Syn-PDZ (mouse α-syntrophin, 79–228 aa) was amplified by PCR and then inserted into pET30a at the BamHI and XhoI sites, whereas β1-Syn-PDZ (mouse β1-syntrophin, 106–252 aa), β2-Syn-PDZ (human β2-syntrophin, 111–265 aa), γ1-Syn-PDZ (mouse γ1-syntrophin, 52–201 aa), and γ2-Syn-PDZ (mouse γ2-syntrophin, 68–215 aa) constructs were prepared by PCR and inserted into pET30a at the EcoRI and XhoI sites. PSD95-PDZ3 (rat PSD 95, 307–446 aa) and membrane-associated guanylate kinase inverted-2 (MAGI2)-PDZ1 (human MAGI2, 446–571 aa) were generated as previously described (17Xu J. Paquet M. Lau A.G. Wood J.D. Ross C.A. Hall R.A. J. Biol. Chem. 2001; 276: 41310-41317Abstract Full Text Full Text PDF PubMed Scopus (106) Google Scholar). Blot Overlay Assays—The interaction between the GST-tagged receptor C-terminal fusion proteins and His6/S-tagged PDZ domain fusion proteins was assayed via blot overlay assays. 2 μg of purified His6-tagged syntrophin PDZ domain fusion proteins were run on a 4–20% Tris-glycine SDS-PAGE gel for 1.5–2 h at 125 V and then transferred to ProTran nitrocellulose. The blot was blocked in Tris-buffered saline containing 0.1% Tween 20 (TBST) consisting of 5% nonfat milk for 1 h at room temperature (RT), subsequently incubated with 25 nm GST-tagged α1D-C-tail fusion proteins containing 2% nonfat milk for at least 1 h at RT, washed 3 times with TBST, incubated at RT with monoclonal anti-GST antibody, washed 3 times with TBST, and then incubated with a HRP-conjugated anti-mouse IgG secondary antibody. After 6 washes with TBST, bands were visualized with ECL. PSD95-PDZ3 and MAGI2-PDZ1 fusion proteins were used as controls. In other experiments 2 μg of purified GST or GST fusion proteins as indicated were run on an SDS-PAGE gel and overlaid with 25 nm His6/S-tagged indicated PDZ domain fusion proteins. Interaction was detected by HRP-conjugated S protein and ECL. Cell Culture and Transfection—HEK293 cells were propagated in Dulbecco's modified Eagle's medium (4.5 g/liter glucose) plus 10% heat-inactivated fetal bovine serum, 100 mg/liter streptomycin, and 105 units/liter penicillin at 37 °C in a humidified atmosphere with 5% CO2. For transient transfection, 8 μg of indicated plasmid DNA was mixed with Lipofectamine2000 and serum-free medium at RT for 20 min and added to HEK293 cells growing in a 150-mm tissue culture plate. Cells were harvested 48–72 h after transfection for further experimentation. For stable transfection cells were selected in the presence of 400–800 μg/ml Geneticin. Membrane Preparation—For radioligand binding, cells grown on 150-mm tissue culture plates were harvested in phosphate-buffered saline (10 mm phosphate buffer, 2.7 mm KCl, 137 mm NaCl, pH 7.4), and membrane preparations were prepared as previously described (18Chen Z. Rogge G. Hague C. Alewood D. Colless B. Lewis R.J. Minneman K.P. J. Biol. Chem. 2004; 279: 35326-35333Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). For immunoprecipitation, cells were collected by centrifugation at 30,000 × g for 20 min, and membrane preparations were prepared as previously described (13Uberti M. Hall R.A. Minneman K.P. Mol. Pharmacol. 2003; 64: 1379-1390Crossref PubMed Scopus (97) Google Scholar). Immunoprecipitation and Immunoblotting—Membrane preparations were solubilized by 2% n-dodecyl-β-d-maltoside, and the supernatant was incubated with either anti-FLAG affinity gel or anti-HA affinity matrix in 0.2% n-dodecyl-β-d-maltoside prepared in 1× buffer (25 mm HEPES, 150 mm NaCl, pH 7.4, 5 mm EDTA) with a protease inhibitor mixture (1 mm benzamidine, 3 μm pepstatin, 3 μm phenylmethylsulfonyl fluoride, 3 μm aprotinin, and 3 μm leupeptin) overnight at 4 °C. An aliquot of 50 μl of supernatant was incubated with 4× Laemmli sample buffer (62.5 mm Tris-HCl, pH 6.8, 20% glycerol, 2% SDS, 0.025% bromphenol blue, and 5% β-mercaptoethanol) to examine expression of proteins in the solubilized fraction. The next day the affinity gel/matrix was collected by centrifugation, washed with 1× buffer 3 times at 4 °C, and eluted with an equal volume of 4× Laemmli sample buffer. Immunoprecipitated samples were run on 4–20% Tris-glycine SDS-PAGE and transferred to nitrocellulose. Membranes were blocked with 5% nonfat dried milk in TBST buffer at RT, incubated with HRP-conjugated anti-FLAG M2 antibody (1:600) or anti-HA-mouse antibody (1:5000) at RT, washed with TBST and detected with ECL or incubated with anti-mouse secondary antibody (1:5000) and then detected with ECL. For overexpression of α-syntrophin with HF-α1D-AR and ΔPDZ-HF-Ntrα1D-AR, immunoprecipitation was done as previously described (19Balasubramanian S. Teissere J.A. Raju D.V. Hall R.A. J. Biol. Chem. 2004; 279: 18840-18850Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar). Radioligand Binding—Receptor density was determined by saturation binding assays as previously described (18Chen Z. Rogge G. Hague C. Alewood D. Colless B. Lewis R.J. Minneman K.P. J. Biol. Chem. 2004; 279: 35326-35333Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). 3H-Labeled Inositol Phosphate (InsP) Formation—Receptor function in transfected HEK293 cells was measured by [3H]inositol phosphate (InsP) formation upon NE stimulation as previously described (18Chen Z. Rogge G. Hague C. Alewood D. Colless B. Lewis R.J. Minneman K.P. J. Biol. Chem. 2004; 279: 35326-35333Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). 10–4 m carbachol was used as a control. Data Analysis—Data were expressed as the mean ± S.E. of results obtained from the indicated number of observations. For saturation binding assays, KD and Bmax were calculated by nonlinear regression using Prism (GraphPad). α-Syntrophin Is a Specific Binding Partner for the α1D-AR C Terminus—To identify novel α1D-AR-associated proteins, a human α1D-AR partial C terminus (α1D-C-tail) was used as bait to screen a human brain pretransformed cDNA library. From a total of 3 × 105-independent diploids screened, 9 positive clones were obtained. One positive clone was identified as a gene fragment of human α-syntrophin (hα-syn). This fragment contained an intact PDZ domain and is displayed in schematic form in Fig. 1. The α1D-AR is known to contain a putative PDZ-interacting motif at the distal end of its C-tail (568RETDI572) that is highly homologous to the conserved PDZ-interacting motif ((K/Q/R)E(S/T)X(V/I)) previously demonstrated to be recognized by syntrophins (20Gee S.H. Madhavan R. Levinson S.R. Caldwell J.H. Sealock R. Froehner S.C. J. Neurosci. 1998; 18: 128-137Crossref PubMed Google Scholar, 21Gee S.H. Quenneville S. Lombardo C.R. Chabot J. Biochemistry. 2000; 39: 14638-14646Crossref PubMed Scopus (39) Google Scholar, 22Wiedemann U. Boisguerin P. Leben R. Leitner D. Krause G. Moelling K. Volkmer-Engert R. Oschkinat H. J. Mol. Biol. 2004; 343: 703-718Crossref PubMed Scopus (124) Google Scholar). The specificity of the interaction between hα-syn and α1D-C-tail was confirmed by further yeast two-hybrid analysis. The hα-syn library construct was co-transformed into yeast strain AH109 with individual baits α1A-, α1B-, or α1D-C-tails. Transformed yeast containing the indicated bait and hα-syn (Fig. 2A) were subjected to growth tests on selective medium. As shown in Fig. 2B, only yeast co-transformed with hα-syn and α1D-C-tail were able to grow on high stringency selective medium. These findings suggest that hα-syn specifically interacts with the C terminus of α1D- but not α1A-or α1B-ARs.FIGURE 2α-Syntrophin specifically interacts with the C terminus of α1D-ARs in yeast. A, yeast strain AH109 co-transformed with the α-syntrophin library clone, and either the indicated receptor C-terminal constructs (α1A, α1B, and α1D) or vector was streaked on a mating medium (SD/–Leu/–Trp). B, yeast streaked on A were restreaked on a high stringency-selective medium (SD/–Leu/–Trp/–His/–Ade).View Large Image Figure ViewerDownload Hi-res image Download (PPT) α1D-AR C-tail GST Fusion Proteins Specifically Associate with Purified Syntrophin Isoforms—Five syntrophin isoforms have been cloned (α, β1, β2, γ1, γ2), each containing a highly homologous PDZ domain (23Piluso G. Mirabella M. Ricci E. Belsito A. Abbondanza C. Servidei S. Puca A.A. Tonali P. Puca G.A. Nigro V. J. Biol. Chem. 2000; 275: 15851-15860Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar). Therefore, to examine the interaction specificity of the α1D-C-tail with different syntrophin isoforms, blot overlay assays were performed using hexahistidine (His6)/S protein-tagged syntrophin PDZ domains and α1D-C-tail GST fusion proteins. The PDZ domain fusion proteins were immobilized on membranes and overlaid with GST-tagged α1D-C-tail fusion proteins. As shown in Fig. 3, GST-α1D-C-tail interacted robustly with α-, β1-, and β2-syntrophins and weakly associated with γ2-syntrophin. The third PDZ domain from PSD95 (PSD95-PDZ3) and the first PDZ domain from MAGI2-PDZ1 were used as negative controls. As expected, the α1D-C-tail did not associate with PSD95-PDZ3 or MAGI2-PDZ1. Next, we performed a reverse blot overlay to confirm our previous findings. GST-tagged α1D-C-tail fusion proteins were immobilized on membranes and overlaid with individual PDZ domain fusion proteins (Fig. 4A). Consistent with our previous experiment, the α1D-C-tail was found to specifically interact with the PDZ domains of the α, β1, and β2 isoforms of syntrophin. In addition, the α1D-C-tail did not associate with PSD95-PDZ3 and MAGI2-PDZ1, whereas consistent with previous reports (17Xu J. Paquet M. Lau A.G. Wood J.D. Ross C.A. Hall R.A. J. Biol. Chem. 2001; 276: 41310-41317Abstract Full Text Full Text PDF PubMed Scopus (106) Google Scholar) that the β1-AR C terminus (β1-C-tail) associated with both of these PDZ domains (Fig. 4B). Therefore, these studies suggest that the α1D-C-tail selectively associates with the α, β1, and β2 isoforms of syntrophin.FIGURE 4Different syntrophin isoforms recognize the α1D-C-tail in blot overlay assays. A, 2 μg of purified GST proteins or GST-tagged α1D-Ctail fusion proteins were run on SDS-PAGE, transferred to nitrocellulose membranes, and overlaid with 25 nm concentrations of the indicated PDZ domain fusion protein. B, 2 μg of purified GST proteins, GST-tagged β1-tail, or α1D-C-tail fusion proteins were run on SDS-PAGE, transferred to nitrocellulose membranes, and overlaid with 25 nm concentrations of the indicated PDZ domains.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Syntrophin Isoforms Co-immunoprecipitate with α1D-ARs in HEK293 Cells—Because the α-syntrophin PDZ domain was found to specifically interact with the α1D-C-tail in yeast (Fig. 2B) and in blot overlay assays (Figs. 3 and 4), we next determined whether full-length α1D-AR and syntrophins might associate in intact cells. HEK293 cells were co-transfected with α-syntrophin and a single N-terminal FLAG-tagged α1-AR subtype. Cells were harvested, and membrane preparations were solubilized and immunoprecipitated using an anti-FLAG affinity matrix. Immunoprecipitation of receptors was resolved on a SDS-PAGE gel, and syntrophins were detected by the pan-specific syntrophin antibody that is able to recognize α, β1, and β2 syntrophins (24Peters M.F. Adams M.E. Froehner S.C. J. Cell Biol. 1997; 138: 81-93Crossref PubMed Scopus (213) Google Scholar). As shown in Fig. 5, untransfected HEK293 cells exhibit endogenous syntrophin immunoreactivity that is somewhat enhanced by α-syntrophin transfection. Syntrophin co-immunoprecipitated with full-length α1D-ARs but not with the other two α1-AR subtypes. These data confirm that α1D-ARs and syntrophins can interact in a cellular context. The α1D-AR Interacts with Syntrophins through Its C-tail in HEK293 Cells—Because the α1D-AR C-tail was shown to interact with α-syntrophin in yeast, we further tested whether the receptor C-tail is the major determinant for this interaction in mammalian cells, utilizing a chimeric α1B-AR with the α1D-AR C-tail (FLAG-α1B/D-ARs). This C-tail chimeric receptor showed similar pharmacological properties and Gαq/11/Ca2+ signaling to the wild type α1B-AR (data not shown). Because HEK293 cells endogenously express syntrophins (Fig. 5, left lane), cells were only transfected with FLAG-α1B-ARs, FLAG-α1D-ARs, and FLAG-α1B/D-ARs. Immunoprecipitation of FLAG-tagged receptors followed by detection for syntrophins showed that syntrophins were associated with α1D-ARs and α1B/D-ARs but not with α1B-ARs (Fig. 6), suggesting that the α1D C-tail plays an important role in its interaction with syntrophins, probably through the PDZ-interacting motif. Mutation of the PDZ-interacting Motif Affects α1D-AR Receptor Expression and Signaling—To determine whether the α1D-AR/syntrophin interaction might be involved in regulating α1D-AR function, the PDZ-interacting motif at the α1D-AR C-tail was substituted with alanine residues (568RETDI572 → 568AAAAA572) to disrupt its interaction with syntrophins, and the function of the receptors without (HA-Ntrα1D) or with the mutated PDZ-interacting motif (ΔPDZ-HA-Ntrα1D) was examined by measuring accumulation of InsPs upon NE stimulation. N-terminal-truncated α1D-ARs (Ntrα1D-AR) were used to ensure sufficient expression, since truncation does not affect receptor pharmacological or signaling properties but dramatically increases functional receptor expression on the cell surface (11Hague C. Chen Z. Pupo A.S. Schulte N. Toews M.L. Minneman K.P. J. Pharmacol. Exp. Ther. 2004; 309: 388-397Crossref PubMed Scopus (63) Google Scholar, 12Pupo A.S. Uberti M.A. Minneman K.P. Eur. J. Pharmacol. 2003; 462: 1-8Crossref PubMed Scopus (44) Google Scholar). In control experiments, HA-Ntrα1D was also found to co-immunoprecipitate with syntrophins when transfected in HEK293 cells (data not shown). As shown in Fig. 7, HEK293 cells stably expressing each receptor construct had similar basal InsP formations. Cells expressing HA-Ntrα1D showed a sequential increase in InsP production with increasing concentrations of NE (10–7 and 10–4 m). However, those cells expressing ΔPDZ-HA-Ntrα1D barely showed any increase over the basal even at 10–4 m NE compared with HA-Ntrα1D. Both cell lines showed similar InsP formation when challenged with 10–4 m carbachol to stimulate endogenously expressed muscarinic cholinergic receptors, suggesting the difference in InsP formation by NE was specific to the transfected receptors. To test whether this dramatic decrease in signaling is caused by a difference in receptor expression, saturation binding assays with the α1-AR specific radioligand 125I-labeled BE were performed (Fig. 8A). The receptor densities were 1916 ± 41 fmol/mg of protein for cells expressing HA-Ntrα1D and 301 ± 29 fmol/mg for those with ΔPDZ-HA-Ntrα1D. Because the heterologously expressed α1D-AR has been found to show a dramatic discrepancy between protein expression level and receptor density, probably due to its intracellular localization (14Hague C. Uberti M.A. Chen Z. Hall R.A. Minneman K.P. J. Biol. Chem. 2004; 279: 15541-15549Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar, 16Vicentic A. Robeva A. Rogge G. Uberti M. Minneman K.P. J. Pharmacol. Exp. Ther. 2002; 302: 58-65Crossref PubMed Scopus (50) Google Scholar), protein expression of those two α1D constructs was examined by immunoprecipitation and Western blotting (Fig. 8B). ΔPDZ-HA-Ntrα1D was expressed at a much lower level (nearly undetectable) compared with HA-Ntrα1D, suggesting that the poor receptor density was caused by impaired protein expression. Overexpression of α-Syntrophin Increases Receptor Protein and Cell Surface Expression—Because our" @default.
• W2141430858 created "2016-06-24" @default.
• W2141430858 creator A5003416046 @default.
• W2141430858 creator A5054874056 @default.
• W2141430858 creator A5064470143 @default.
• W2141430858 creator A5081172086 @default.
• W2141430858 date "2006-05-01" @default.
• W2141430858 modified "2023-10-08" @default.
• W2141430858 title "Syntrophins Regulate α1D-Adrenergic Receptors through a PDZ Domain-mediated Interaction" @default.
• W2141430858 cites W1967001670 @default.
• W2141430858 cites W1977394169 @default.
• W2141430858 cites W1978424595 @default.
• W2141430858 cites W1979715740 @default.
• W2141430858 cites W1985407755 @default.
• W2141430858 cites W1991852042 @default.
• W2141430858 cites W1999453187 @default.
• W2141430858 cites W2000806628 @default.
• W2141430858 cites W2001005561 @default.
• W2141430858 cites W2004387232 @default.
• W2141430858 cites W2014108369 @default.
• W2141430858 cites W2018146224 @default.
• W2141430858 cites W2018302467 @default.
• W2141430858 cites W2023000374 @default.
• W2141430858 cites W2032086808 @default.
• W2141430858 cites W2032260752 @default.
• W2141430858 cites W2051530695 @default.
• W2141430858 cites W2053632669 @default.
• W2141430858 cites W2061413318 @default.
• W2141430858 cites W2067247590 @default.
• W2141430858 cites W2073093324 @default.
• W2141430858 cites W2076639450 @default.
• W2141430858 cites W2087430420 @default.
• W2141430858 cites W2113221012 @default.
• W2141430858 cites W2113545613 @default.
• W2141430858 cites W2135043861 @default.
• W2141430858 cites W2139192607 @default.
• W2141430858 cites W2140246888 @default.
• W2141430858 cites W2141934750 @default.
• W2141430858 cites W2145877186 @default.
• W2141430858 cites W2152508553 @default.
• W2141430858 cites W2152709230 @default.
• W2141430858 cites W2155170415 @default.
• W2141430858 cites W2157032387 @default.
• W2141430858 cites W2162890258 @default.
• W2141430858 cites W2163894338 @default.
• W2141430858 cites W2167618702 @default.
• W2141430858 cites W2167628367 @default.
• W2141430858 cites W2169164259 @default.
• W2141430858 cites W2171691139 @default.
• W2141430858 doi "https://doi.org/10.1074/jbc.m508651200" @default.
• W2141430858 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16533813" @default.
• W2141430858 hasPublicationYear "2006" @default.
• W2141430858 type Work @default.
• W2141430858 sameAs 2141430858 @default.
• W2141430858 citedByCount "48" @default.
• W2141430858 countsByYear W21414308582012 @default.
• W2141430858 countsByYear W21414308582013 @default.
• W2141430858 countsByYear W21414308582014 @default.
• W2141430858 countsByYear W21414308582015 @default.
• W2141430858 countsByYear W21414308582016 @default.
• W2141430858 countsByYear W21414308582018 @default.
• W2141430858 countsByYear W21414308582019 @default.
• W2141430858 countsByYear W21414308582020 @default.
• W2141430858 countsByYear W21414308582021 @default.
• W2141430858 countsByYear W21414308582023 @default.
• W2141430858 crossrefType "journal-article" @default.
• W2141430858 hasAuthorship W2141430858A5003416046 @default.
• W2141430858 hasAuthorship W2141430858A5054874056 @default.
• W2141430858 hasAuthorship W2141430858A5064470143 @default.
• W2141430858 hasAuthorship W2141430858A5081172086 @default.
• W2141430858 hasBestOaLocation W21414308581 @default.
• W2141430858 hasConcept C12554922 @default.
• W2141430858 hasConcept C134306372 @default.
• W2141430858 hasConcept C154428179 @default.
• W2141430858 hasConcept C170493617 @default.
• W2141430858 hasConcept C185592680 @default.
• W2141430858 hasConcept C2778938600 @default.
• W2141430858 hasConcept C3018209156 @default.
• W2141430858 hasConcept C33923547 @default.
• W2141430858 hasConcept C36503486 @default.
• W2141430858 hasConcept C55493867 @default.
• W2141430858 hasConcept C86803240 @default.
• W2141430858 hasConcept C95444343 @default.
• W2141430858 hasConceptScore W2141430858C12554922 @default.
• W2141430858 hasConceptScore W2141430858C134306372 @default.
• W2141430858 hasConceptScore W2141430858C154428179 @default.
• W2141430858 hasConceptScore W2141430858C170493617 @default.
• W2141430858 hasConceptScore W2141430858C185592680 @default.
• W2141430858 hasConceptScore W2141430858C2778938600 @default.
• W2141430858 hasConceptScore W2141430858C3018209156 @default.
• W2141430858 hasConceptScore W2141430858C33923547 @default.
• W2141430858 hasConceptScore W2141430858C36503486 @default.
• W2141430858 hasConceptScore W2141430858C55493867 @default.
• W2141430858 hasConceptScore W2141430858C86803240 @default.
• W2141430858 hasConceptScore W2141430858C95444343 @default.
• W2141430858 hasIssue "18" @default.
• W2141430858 hasLocation W21414308581 @default.
• W2141430858 hasOpenAccess W2141430858 @default.

• next