FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2141867662> ?p ?o ?g. }

• W2141867662 endingPage "41308" @default.
• W2141867662 startingPage "41302" @default.
• W2141867662 abstract "The Bacteroides fragilis capsular polysaccharide complex is the major virulence factor for abscess formation in human hosts. Polysaccharide B of this complex contains a 2-aminoethylphosphonate functional group. This functional group is synthesized in three steps, one of which is catalyzed by phosphonopyruvate decarboxylase. In this paper, we report the cloning and overexpression of the B. fragilis phosphonopyruvate decarboxylase gene (aepY), purification of the phosphonopyruvate decarboxylase recombinant protein, and the extensive characterization of the reaction that it catalyzes. The homotrimeric (41,184-Da subunit) phosphonopyruvate decarboxylase catalyzes (k cat = 10.2 ± 0.3 s–1) the decarboxylation of phosphonopyruvate (Km = 3.2 ± 0.2 μm) to phosphonoacetaldehyde (Ki = 15 ± 2 μm) and carbon dioxide at an optimal pH range of 7.0–7.5. Thiamine pyrophosphate (Km = 13 ± 2 μm) and certain divalent metal ions (Mg(II) Km = 82 ± 8 μm; Mn(II) Km = 13 ± 1 μm; Ca(II) Km = 78 ± 6 μm) serve as cofactors. Phosphonopyruvate decarboxylase is a member of the α-ketodecarboxylase family that includes sulfopyruvate decarboxylase, acetohydroxy acid synthase/acetolactate synthase, benzoylformate decarboxylase, glyoxylate carboligase, indole pyruvate decarboxylase, pyruvate decarboxylase, the acetyl phosphate-producing pyruvate oxidase, and the acetate-producing pyruvate oxidase. The Mg(II) binding residue Asp-260, which is located within the thiamine pyrophosphate binding motif of the α-ketodecarboxylase family, was shown by site-directed mutagenesis to play an important role in catalysis. Pyruvate (k cat = 0.05 s–1, Km = 25 mm) and sulfopyruvate (k cat ∼ 0.05 s–1; Ki = 200 ± 20 μm) are slow substrates for the phosphonopyruvate decarboxylase, indicating that this enzyme is promiscuous. The Bacteroides fragilis capsular polysaccharide complex is the major virulence factor for abscess formation in human hosts. Polysaccharide B of this complex contains a 2-aminoethylphosphonate functional group. This functional group is synthesized in three steps, one of which is catalyzed by phosphonopyruvate decarboxylase. In this paper, we report the cloning and overexpression of the B. fragilis phosphonopyruvate decarboxylase gene (aepY), purification of the phosphonopyruvate decarboxylase recombinant protein, and the extensive characterization of the reaction that it catalyzes. The homotrimeric (41,184-Da subunit) phosphonopyruvate decarboxylase catalyzes (k cat = 10.2 ± 0.3 s–1) the decarboxylation of phosphonopyruvate (Km = 3.2 ± 0.2 μm) to phosphonoacetaldehyde (Ki = 15 ± 2 μm) and carbon dioxide at an optimal pH range of 7.0–7.5. Thiamine pyrophosphate (Km = 13 ± 2 μm) and certain divalent metal ions (Mg(II) Km = 82 ± 8 μm; Mn(II) Km = 13 ± 1 μm; Ca(II) Km = 78 ± 6 μm) serve as cofactors. Phosphonopyruvate decarboxylase is a member of the α-ketodecarboxylase family that includes sulfopyruvate decarboxylase, acetohydroxy acid synthase/acetolactate synthase, benzoylformate decarboxylase, glyoxylate carboligase, indole pyruvate decarboxylase, pyruvate decarboxylase, the acetyl phosphate-producing pyruvate oxidase, and the acetate-producing pyruvate oxidase. The Mg(II) binding residue Asp-260, which is located within the thiamine pyrophosphate binding motif of the α-ketodecarboxylase family, was shown by site-directed mutagenesis to play an important role in catalysis. Pyruvate (k cat = 0.05 s–1, Km = 25 mm) and sulfopyruvate (k cat ∼ 0.05 s–1; Ki = 200 ± 20 μm) are slow substrates for the phosphonopyruvate decarboxylase, indicating that this enzyme is promiscuous. Bacteroides fragilis is a human pathogen that causes intraabdominal abscess formation in its host (1Baumann H. Tzianabos A.O. Brisson J.R. Kasper D.L. Jennings H.J. Biochemistry. 1992; 31: 4081-4089Crossref PubMed Scopus (166) Google Scholar, 2Tzianabos A.O. Chandraker A. Kalka-Moll W. Stingele F. Dong V.M. Finberg R.W. Peach R. Sayegh M.H. Infect. Immun. 2000; 68: 6650-6655Crossref PubMed Scopus (43) Google Scholar). The bacterial capsular polysaccharide complex is the major virulence factor for abscess formation. The capsular polysaccharide complex is composed of three distinct polysaccharides, polysaccharides A, B, and C (3Tzianabos A.O. Pantosti A. Baumann H. Brisson J.R. Jennings H.J. Kasper D.L. J. Biol. Chem. 1992; 267: 18230-18235Abstract Full Text PDF PubMed Google Scholar, 4Tzianabos A.O. Onderdonk A.B. Rosner B. Cisneros R.L. Kasper D.L. Science. 1993; 262: 416-419Crossref PubMed Scopus (214) Google Scholar, 5Kalka-Moll W.M. Wang Y. Comstock L.E. Gonzalez S.E. Tzianabos A.O. Kasper D.L. Infect. Immun. 2001; 69: 2339-2344Crossref PubMed Scopus (24) Google Scholar, 6Wang Y. Kalka-Moll W.M. Roehrl M.H. Kasper D.L. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 13478-13483Crossref PubMed Scopus (63) Google Scholar). These polysaccharides consist of repeating units that contain a zwitterionic motif of negative and positive charged groups. The zwitterionic charge motif plays an essential role in the induction of the host defense response, which leads to abscess formation. The 2-aminoethylphosphonate (AEP) 1The abbreviations used are: AEP, 2-aminoethylphosphonate; P-enolpyruvate, phosphoenolpyruvate; Ppyr, phosphonopyruvate; TPP, thiamine pyrophosphate; TAPS, N-tris(hydroxymethyl)methyl-3-aminopropanesulfonic acid; Pald, phosphonoacetaldehyde; MES, 4-morpholineethanesulfonic acid.1The abbreviations used are: AEP, 2-aminoethylphosphonate; P-enolpyruvate, phosphoenolpyruvate; Ppyr, phosphonopyruvate; TPP, thiamine pyrophosphate; TAPS, N-tris(hydroxymethyl)methyl-3-aminopropanesulfonic acid; Pald, phosphonoacetaldehyde; MES, 4-morpholineethanesulfonic acid. unit of polysaccharide B contributes the positive and negative charges that form the zwitterionic motif (see Fig. 1). AEP is the phosphonate counterpart to phosphoethanol amine, a common lipid polar head-group. The P-C bond of AEP is resistant to both chemical and enzymatic hydrolysis. The AEP unit is found in proteins (7Heise N. Raper J. Buxbaum L.U. Peranovich T.M. de Almeida M.L. J. Biol. Chem. 1996; 271: 16877-16887Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar), lipids (8Shin J.E. Ackloo S. Mainkar A.S. Monteiro M.A. Pang H. Penner J.L. Aspinall G.O. Carbohydr. Res. 1997; 305: 223-232Crossref PubMed Scopus (46) Google Scholar, 9Kennedy K.E. Thompson Jr., G.A. Science. 1970; 168: 989-991Crossref PubMed Scopus (64) Google Scholar, 10Steiner S. Conti S.F. Lester R.L. J. Bacteriol. 1973; 116: 1199-1211Crossref PubMed Google Scholar, 11Wassef M.K. Hendrix J.W. Biochim. Biophys. Acta. 1976; 486: 172-178Crossref PubMed Scopus (24) Google Scholar, 12Serrano A.A. Schenkman S. Yoshida N. Mehlert A. Richardson J.M. Ferguson M.A. J. Biol. Chem. 1995; 270: 27244-27253Abstract Full Text Full Text PDF PubMed Scopus (177) Google Scholar), and polysaccharides (4Tzianabos A.O. Onderdonk A.B. Rosner B. Cisneros R.L. Kasper D.L. Science. 1993; 262: 416-419Crossref PubMed Scopus (214) Google Scholar) located at the cell surfaces in certain parasitic organisms. These AEP conjugates either participate in host infection, as in the case of the B. fragilis polysaccharide B, or they are responsible for the persistence of the parasite within the host. The presence of AEP in the B. fragilis polysaccharide B was first demonstrated by NMR structural analysis (3Tzianabos A.O. Pantosti A. Baumann H. Brisson J.R. Jennings H.J. Kasper D.L. J. Biol. Chem. 1992; 267: 18230-18235Abstract Full Text PDF PubMed Google Scholar). More recently, the polysaccharide B biosynthetic pathway gene locus was sequenced (13Coyne M.J. Kalka-Moll W. Tzianabos A.O. Kasper D.L. Comstock L.E. Infect. Immun. 2000; 68: 6176-6181Crossref PubMed Scopus (43) Google Scholar). Three genes, aepX, aepY, and aepZ, which encode proteins that share significant sequence identity with the three enzymes of the AEP biosynthetic pathway, are included within this locus (Fig. 2). To our knowledge, this is the first known example of the AEP biosynthetic pathway gene cluster in a bacterium. Moreover, the opportunity now exists for the isolation of the three pathway enzymes for mechanistic study and inhibitor design. Because the AEP pathway enzymes are not present in humans, they are excellent candidates for drug targeting. What is presently known about the AEP biosynthetic pathway and the three enzymes that catalyze it has resulted from a “patch-work” effort. The AEP biosynthetic pathway was first discovered in Tetrahymena pyriformis (14Barry R.J. Bowman E. McQueney M. Dunaway-Mariano D. Biochem. Biophys. Res. Commun. 1988; 153: 177-182Crossref PubMed Scopus (22) Google Scholar, 15Liang C.R. Rosenberg H. Biochim. Biophys. Acta. 1968; 156: 437-439Crossref PubMed Scopus (28) Google Scholar, 16Warren W.A. Biochim. Biophys. Acta. 1968; 156: 340-346Crossref PubMed Scopus (51) Google Scholar, 17Deleted in proofGoogle Scholar). In this organism, AEP is incorporated into phosphonolipids, which form the plasma membrane. The AEP pathway was shown to consist of the three steps depicted in Fig. 3. In the first step of the reaction, P-enolpyruvate is converted to phosphonopyruvate (Ppyr). P-enolpyruvate mutase, the enzyme that catalyzes this step, has been isolated from several different organisms and characterized (18Kim A. Kim J. Martin B.M. Dunaway-Mariano D. J. Biol. Chem. 1998; 273: 4443-4448Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar, 19Jia Y. Lu Z. Huang K. Herzberg O. Dunaway-Mariano D. Biochemistry. 1999; 38: 14165-14173Crossref PubMed Scopus (29) Google Scholar, 20Liu S. Lu Z. Jia Y. Dunaway-Mariano D. Herzberg O. Biochemistry. 2002; 41: 10270-10276Crossref PubMed Scopus (29) Google Scholar). The conversion of P-enolpyruvate to Ppyr is thermodynamically unfavorable (K eq ∼ 1 × 10–3), and thus, the ensuing decarboxylation step catalyzed by Ppyr decarboxylase is required to drive the Ppyr-forming reaction forward. The T. pyriformis Ppyr decarboxylase is membranebound and difficult to isolate for characterization (21Kim J.B. Investigations of 2-Aminoethylphosphonate Biosynthetic Enzymes in Tetrahymena Pyriformis. Ph.D. thesis, University of Maryland, College Park, MD1994Google Scholar). What we do know about this enzyme derives from the study of the bacterial enzyme which functions in biosynthetic pathways leading to bialaphos, fosfomycin, and phosphinothricin tripeptide in Streptomyces hygroscopicus (22Nakashita H. Kozuka K. Hidaka T. Hara O. Seto H. Biochim. Biophys. Acta. 2000; 1490: 159-162Crossref PubMed Scopus (18) Google Scholar), Streptomyces wendmorensis (23Thompson C.J. Seto H. Biotechnology. 1995; 28: 197-222PubMed Google Scholar, 24Seto H. Kuzuyama T. Nat. Prod. Rep. 1999; 16: 589-596Crossref PubMed Scopus (229) Google Scholar), and Streptomyces viridomogenes (25Schwartz D. Recktenwald J. Pelzer S. Wohlleben W. FEMS Microbiol. Lett. 1998; 163: 149-157PubMed Google Scholar), respectively. In these pathways, P-enolpyruvate mutase and Ppyr decarboxylase collaborate to form the common precursor phosphonoacetaldehyde (Pald). The S. hygroscopis Ppyr decarboxylase has been isolated and its native size and its cofactor requirement (viz. thiamine pyrophosphate and Mg(II)) have been defined (26Nakashita H. Watanabe K. Hara O. Hidaka T. Seto H. J. Antibiot. (Tokyo). 1997; 50: 212-219Crossref Scopus (32) Google Scholar). As with the Ppyr decarboxylase of Tetrahymena pyriformis, the third enzyme of the pathway, Pald transaminase proved to be membrane-bound and difficult to isolate. Using partially purified enzyme, Kim (21Kim J.B. Investigations of 2-Aminoethylphosphonate Biosynthetic Enzymes in Tetrahymena Pyriformis. Ph.D. thesis, University of Maryland, College Park, MD1994Google Scholar) was able to demonstrate catalysis of pyridoxal phosphate-dependent transamination of Pald with l-alanine functioning as the ammonium group donor. A related transaminase can be found in bacteria adapted for the use of AEP as an alternate source of carbon, nitrogen, and phosphorous. Because the physiological reaction is catalyzed in the direction of Pald formation, this enzyme has become known as AEP transaminase (27Cassaigne A. Lacoste A.M. Neuzil E. C. R. Hebd. Seances Acad. Sci. Ser. D Sci. Nat. 1976; 282: 1637-1639PubMed Google Scholar, 28Jiang W. Metcalf W.W. Lee K.S. Wanner B.L. J. Bacteriol. 1995; 177: 6411-6421Crossref PubMed Google Scholar, 29Parker G.F. Higgins T.P. Hawkes T. Robson R.L. J. Bacteriol. 1999; 181: 389-395Crossref PubMed Google Scholar, 30Ternan N.G. Quinn J.P. Syst. Appl. Microbiol. 1998; 21: 346-352Crossref PubMed Scopus (41) Google Scholar, 31La Nauze J.M. Rosenberg H. Shaw D.C. Biochim. Biophys. Acta. 1970; 212: 332-350Crossref PubMed Scopus (96) Google Scholar). It, too, is dependent on pyridoxal phosphate; however, the ammonium group acceptor is not pyruvate but rather l-glutamate (32Kim A.D. Baker A.S. Dunaway-Mariano D. Metcalf W.W. Wanner B.L. Martin B.M. J. Bacteriol. 2002; 184: 4134-4140Crossref PubMed Scopus (43) Google Scholar). Nevertheless, the bacterial AEP transaminase shares sufficient sequence identity with the B. fragilis Pald transaminase to indicate that the two enzymes share common ancestry. The AEP pathway enzymes of B. fragilis have not been isolated for characterization. Our goal was to express the B. fragilis AEP pathway genes in Escherichia coli for purification and study of the three pathway enzymes. In this paper, we report the cloning and overexpression of the B. fragilis Ppyr decarboxylase gene (aepY), purification of the protein, and for the first time, an in-depth study of the Ppyr decarboxylase. Materials—Thiamine pyrophosphate chloride (TPP), dihydro-β-nicotinamide adenine dinucleotide (β-NADH), yeast alcohol dehydrogenase, and the buffers used in protein purification and kinetic assays were purchased from Sigma and used without further purification. Phosphonopyruvate and sulfopyruvate were synthesized according to the published methods (33Anderson V.E. Weiss P.M. Cleland W.W. Biochemistry. 1984; 23: 2779-2786Crossref PubMed Scopus (90) Google Scholar, 34White R.H. Biochemistry. 1986; 25: 5304-5308Crossref Scopus (31) Google Scholar). Recombinant Bacillus cereus phosphonoacetaldehyde hydrolase was purified as described previously (35Baker A.S. Ciocci M.J. Metcalf W.W. Kim J. Babbitt P.C. Wanner B.L. Martin B.M. Dunaway-Mariano D. Biochemistry. 1998; 37: 9305-9315Crossref PubMed Scopus (65) Google Scholar). B. fragilis genomic DNA was purchased from American Type Culture Collection (ATCC 25285D). The primers used in PCR-based DNA amplification were custom synthesized at Invitrogen. For the cloning of the phosphonopyruvate decarboxylase gene, the sequence of the 5′ to 3′ primer was ATTCAGACGCATATGGTAAGTGTA and that of the 3′ to 5′ primer was TCTTTCTTTGGATCCTCATGAATGCGT, with the introduced restriction sites underlined. The enzymes used in DNA manipulation were purchased from Invitrogen and used with the buffers provided. PCR-based Cloning of Phosphonopyruvate Decarboxylase Gene—The genomic DNA template was denatured (30 min at 94 °C) before adding Pfu DNA polymerase. The target gene was amplified by 20 cycles of 94 °C denaturation for 1 min, 55 °C annealing for 50 s, and 73 °C elongation for 3.5 min. The PCR product was purified by electrophoresis and digested using NdeI and BamHI restriction enzymes. The digest was ligated to an NdeI- and BamHI-cut pET 3a vector. The resulting clone, named bf-Pyrdecarb-pET 3a, was used to transform E. coli BL21(DE3) competent cells. The gene sequence was verified by DNA sequencing carried at the Center for Genetics in Medicine, University of New Mexico School of Medicine, Albuquerque, NM. Protein Purification—E. coli BL21(DE3) cells, transformed with the named bf-Pyrcarb-pET 3a clone, were grown to 1 A 600 nm at 22 °C in 1.2 liters × 4-LB media containing 100 μg/ml ampicillin. Following an 8-h induction period with 0.2 mm isopropyl-β-d-thiogalactopyranoside, the cells were harvested by centrifugation at 6500 rpm, 4 °C (all purification steps were carried out at 4 °C except where noted). The cell pellet was suspended in 100 ml of 50 mm K+HEPES containing 5 mm MgCl2 and1mm dithiothreitol, pH 7.5 (referred to as buffer A, hereafter). Cells were lysed at 1000 p.s.i. in a French pressure cell and then centrifuged at 20,000 rpm for 30 min. The supernatant was subjected to ammonium sulfate precipitation. The 40–85% fraction was collected by centrifugation and dissolved in buffer A for overnight dialysis against buffer A. The dialysate was chromatographed on a DEAE-Sepharose column (3.0 × 60 cm) (equilibrated with buffer A) using a 1.4-liter linear gradient of KCl (0.15–0.60 m) in buffer A as eluant. The Ppyr decarboxylase-containing fractions (eluted at ∼0.35–0.40 m KCl) were identified using the spectrophotometric activity assay (described in the following section) and analyzed by SDS-PAGE. The desired Ppyr decarboxylase-containing fractions were combined and chromatographed on a hydroxylapatite column (3.0 × 40 cm) equilibrated with buffer A, using a 1.4-liter linear gradient of phosphate (0–0.25 m) in buffer A as eluant. Column fractions containing the Ppyr decarboxylase (eluted at ∼0.08–0.12 m phosphate) in >95% purity (as judged by SDS-PAGE analysis) were combined and concentrated in 50 mm K+HEPES buffer containing 5mm MgCl2,1mm MnCl2,and1mm dithiothreitol, pH 7.5 (buffer B) for storage at –80 °C. Yield: 3.7 mg/g wet cell (or 22 mg of cell culture/liter). Site-directed Mutants—The site-directed mutants E213A, D258A, and D260A were prepared by PCR and commercial primers using the clone bf-Pyrdecarb-pET 3a as a template. The PCR product was purified by electrophoresis and digested using NdeI and BamHI restriction enzymes. The digest was ligated to an NdeI- and BamHI-cut pET 3a vector and then used to transform competent E. coli BL21(DE3) cells. The gene sequence was verified by DNA sequencing carried out at the Center for Genetics in Medicine, University of New Mexico School of Medicine. The mutant proteins were prepared in the same manner as the wild-type Ppyr decarboxylase. The yield of the homogenous mutant proteins (as judged by SDS-PAGE analysis) are: 4 mg/g wet cell (or 20 mg of cell culture/liter) E213A, 5 mg/g wet cell (or 25 mg of cell culture/liter) D258A, and 3.5 mg/g wet cell (or 16 mg of cell culture/liter) D260A. Ppyr Decarboxylase Molecular Size Determination—The molecular mass was calculated from the amino acid composition, derived from the gene sequence, by using the EXPASY Molecular Biology Server program Compute pI/MW (36Appel R.D. Bairoch A. Hochstrasser D.F. Trends Biochem. Sci. 1994; 19: 258-260Abstract Full Text PDF PubMed Scopus (512) Google Scholar). The molecular mass was measured by mass spectrometry (Biopolymer Mass Spectrometry Core Facility, Weill Medical College of Cornell University) and by SDS-PAGE (4% stacking gel and 12% separating gel). Commercial protein molecular weight standards were used to generate a plot of log M r versus distance traveled on the gel. The size of native Ppyr decarboxylase was estimated by gel filtration column chromatography (1.6 × 60 cm, Amersham Biosciences Biotech Superdex 200-column, eluted at 4 °C with 25 mm K+HEPES, 0.15 M KCl, pH 7.5). Commercial protein molecular weight standards were used to generate a plot of log M r versus elution volume from the column. Metal Ion Activation—The metal ion-free protein (3 mg/ml) was prepared by exhaustive dialysis against 50 mm K+HEPES (pH 7.5, 4 °C) containing 1 mm dithiothreitol and 20 mm EDTA. The dialyzed protein was then concentrated to 10 mg/ml for kinetic study. The 1-ml reaction mixture contained 50 mm K+HEPES (pH 7.3, 25 °C), 50 μm Ppyr, 0.15 mm NADH, 1.5 mm TPP, 1 μm wild-type phosphonoacetaldehyde hydrolase, 10 units of alcohol dehydrogenase, 0.02 μm metal-free Ppyr decarboxylase, and various concentrations of metal ions. The reactions were monitored at 340 nm (Δϵ = 6,200 m–1 cm–1). The initial velocity data were fitted to Equation 1 to obtain the dissociation constant (Km) for the enzyme-metal ion complex, V0=Vmax[S]/(Km+[S])(Eq. 1) where [S] is the metal ion concentration, V 0 is the initial velocity, V max is the maximum velocity, and Km is the Michaelis-Menten constant (or in this case the Kd). Thiamine Pyrophosphate Activation—The 1-ml reaction mixture contained 50 mm K+HEPES (pH 7.3, 25 °C), 50 μm Ppyr, 0.15 mm NADH, 5 mm MgCl2, 1 mm MnCl2, 1 μm wild-type phosphonoacetaldehyde hydrolase, 10 units of alcohol dehydrogenase, 0.02 μm of dialyzed Ppyr decarboxylase (prepared as described above), and various concentrations of TPP. The reactions were monitored at 340 nm (Δϵ = 6,200 m–1 cm–1). The initial velocity data were fitted to Equation 1 to obtain the dissociation constant for the TPP-enzyme complex. Steady-state Kinetic Constant Determination—The Km and k cat values for wild-type and mutant Ppyr decarboxylase catalysis were determined from the initial velocity data measured as a function of phosphonopyruvate concentration. The 1 ml of reaction solution contained varying concentrations of phosphonopyruvate (0.5–10 Km),5mm MgCl2, 1 mm MnCl2, 0.15 mm NADH, 1.5 mm TPP, 1 μm wild-type phosphonoacetaldehyde hydrolase, and 10 units of alcohol dehydrogenase in 50 mm K+HEPES (pH 7.3, 25 °C). Reactions were monitored at 340 nm. The initial velocity data were analyzed using Equation 1, wherein [S] is the phosphonopyruvate concentration. The k cat was calculated from V max and the enzyme concentration using the equation k cat = V max/[E]. The enzyme concentration was determined using the Bradford method (37Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (215608) Google Scholar). pH-Rate Profile Determination—The initial velocity data were measured as a function of the reaction pH by using the following buffers at the indicated pH values: 50 mm MES (pH 6.0–6.8), 50 mm HEPES (pH 6.8–8.0), and 50 mm TAPS (pH 8.0–8.7). Each buffer solution contained 5 mm MgCl2 and 1 mm MnCl2 at a total chloride concentration of 75 mm (adjusted with 2 m KCl). At pH values where the reaction buffers were switched, the kinetic measurement was made with each of the two buffers to test for a possible buffer effect on the reaction rate. The k cat and k cat/Km values were determined as described in the previous section and fitted to Equation 2 using the computer program KaleidaGraph, logY=log(C/(1+[H]/Ka+Kb/[H]))(Eq. 2) where Y is k cat or k cat/Km , [H] is the hydrogen ion concentration, C is the k cat or k cat/Km value where it does not change with pH. Ka is the acid dissociation constant, and Kb is the base dissociation constant. Screening of Alternative Substrates and Inhibitors—Substrate activity was observed with pyruvate and sulfopyruvate. The pyruvate reaction was monitored at 340 nm (Δϵ = 6,200 m–1 cm–1) by using the alcohol dehydrogenase/NADH coupling system. The 1 ml of reaction mixture contained 50 mm K+HEPES (pH 7.3, 25 °C), 5 mm MgCl2,1mm MnCl2, 0.15 mm NADH, 1.5 mm TPP, 1.8 μm Ppyr decarboxylase, 10 units of alcohol dehydrogenase, and various concentrations of pyruvate (3–50 mm). The initial velocity data were analyzed using Equation 1. The sulfopyruvate reaction was monitored by 1H NMR. Sulfopyruvate (1 mm) was incubated for 1.5 h in 1 ml of D2O containing 0.5 μm Ppyr decarboxylase, 1 mm MgCl2, 0.4 mm TPP, and 10 mm K+HEPES (pD 7.6, 25 °C) before recording the NMR spectrum. 1H NMR spectra were measured with a Bruker Advance 500-MHz NMR spectrometer using D2O as the solvent and at a probe temperature of 24–26 °C. The chemical shift data are reported with respect to the external reference (trimethysilyl)-propanesulfonic acid for 1H NMR. Control reactions were carried out under the same conditions, except that Ppyr decarboxylase was omitted. Pald Inhibition of Ppyr Decarboxylase Catalyzed Decarboxylation of Pyruvate—The 1-ml reaction mixtures contained 50 mm K+HEPES, 5 mm MgCl2, 1 mm MnCl2, 10 mm pyruvate, 10 units of alcohol dehydrogenase, 0.15 mm NADH, 1.5 mm TPP, 1.8 μm decarboxylase, and various concentrations of Pald (0–300 μm). Initial velocities were measured at 340 nm and analyzed using Dixon Equation 3 for a competitive inhibition pattern, 1v=KmVmax[S]Ki[I]+1Vmax1+Km[S](Eq. 3) where v is the initial velocity, V max is the maximum velocity, [S] is the substrate concentration (here it is 10 mm pyruvate), Km is the Michaelis-Menten constant of pyruvate, [I] is the inhibitor concentration and Ki is the inhibition constant. Protein Purification and Size Determination—The DNA sequence of the cloned gene agreed with the published sequence (GenBank™ accession number AF285774_6). The recombinant Ppyr decarboxylase was purified to homogeneity (see Fig. 4) by using the 4-step protocol summarized in Table I in an overall yield of 3.7 mg/g wet cells. The steady-state kinetic constants for catalyzed decarboxylation of phosphonopyruvate are:k cat = 10.2 ± 0.3 s–1; Km = 3.2 ± 0.2 μm; and k cat/Km = 3.2 × 106 s–1m–1, as determined at 25 °C under optimal reaction conditions (viz. pH 7.3, 5 mm MgCl2, 1 mm MnCl2, 200 μm TPP).Table IExperimental protocal for purification of B. fragilis Ppyr decarboxylase from E. coli BL21 (DE3) cells, transformed with the bf-Pyrcarb-pET 3a clonePurification stepsTotal proteinTotal activitySpecific activityActivity recoveryPurificationgunits aOne activity unit is defined as the amount of enzyme required to produce 1 μmol of Pald/min in 50 mm K+HEPES, pH 7.3, 5 mm MgCl2 and 1.5 mm TPP at 25 °C.units/mg%activity-foldExtract from 30 g of wet cells1062000.62100Ammonium sulfate (40-85%)235001.8603DEAE-Sepharose0.20220010.53517Hydroxylapatite0.11134412.12020a One activity unit is defined as the amount of enzyme required to produce 1 μmol of Pald/min in 50 mm K+HEPES, pH 7.3, 5 mm MgCl2 and 1.5 mm TPP at 25 °C. Open table in a new tab The theoretical molecular weight of the phosphonopyruvate decarboxylase calculated from the amino acid sequence was 41,184, which agrees with the experimental molecular weight of 41,199, measured by matrix-assisted laser desorption ionization time-of-flight mass spectrometry. The subunit size estimated by SDS-PAGE analysis was 40 kDa compared with the native protein size of 120 kDa determined by gel filtration chromatography. Thus, the quaternary structure of Ppyr decarboxylase appears to be homotrimeric. (The S. hygroscopicus native Ppyr decarboxylase molecular size was reported as 135 kDa (26Nakashita H. Watanabe K. Hara O. Hidaka T. Seto H. J. Antibiot. (Tokyo). 1997; 50: 212-219Crossref Scopus (32) Google Scholar)). Sequence Homologs—At the time of this writing, there are a total of seven Ppyr decarboxylase sequences listed in the Protein Data Bank. The Ppyr decarboxylase-encoding genes in B. fragilis (NCBI protein data bank ID code AAG26466) (378 amino acids), Bacteroides thetaiotaomicron (NCBI protein data bank ID code NP_810632) (374 amino acids), Amycolatopsis orientalis (NCBI protein data bank ID code CAB45023) (371 amino acids), and Clostridium tetani E88 (NCBI protein data bank ID code NP_782297) (376 amino acids) are positioned between the genes encoding homologs of P-enolpyruvate mutase and AEP transaminase. Pairwise sequence alignments made with the B. fragilis Ppyr decarboxylase (which activity has been demonstrated in this work) demonstrated 76, 35, and 43% sequence identity, respectively. The other three Ppyr decarboxylases (401, 384, and 397 amino acids long, respectively) function in the bialaphos, fosfomycin, and phosphinothricin tripeptide biosynthetic pathways of S. hygroscopicus (22Nakashita H. Kozuka K. Hidaka T. Hara O. Seto H. Biochim. Biophys. Acta. 2000; 1490: 159-162Crossref PubMed Scopus (18) Google Scholar), S. wendmorensis (23Thompson C.J. Seto H. Biotechnology. 1995; 28: 197-222PubMed Google Scholar, 24Seto H. Kuzuyama T. Nat. Prod. Rep. 1999; 16: 589-596Crossref PubMed Scopus (229) Google Scholar) and S. viridomogenes (25Schwartz D. Recktenwald J. Pelzer S. Wohlleben W. FEMS Microbiol. Lett. 1998; 163: 149-157PubMed Google Scholar), respectively. A pairwise sequence alignment of these three Ppyr decarboxylases with the Ppyr decarboxylase from B. fragilis identified 34, 50, and 32% sequence identities, respectively. A ClustalW-based sequence alignment of the seven Ppyr decarboxylase sequences identified 61 stringently conserved residues (16%). A total of 26 of the 61 stringently conserved residues are polar and, thus, are potential candidates for catalytic residues and for substrate- or cofactor-binding residues. The B. fragilis Ppyr decarboxylase sequence was used as the query in a BLAST (Basic Local Alignment Search Tool) search of the gene data bank for protein homologs. The sulfopyruvate decarboxylase of the coenzyme M pathway, found in methane-forming bacteria (38DiMarco A.A. Bobik T.A. Wolfe R.S. Annu. Rev. Biochem. 1990; 59: 355-394Crossref PubMed Scopus (332) Google Scholar), was identified as the closest homolog. Studies of the sulfopyruvate decarboxylase from Methanococcus jannaschii (39Graupner M. Xu H. White R.H. J. Bacteriol. 2000; 182: 4862-4867Crossref PubMed Scopus (43) Google Scholar) have shown that the native enzyme is a dodecamer of 6 α-subunits (ComD 169 amino acids long; 34% sequence identity with the N-terminal half of the Ppyr decarboxylase) and 6 β-subunits (ComE 169 amino acids long; 39% sequence identity with the C-terminal half of Ppyr decarboxylase). It may be inferred that the α- and β-subunits of the sulfopyruvate decarboxylase correspond to N-terminal and C-terminal domains of the Ppyr decarboxylase. Sulfopyruvate decarboxylase (39Graupner M. Xu H. White R.H. J. Bacteriol. 2000; 182: 4862-4867Crossref PubMed Scopus (43) Google Scholar) and Ppyr decarboxylase are more distant members of a family of TPP- and Mg(II)-dependent decarboxylases that includes acetohydroxy acid synthase/acetolactate synthase (40Chipm" @default.
• W2141867662 created "2016-06-24" @default.
• W2141867662 creator A5025324044 @default.
• W2141867662 creator A5043323040 @default.
• W2141867662 creator A5045816528 @default.
• W2141867662 creator A5077348861 @default.
• W2141867662 date "2003-10-01" @default.
• W2141867662 modified "2023-10-10" @default.
• W2141867662 title "The Phosphonopyruvate Decarboxylase from Bacteroides fragilis" @default.
• W2141867662 cites W1566203300 @default.
• W2141867662 cites W1923213745 @default.
• W2141867662 cites W1945567478 @default.
• W2141867662 cites W1963881701 @default.
• W2141867662 cites W1968428725 @default.
• W2141867662 cites W1971383548 @default.
• W2141867662 cites W1975339743 @default.
• W2141867662 cites W1976227897 @default.
• W2141867662 cites W1986225499 @default.
• W2141867662 cites W1987267808 @default.
• W2141867662 cites W1996726147 @default.
• W2141867662 cites W1998995307 @default.
• W2141867662 cites W2003130713 @default.
• W2141867662 cites W2014981059 @default.
• W2141867662 cites W2025265597 @default.
• W2141867662 cites W2034371095 @default.
• W2141867662 cites W2043917844 @default.
• W2141867662 cites W2045362308 @default.
• W2141867662 cites W2049570106 @default.
• W2141867662 cites W2054146826 @default.
• W2141867662 cites W2058522525 @default.
• W2141867662 cites W2060600925 @default.
• W2141867662 cites W2063113999 @default.
• W2141867662 cites W2074147919 @default.
• W2141867662 cites W2074493971 @default.
• W2141867662 cites W2079167532 @default.
• W2141867662 cites W2081559244 @default.
• W2141867662 cites W2082270688 @default.
• W2141867662 cites W2104426142 @default.
• W2141867662 cites W2105496349 @default.
• W2141867662 cites W2109064484 @default.
• W2141867662 cites W2118567098 @default.
• W2141867662 cites W2119524661 @default.
• W2141867662 cites W2125576777 @default.
• W2141867662 cites W2125678029 @default.
• W2141867662 cites W2132886727 @default.
• W2141867662 cites W2144947266 @default.
• W2141867662 cites W2149384232 @default.
• W2141867662 cites W2149845703 @default.
• W2141867662 cites W2153010156 @default.
• W2141867662 cites W2153490339 @default.
• W2141867662 cites W2156685063 @default.
• W2141867662 cites W2158730144 @default.
• W2141867662 cites W2160885179 @default.
• W2141867662 cites W2178358345 @default.
• W2141867662 cites W4293247451 @default.
• W2141867662 doi "https://doi.org/10.1074/jbc.m305976200" @default.
• W2141867662 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12904299" @default.
• W2141867662 hasPublicationYear "2003" @default.
• W2141867662 type Work @default.
• W2141867662 sameAs 2141867662 @default.
• W2141867662 citedByCount "43" @default.
• W2141867662 countsByYear W21418676622012 @default.
• W2141867662 countsByYear W21418676622013 @default.
• W2141867662 countsByYear W21418676622014 @default.
• W2141867662 countsByYear W21418676622015 @default.
• W2141867662 countsByYear W21418676622016 @default.
• W2141867662 countsByYear W21418676622017 @default.
• W2141867662 countsByYear W21418676622018 @default.
• W2141867662 countsByYear W21418676622019 @default.
• W2141867662 countsByYear W21418676622020 @default.
• W2141867662 countsByYear W21418676622021 @default.
• W2141867662 countsByYear W21418676622022 @default.
• W2141867662 countsByYear W21418676622023 @default.
• W2141867662 crossrefType "journal-article" @default.
• W2141867662 hasAuthorship W2141867662A5025324044 @default.
• W2141867662 hasAuthorship W2141867662A5043323040 @default.
• W2141867662 hasAuthorship W2141867662A5045816528 @default.
• W2141867662 hasAuthorship W2141867662A5077348861 @default.
• W2141867662 hasBestOaLocation W21418676621 @default.
• W2141867662 hasConcept C181199279 @default.
• W2141867662 hasConcept C185592680 @default.
• W2141867662 hasConcept C2780246119 @default.
• W2141867662 hasConcept C2780627266 @default.
• W2141867662 hasConcept C501593827 @default.
• W2141867662 hasConcept C55493867 @default.
• W2141867662 hasConcept C86803240 @default.
• W2141867662 hasConcept C89423630 @default.
• W2141867662 hasConceptScore W2141867662C181199279 @default.
• W2141867662 hasConceptScore W2141867662C185592680 @default.
• W2141867662 hasConceptScore W2141867662C2780246119 @default.
• W2141867662 hasConceptScore W2141867662C2780627266 @default.
• W2141867662 hasConceptScore W2141867662C501593827 @default.
• W2141867662 hasConceptScore W2141867662C55493867 @default.
• W2141867662 hasConceptScore W2141867662C86803240 @default.
• W2141867662 hasConceptScore W2141867662C89423630 @default.
• W2141867662 hasIssue "42" @default.
• W2141867662 hasLocation W21418676621 @default.
• W2141867662 hasOpenAccess W2141867662 @default.

• next