FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2143453595> ?p ?o ?g. }

• W2143453595 endingPage "38003" @default.
• W2143453595 startingPage "37993" @default.
• W2143453595 abstract "Spore formation is an extreme response of many bacterial species to starvation. In the case of pathogenic species of Bacillus and Clostridium, it is also a component of disease transmission. Entry into the pathway of sporulation in Bacillus subtilis and its relatives is controlled by an expanded two-component system in which starvation signals lead to the activation of sensor kinases and phosphorylation of the master sporulation response regulator Spo0A. Accumulation of threshold concentrations of Spo0A∼P heralds the commitment to sporulation. Countering the activities of the sensor kinases are phosphatases such as Spo0E, which dephosphorylate Spo0A∼P and inhibit sporulation. Spo0E-like protein-aspartic acid-phosphate phosphatases, consisting of 50-90 residues, are conserved in sporeforming bacteria and unrelated in sequence to proteins of known structure. Here we determined the structures of the Spo0A∼P phosphatases BA1655 and BA5174 from Bacillus anthracis using nuclear magnetic resonance spectroscopy. Each is composed of two anti-parallel α-helices flanked by flexible regions at the termini. The signature SQELD motif (SRDLD in BA1655) is situated in the middle of helix α2 with its polar residues projecting outward. BA5174 is a monomer, whereas BA1655 is a dimer. The four-helix bundle structure in the dimer is reminiscent of the phosphotransferase Spo0B and the chemotaxis phosphatase CheZ, although in contrast to these systems, the subunits in BA1655 are in head-to-tail rather than head-to-head apposition. The implications of the structures for interactions between the phosphatases and their substrate Spo0A∼P are discussed. Spore formation is an extreme response of many bacterial species to starvation. In the case of pathogenic species of Bacillus and Clostridium, it is also a component of disease transmission. Entry into the pathway of sporulation in Bacillus subtilis and its relatives is controlled by an expanded two-component system in which starvation signals lead to the activation of sensor kinases and phosphorylation of the master sporulation response regulator Spo0A. Accumulation of threshold concentrations of Spo0A∼P heralds the commitment to sporulation. Countering the activities of the sensor kinases are phosphatases such as Spo0E, which dephosphorylate Spo0A∼P and inhibit sporulation. Spo0E-like protein-aspartic acid-phosphate phosphatases, consisting of 50-90 residues, are conserved in sporeforming bacteria and unrelated in sequence to proteins of known structure. Here we determined the structures of the Spo0A∼P phosphatases BA1655 and BA5174 from Bacillus anthracis using nuclear magnetic resonance spectroscopy. Each is composed of two anti-parallel α-helices flanked by flexible regions at the termini. The signature SQELD motif (SRDLD in BA1655) is situated in the middle of helix α2 with its polar residues projecting outward. BA5174 is a monomer, whereas BA1655 is a dimer. The four-helix bundle structure in the dimer is reminiscent of the phosphotransferase Spo0B and the chemotaxis phosphatase CheZ, although in contrast to these systems, the subunits in BA1655 are in head-to-tail rather than head-to-head apposition. The implications of the structures for interactions between the phosphatases and their substrate Spo0A∼P are discussed. Spore formation is an extreme developmental response of many Gram-positive species of bacteria, exemplified by Bacillus subtilis, to nutrient deprivation (1Piggot P.J. Coote J.G. Bacteriol. Rev. 1976; 40: 908-962Crossref PubMed Google Scholar). It starts with an asymmetric septation, which produces a larger mother cell and a smaller forespore. The mother cell engulfs the forespore and nurtures it during its development into a resistant spore. The spore is released in the final stages upon lysis of the mother cell and can remain dormant in the soil until favorable conditions for growth are restored and it can germinate. Spores are important in the life cycle of a number of human pathogens most notably in the food-borne agents Clostridium botulinum and Bacillus cereus and the anthrax agent Bacillus anthracis (2Piggot P.J. Hilbert D.W. Curr. Opin. Microbiol. 2004; 7: 579-586Crossref PubMed Scopus (447) Google Scholar). Sporulation is energetically expensive, requiring the activation of hundreds of hitherto silent genes at a time when nutrients are scarce. As a result, it is under elaborate control. At the heart of the regulatory system is an expanded two-component signal transduction system, termed the phosphorelay (3Burbulys D. Trach K.A. Hoch J.A. Cell. 1991; 64: 545-552Abstract Full Text PDF PubMed Scopus (661) Google Scholar). The phosphorelay consists of multiple sensor kinases (4Jiang M. Shao W. Perego M. Hoch J.A. Mol. Microbiol. 2000; 38: 535-542Crossref PubMed Scopus (276) Google Scholar, 6Kobayashi K. Shoji K. Shimizu T. Nakano K. Sato T. Kobayashi Y. J. Bacteriol. 1995; 177: 176-182Crossref PubMed Scopus (59) Google Scholar) that, when activated by appropriate environmental, metabolic, and cell cycle stimuli, autophosphorylate on a conserved histidine residue. The phosphoryl group is then relayed via an aspartate on Spo0F and a histidine on Spo0B to an aspartate on Spo0A. Spo0A is a response regulator and the master control element in the initiation of sporulation. If a threshold concentration of Spo0A∼P is achieved, the cell is committed to the sporulation pathway. Attainment of this threshold requires elevated levels of spo0A expression as well as increased flux of phosphoryl groups through the phosphorelay. The latter requires not only elevated activity of the sporulation sensor kinases that feed the phosphorelay but also the inactivity of a number of protein-aspartic acid phosphatases that drain it (7Perego M. Hanstein C. Welsh K.M. Djavakhishvili T. Glaser P. Hoch J.A. Cell. 1994; 79: 1047-1055Abstract Full Text PDF PubMed Scopus (252) Google Scholar, 9Perego M. Mol. Microbiol. 2001; 42: 133-143Crossref PubMed Scopus (82) Google Scholar). Spo0F and the receiver domain of Spo0A have similar tertiary structures (10Lewis R.J. Brannigan J.A. Muchova K. Barak I. Wilkinson A.J. J. Mol. Biol. 1999; 294: 9-15Crossref PubMed Scopus (141) Google Scholar, 11Madhusudan Zapf J. Whiteley J.M. Hoch J.A. Xuong N.H. Varughese K.I. Structure (Lond.). 1996; 4: 679-690Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar). Each is capable of reversible phosphotransfer to Spo0B implying a similar phosphorylation site stereochemistry. Despite these similarities, the phosphatases that dephosphorylate Spo0F∼P and Spo0A∼P are quite different. The Rap phosphatases, RapA, RapB, and RapE, which are active against Spo0F∼P, have molecular masses of ∼45 kDa and contain six tetratricopeptide repeats (12Perego M. Brannigan J.A. Peptides. 2001; 22: 1541-1547Crossref PubMed Scopus (94) Google Scholar). Their activities are regulated by peptides derived from downstream Phr proteins following an export-import maturation process (13Perego M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 8612-8617Crossref PubMed Scopus (159) Google Scholar). In contrast Spo0E, YisI, and YnzD, which dephosphorylate Spo0A∼P, are small 50-90-residue proteins, and little is known about their regulation (9Perego M. Mol. Microbiol. 2001; 42: 133-143Crossref PubMed Scopus (82) Google Scholar). Structural studies of the components of the phosphorelay have provided important insights of wider significance including (i) the first glimpse of phosphorylated aspartic acid in a protein and the associated stereochemistry that is conserved across the response regulator family (10Lewis R.J. Brannigan J.A. Muchova K. Barak I. Wilkinson A.J. J. Mol. Biol. 1999; 294: 9-15Crossref PubMed Scopus (141) Google Scholar) and (ii) the first view of a complex between a response regulator and a sensor kinasetype phosphotransferase domain, placing studies of the evolution of protein recognition in two-component systems on a firm footing (14Zapf J. Sen U. Madhusudan Hoch J.A. Varughese K.I. Structure (Lond.). 2000; 8: 851-862Abstract Full Text Full Text PDF PubMed Scopus (156) Google Scholar). To complement and extend these studies, structures of the kinases and phosphatases that feed and drain the sporulation phosphorelay are needed. We have attempted, without success, to crystallize the Spo0E, YisI, and YnzD proteins from B. subtilis. We therefore extended our study to putative Spo0A∼P phosphatases from B. anthracis. In this organism, the major components of the sporulation phosphorelay, Spo0F, Spo0B, and Spo0A, are essentially identical (15Stephenson K. Hoch J.A. Mol. Microbiol. 2002; 46: 297-304Crossref PubMed Scopus (107) Google Scholar), although they may be phosphorylated by as many as nine sensor histidine kinases (16Brunsing R.L. La Clair C. Tang S. Chiang C. Hancock L.E. Perego M. Hoch J.A. J. Bacteriol. 2005; 187: 6972-6981Crossref PubMed Scopus (56) Google Scholar). Two putative Spo0E-type proteins, BA1655 and BA5174, were purified and shown to have Spo0A-phosphate phosphatase activity. With crystals continuing to prove elusive, we used nuclear magnetic resonance spectroscopy to determine the structures of both proteins. The structures provide insights into the Spo0E-dependent dephosphorylation of Spo0A, the master regulator of sporulation. Cloning and Expression—DNA fragments encoding BA1655 and BA5174 were amplified by PCR from B. anthracis UM23CL-2 genomic DNA. Sequence alignment data showed that the annotated sequences provided by The Institute for Genomic Research (Rockville, MD) for the loci BA5174 and BA1655 may possess 51 and 18 extra residues, respectively, at their N termini compared with B. subtilis Spo0E. The coding sequences for these “extra” amino acid residues were omitted from the final constructs used in this work. The amplified fragments were digested with the restriction endonucleases NcoI and XhoI and ligated to similarly cut pET-28a vector DNA (Novagen). The ligation products were introduced into Escherichia coli NovaBlue competent cells (Novagen). Restriction enzyme digestion analysis of recombinant plasmids and subsequent DNA sequencing allowed the isolation of desired recombinants in which the coding sequences of the phosphatases are placed adjacent to a sequence encoding a C-terminal hexahistidine tag (LEHHHHHH). Protein Production—Protein expression and purification, as well as sample preparation, were performed as described previously (17Folkers G.E. van Buuren B.N.M. Kaptein R. J. Struct. Funct. Genomics. 2004; 5: 119-131Crossref PubMed Scopus (48) Google Scholar). For production of 15N-labeled protein, recombinant plasmids were introduced into E. coli BL21 (DE3) and grown at 37 °C in 500 ml of minimal medium (18Jansson M. Li Y.C. Jendeberg L. Anderson S. Montelione B.T. Nilsson B. J. Biomol. NMR. 1996; 7: 131-141Crossref PubMed Scopus (151) Google Scholar) containing 4 g/liter glucose and 0.5 g/liter 15NH4Cl. At an OD600 of 0.5, protein expression was induced by the addition of isopropyl thio-β-d-galactopyranoside to a final concentration of 0.5 mm, and the culture was incubated with shaking at 30 °C for a further 4 h. 13C/15N doubly labeled protein was prepared in the same way with [13C]glucose at 2 g/liter replacing the unlabeled glucose in the minimal medium. Cells were harvested by centrifugation and resuspended in 10 ml of Buffer A (50 mm sodium phosphate, pH 8, 300 mm NaCl) containing 10 mm imidazole, 1 mm β-mercaptoethanol, 0.2 mm phenylmethylsulfonyl fluoride, 1 μg/ml lysozyme, and 1% (v/v) protease inhibitor mixture (Complete, Roche Applied Science) and frozen at -80 °C overnight. Following cell lysis by sonication, the soluble cell fraction was fractionated by Ni2+-nitrilotriacetic acid chromatography using a Poros MC column and a BioCad Vision HPLC 5The abbreviations used are: HPLC, high pressure liquid chromatography; NOE, nuclear Overhauser enhancement; r.m.s., root mean square; N-Spo0A, the receiver domain of Spo0A; BA, B. anthracis; FPLC, fast protein liquid chromatography; GAP, GTPase-activating protein. system (Applied Biosystems). Samples were loaded in Buffer A containing 20 mm imidazole, and after washing, bound proteins were eluted in Buffer A containing 500 mm imidazole and directed onto a Sephadex G75 gel filtration column pre-equilibrated in 50 mm sodium phosphate, pH 8.0, 150 mm NaCl. Protein fractions eluting from this column were buffer-exchanged into 50 mm sodium phosphate buffer, pH 6.0, 150 mm NaCl in the case of BA5174 and 10 mm sodium phosphate, pH 6.0, 50 mm NaCl in the case of BA1655. The protein samples were concentrated initially to 0.3-1.0 mm, and sodium azide and D2O were added to the samples to final concentrations of 0.02 and 10%, respectively. NMR Spectroscopy—All NMR measurements on U-15N- and U-13C,15N-labeled BA1655 and BA5174 were recorded on Bruker Avance spectrometers operating at 700 and 900 MHz. For the intrinsically dimeric BA1655, the temperature was set to 298 K, whereas a lower temperature of 278 K was chosen for BA5174 to obtain a homogeneous monomeric spectrum (see below). The three-dimensional spectra required for resonance assignment and structure determination were recorded using a standard set of NMR experiments (19Sattler M. Schleucher J. Griesinger C. Prog. Nucl. Magn. Reson. Spectrosc. 1999; 34: 93-158Abstract Full Text Full Text PDF Scopus (1399) Google Scholar). To accelerate resolution sampling in the indirect 15N dimension, extensive spectral folding was applied resulting in sweep widths of 13.8 ppm for BA5174 and 7.0 ppm for BA1655. For resonance assignment of both proteins, we recorded slightly different sets of NMR spectra to account for the substantially lower inherent sensitivity of the BA5174 sample (∼0.3 mm concentration at 278 K) compared with the BA1655 sample (∼1mm dimer concentration at 298 K). Thus, for both samples we recorded sequential CO and CA information for backbone assignment in three-dimensional inter-residual (i - 1) HNCO and CBCA[CO]NH and bifurcate (i, i - 1) HN[CA]CO and HNCA experiments as well as side chain information in three-dimensional [H]CCH correlated spectroscopy, H[C]CH total correlated spectroscopy, and [H]C[CCO]NH total correlated spectroscopy experiments. The optional, more sensitivity-limited three-dimensional (i, i - 1) HNCACB (to obtain sequential CB information) and H[CCO]NH total correlated spectroscopy experiments for backbone and side chain assignment, respectively, were only recorded for BA1655. For BA5174, we recorded instead three-dimensional (i - 1) HBHA[CO]NH and (i, i - 1) HN[CA]HA spectra to add sequential HA information to the backbone assignment protocol; we furthermore recorded a two-dimensional H,H total correlated spectroscopy experiment with H[15N] suppression in the direct dimension (20Whitehead B. Tessari M. Düx P. Boelens R. Kaptein R. Vuister G.W. J. Biomol. NMR. 1997; 9: 313-316Crossref PubMed Scopus (12) Google Scholar) to better resolve and assign the additional six tyrosine aromatic moieties. All spectra were processed in XWinNMR 3.5 (Bruker Biospin, Rheinstetten, Germany), and peak lists were generated by SPARKY (21Goddard T.D. Kneller D.G. SPARKY 3. University of California, San Francisco2006Google Scholar). Sequential backbone assignment was performed largely automatically using both PASTA (22Leutner M. Gschwind R.M. Lermann J. Schwarz C. Gemmecker G. Kessler H. J. Biol. NMR. 1998; 11: 31-43Crossref PubMed Scopus (86) Google Scholar) and AutoAssign (23Zimmerman D.E. Kulikowski C.A. Huang Y. Feng W. Tashiro M. Shimotakahara S. Chien C. Powers R. Montelione G.T. J. Mol. Biol. 1997; 269: 592-610Crossref PubMed Scopus (266) Google Scholar), whereas manual side chain assignment was supported by in-house software. For structure elucidation we recorded a set of three-dimensional H,NH-, H,CH-, and [H]C,NH-NOE spectroscopy spectra (24Diercks T. Coles M. Kessler H. J. Biomol. NMR. 1999; 15: 177-180Crossref PubMed Scopus (65) Google Scholar) complemented by a high-resolution two-dimensional H,H-NOE spectroscopy spectrum. Automated NOE assignment and structure calculations were performed using the CANDID (25Herrmann T. Guntert P. Wüthrich K. J. Mol. Biol. 2002; 319: 209-227Crossref PubMed Scopus (1335) Google Scholar) module of CYANA2.1 (26Güntert P. Mumenthaler C. Wüthrich K. J. Mol. Biol. 1997; 273: 283-298Crossref PubMed Scopus (2558) Google Scholar), although NOE spectra were manually checked for i + 3 and i + 4 peaks to identify helical boundaries. Dihedral angle restraints were calculated using TALOS (27Cornilescu G. Delaglio F. Bax A. J. Biomol. NMR. 1999; 13: 289-302Crossref PubMed Scopus (2740) Google Scholar). Finally, water refinement was performed using CNS (28Brunger A.T. Adams P.D. Clore G.M. Delano W.L. Gros P. Grosse-Kunstleve R.W. Jiang J.S. Kuszewski J. Nilges M. Pannu N.S. Read R.J. Rice L.M. Simonson T. Warren G.L. Crystallography & NMR System (CNS). Version 1.1, Yale University, New Haven, CT1997Google Scholar) according to the RECOORD protocol (29Nederveen A.J. Doreleijers J.F. Vranken W. Miller Z. Spronk C.A. Nabuurs S.B. Guntert P. Livny M. Markley J.L. Nilges M. Ulrich E.L. Kaptein R. Bonvin A.M. Proteins. 2005; 59: 662-672Crossref PubMed Scopus (295) Google Scholar). Structures were validated using WHATIF (30Vriend G. J. Mol. Graph. 1990; 8: 52-56Crossref PubMed Scopus (3377) Google Scholar) and PROCHECK (31Morris A.L. MacArthur M.W. Hutchinson E.G. Thornton J.M. Proteins. 1992; 12: 345-364Crossref PubMed Scopus (1420) Google Scholar, 32Laskowski R.A. MacArthur M.W. Moss D.S. Thornton J.M. J. Appl. Crystallogr. 1993; 26: 283-291Crossref Google Scholar). Molecular Weight Determination—Proteins were analyzed by gel filtration on a Superdex S75 column (3.2 × 30 cm) equilibrated and run using an FPLC system (Amersham Biosciences) at a flow rate of 1 ml/min in 50 mm sodium phosphate buffer, pH 7.6, containing 150 mm NaCl. Sedimentation equilibrium experiments were performed on a Beckman Optima XL/I analytical ultracentrifuge using Beckman cells with 12-mm path length double sector six-channel charcoal-filled Epon centerpieces and quartz windows in an AN-50Ti rotor. BA1655 (165 μg/ml) was prepared in 25 mm Tris, pH 8.0, 30 mm NaCl, whereas BA5174 (86 μg/ml) was prepared in 25 mm Tris, pH 8.0, 150 mm NaCl. Serial 2-fold dilutions of the protein were prepared, and 118 μl samples were centrifuged along with buffer samples as references at 25,000 rpm for 17 h and at 35,000 rpm for a further 18 h at 20 °C. The temperature was lowered to 8 °C, and runs at 35,000 rpm for 15 h and 25, 000 rpm for 21 h were performed. Radial absorbance scans were taken at 280 or 230 nm at ∼3-h intervals until sedimentation equilibrium was achieved as judged by the absence of change in overlays of successive scans. The data were analyzed using the Beckman Origin software (supplied with the machine). A narrow range of data points around a series of radial points in the scan were used to estimate midpoint molecular weights using the Lamm equation for a single species. These were then plotted against concentration. The data were also analyzed by nonlinear least squares fitting to each set of data assuming a single species model (Beckman Origin software). Protein concentrations were estimated as follows. For BA5174, the protein concentration was determined from plots of A280 versus A230 from scans taken at equilibrium at 35,000 rpm. These gave linear plots that indicated that A280 = 0.109 × A230. Thus, using the calculated A280 for 1 mg/ml protein = 0.563, 1 A230 (in a 1.2-cm path length cell) corresponds to 0.162 mg/ml (20 μm). For BA1655, which lacks Trp and Tyr residues and has a negligible extinction coefficient, the concentration was estimated from interference optical data assuming BA1655 gives a normal response. 1 A230 corresponds to 0.35 mg/ml protein. In Vivo Assays—The BA1655 locus was cloned as a 380-bp fragment obtained by PCR amplification using the oligonucleotide primers BA1655-5′Eco (GAGCCGAATTCTTTTGTAATTAGACACACGC) and BA1655-3′BamII (TAAAAGGATCCAAATTCTTATTTATGTAC). This fragment included 207 bp upstream of the codon for the first methionine residue shown in Fig. 1. The fragment was cloned in the multicopy vector pHT315 (33Arantes O. Lereclus D. Gene (Amst.). 1991; 108: 115-119Crossref PubMed Scopus (355) Google Scholar). After propagation in the dam- E. coli strain C600, the resulting plasmid, pHT315-1655, was used to transform the B. anthracis Sterne strain 34F2 by the method of Koehler et al. (34Koehler T.M. Dai Z. Kaufman-Yarbray M. J. Bacteriol. 1994; 176: 586-595Crossref PubMed Google Scholar). The phenotype of the transformants was analyzed on Schaeffer's sporulation agar plates (sporulation medium) (35Schaeffer P. Millet J. Aubert J.P. Proc. Natl. Acad. Sci. U. S. A. 1965; 54: 704-711Crossref PubMed Scopus (886) Google Scholar). Transcription analysis was carried out by means of β-galactosidase assays on a B. anthracis 34F2 strain carrying a transcriptional lacZ fusion construct generated on plasmid pTCVlac (36Poyart C. Trieu-Cuot P. FEMS Microbiol. Lett. 1997; 156: 193-198Crossref PubMed Scopus (146) Google Scholar). The 285-bp fragment containing the promoter region was generated by PCR amplification using oligonucleotide primers BA1655-5′Eco (see above) and BA1655-3′BamI (TATCAGGATCCAATCCATGTCTAGC). Strains were grown in liquid sporulation medium supplemented with 7.5 μg/ml kanamycin. Aliquots were taken at hourly intervals, and β-galactosidase activity was assayed as described previously (37Ferrari E. Howard S.M. Hoch J.A. J. Bacteriol. 1986; 166: 173-179Crossref PubMed Google Scholar) with the following modifications. The incubation at 37 °C with lysozyme was carried out for 1 h and Triton was used at 0.5% final concentration. Activity Assays—The phosphorylated form of the receiver domain of Spo0A from Bacillus stearothermophilus, prepared as described previously (38Muchová K. Lewis R.J. Perečko D. Brannigan J.A. Ladds J.C. Leech A. Wilkinson A.J. Barák I. Mol. Microbiol. 2004; 53: 829-842Crossref PubMed Scopus (23) Google Scholar), was generously provided by Dr. Rick Lewis, University of Newcastle-upon-Tyne. Its dephosphorylation by BA1655 and BA5174 was monitored using a gel electrophoresis assay exploiting the observation that dephosphorylation of N-Spo0A∼P is associated with an increase in gel mobility (39Zapf J.W. Hoch J.A. Whiteley J.M. Biochemistry. 1996; 35: 2926-2933Crossref PubMed Scopus (50) Google Scholar, 40Lewis R.J. Scott D.J. Brannigan J.A. Ladds J.C. Cervin M.A. Spiegelman G.B. Hoggett J.G. Barák I. Wilkinson A.J. J. Mol. Biol. 2002; 316: 235-245Crossref PubMed Scopus (1) Google Scholar). In a buffer containing 25 mm Tris-HCl and 150 mm NaCl, N-Spo0A∼P at a concentration of ∼30 μm was incubated with 2-fold serial dilutions (3.6 μm to 60 nm) of BA1655 and BA5174. After 1 h at room temperature, a half-volume of sample buffer (1.5 m Tris-HCl, pH 8.8, 20% (v/v) glycerol, 0.1% (w/v) bromphenol blue) was added, and the samples were immediately loaded on a 12.5% non-denaturing polyacrylamide gel. Following electrophoresis at 150 V for 1.5 h at 4 °C, the proteins were visualized by Coomassie Blue staining. The Distribution of Spo0E-like Phosphatases—The spo0E gene of B. subtilis was discovered following the characterization of strains in which sporulation was arrested at stage 0. The mutant phenotype was found to be due to Spo0E hyperactivity (8Ohlsen K.L. Grimsley J.K. Hoch J.A. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 1756-1760Crossref PubMed Scopus (132) Google Scholar, 41Perego M. Hoch J.A. J. Bacteriol. 1991; 173: 2514-2520Crossref PubMed Google Scholar). Subsequent analysis of the genome sequence of this organism led to the identification and characterization of two homologous proteins, YnzD and YisI, which dephosphorylate Spo0A∼P and whose overexpression lowers the sporulation frequency (9Perego M. Mol. Microbiol. 2001; 42: 133-143Crossref PubMed Scopus (82) Google Scholar). Analysis of the genome sequences of Bacillus species in the Cereus group (B. anthracis, B. cereus, and Bacillus thuringiensis) suggests that there has been an expansion in the number of open reading frames that encode small protein-aspartate phosphatases. In B. anthracis, there appear to be five proteins with sequences resembling the Spo0E, YnzD, and YisI proteins of B. subtilis, although two in the Ames strain may not be functional due to frameshifts (supplemental Table S1). B. cereus also appears to have five spo0E-like genes, and B. thuringiensis may have six (supplemental Table S1). Large plasmids contained in B. cereus and B. thuringiensis also harbor homologous genes. A sequence alignment (Fig. 1) highlights the canonical “signature” sequence, SQELDXL (9Perego M. Mol. Microbiol. 2001; 42: 133-143Crossref PubMed Scopus (82) Google Scholar). The first, fifth, and seventh residues are invariant with limited Gln → Arg, Glu → Gln/Asp, and Leu → Ile variations at the second, third, and fourth positions, respectively. These variations become more marked in the homologous proteins of a wider set of Gram-positive organisms that contain Spo0A-like substrate proteins, particularly those that live in extreme environments (supplemental Fig. S1). BA1655 and BA5174 Dephosphorylate Spo0A in Vivo and in Vitro—To characterize further the Spo0E family of aspartic acid-phosphate phosphatases, we expressed and purified a number of Spo0E-like proteins from different Bacillus species. The B. anthracis proteins BA5174 and BA1655 were chosen for extended study because (i) both proteins could be overproduced in good yield and at high solubility from E. coli, and (ii) they are representative of Spo0E-like proteins that harbor the signature sequence SQELDXL (BA5174) and those that contain the most common variation on this motif, SRDLDXL (BA1655). To determine whether these proteins play a role in regulating the sporulation phosphorelay, the genes encoding the BA1655 and BA5174 proteins were cloned on the multicopy vector pHT315 and transformed in the parental B. anthracis strain 34F2. Overexpression of Spo0E-like proteins results in a sporulation-deficient phenotype (Spo-) due to their dephosphorylating activity on Spo0A∼P (9Perego M. Mol. Microbiol. 2001; 42: 133-143Crossref PubMed Scopus (82) Google Scholar). The B. anthracis strain carrying pHT315-1655 clearly showed a Spo- phenotype when grown on Schaeffer's sporulation medium compared with the strain carrying the vector alone (Fig. 2A). This result indicated that BA1655 is indeed a negative regulator of sporulation. Transcription analysis by means of β-galactosidase assays on a strain carrying a promoter lacZ fusion construct showed that a 207-bp fragment upstream of the coding sequence is sufficient to promote a relatively high level of expression that appeared to be essentially constitutive throughout the growth cycle (Fig. 2B). Similar in vivo analyses of BA5174 indicated that this gene is not transcribed at sufficiently high levels to result in overproduction of its gene product, thus explaining the lack of a sporulation phenotype when cloned on pHT315. 6C. Bongiorni and M. Perego, manuscript in preparation. Purified BA1655 and BA5174 were each able to promote the dephosphorylation in vitro of the phosphorylated form of the receiver domain of Spo0A (N-Spo0A) from B. stearothermophilus. Phosphorylated N-Spo0A has a lower electrophoretic mobility than the unphosphorylated protein in non-denaturing gels (40Lewis R.J. Scott D.J. Brannigan J.A. Ladds J.C. Cervin M.A. Spiegelman G.B. Hoggett J.G. Barák I. Wilkinson A.J. J. Mol. Biol. 2002; 316: 235-245Crossref PubMed Scopus (1) Google Scholar). As shown in Fig. 2C, incubation of N-Spo0A∼P with either BA1655 or BA5174 led to an increase in mobility, confirming the capacity of both proteins to dephosphorylate N-Spo0A∼P. BA5174 exhibited ∼8-fold higher specific activity than BA1655 in these assays, an observation we made with two different protein preparations. To gain insights into the mechanism and substrate specificity of these small aspartic acid phosphatases, we determined the structures of these two representative members. NMR Data and Structure Determination—As a step toward structure determination, we expressed and purified a number of Spo0E-like proteins from different Bacillus species in an unsuccessful quest for crystals. In the absence of crystals, we turned to NMR spectroscopy. The initial 15N heteronuclear single quantum correlation spectra for both BA1655 and BA5174 showed limited HN dispersion (∼7.1-8.8 ppm), characteristic of all α-helical proteins (supplemental Fig. S2). The BA5174 heteronuclear single quantum correlation spectra, however, revealed remarkable temperature dependence (data not shown) with a second set of signals appearing above 283 K and predominating at higher temperatures (>308 K). The disappearance of this second set of signals, with distinctly larger line widths, upon 10-fold dilution (to ∼50 μm) at 298 K suggested reversible, yet stable multimerization. However, we cannot exclude the possibility that under these conditions aggregation accompanied by partial unfolding is occurring given the appearance of amide resonances around the random coil position together with the decrease in signal intensity for the monomeric species. We therefore chose to simplify the NMR investigations by carrying out experiments at the relatively low protein concentration of ∼0.3 mm and at the lower temperature of 278 K at which a single species was prevalent. Even under these conditions, several heteronuclear single quantum correlation peaks from BA5174 either had shoulders or could be resolved into weak nearby second peaks, indicating the persistence of some conformational heterogeneity. Complete sets of NMR spectra for assignment and structure elucidation were recorded in 15 and 22 days for BA1655 and BA5174, respectively, on spectrometers operati" @default.
• W2143453595 created "2016-06-24" @default.
• W2143453595 creator A5006440138 @default.
• W2143453595 creator A5016951786 @default.
• W2143453595 creator A5018678780 @default.
• W2143453595 creator A5020986127 @default.
• W2143453595 creator A5022173939 @default.
• W2143453595 creator A5041541957 @default.
• W2143453595 creator A5051669470 @default.
• W2143453595 creator A5052112949 @default.
• W2143453595 creator A5053027227 @default.
• W2143453595 creator A5059682608 @default.
• W2143453595 creator A5062773923 @default.
• W2143453595 creator A5072862133 @default.
• W2143453595 creator A5078946015 @default.
• W2143453595 creator A5080245599 @default.
• W2143453595 creator A5088292790 @default.
• W2143453595 date "2006-12-01" @default.
• W2143453595 modified "2023-10-02" @default.
• W2143453595 title "Structural Characterization of Spo0E-like Protein-aspartic Acid Phosphatases That Regulate Sporulation in Bacilli" @default.
• W2143453595 cites W1486913820 @default.
• W2143453595 cites W1489139260 @default.
• W2143453595 cites W1496264315 @default.
• W2143453595 cites W1582899695 @default.
• W2143453595 cites W1589295940 @default.
• W2143453595 cites W1592293812 @default.
• W2143453595 cites W172193357 @default.
• W2143453595 cites W1945765509 @default.
• W2143453595 cites W1954418814 @default.
• W2143453595 cites W1964511689 @default.
• W2143453595 cites W1975635548 @default.
• W2143453595 cites W1985629904 @default.
• W2143453595 cites W1986191025 @default.
• W2143453595 cites W1988260421 @default.
• W2143453595 cites W1997196594 @default.
• W2143453595 cites W2002195659 @default.
• W2143453595 cites W2020657021 @default.
• W2143453595 cites W2032362831 @default.
• W2143453595 cites W2039287501 @default.
• W2143453595 cites W2043698416 @default.
• W2143453595 cites W2048661284 @default.
• W2143453595 cites W2052933818 @default.
• W2143453595 cites W2053202752 @default.
• W2143453595 cites W2056011150 @default.
• W2143453595 cites W2056536050 @default.
• W2143453595 cites W2069663555 @default.
• W2143453595 cites W2075770210 @default.
• W2143453595 cites W2076452975 @default.
• W2143453595 cites W2087021777 @default.
• W2143453595 cites W2087232840 @default.
• W2143453595 cites W2090103138 @default.
• W2143453595 cites W2093482724 @default.
• W2143453595 cites W2098613471 @default.
• W2143453595 cites W2103612886 @default.
• W2143453595 cites W2111635953 @default.
• W2143453595 cites W2115921407 @default.
• W2143453595 cites W2132717858 @default.
• W2143453595 cites W2134301019 @default.
• W2143453595 cites W2134362529 @default.
• W2143453595 cites W2148531602 @default.
• W2143453595 cites W2157165549 @default.
• W2143453595 cites W2158318887 @default.
• W2143453595 cites W2158521027 @default.
• W2143453595 cites W2166606571 @default.
• W2143453595 cites W2169462961 @default.
• W2143453595 cites W2170338669 @default.
• W2143453595 cites W259086448 @default.
• W2143453595 cites W4237880661 @default.
• W2143453595 doi "https://doi.org/10.1074/jbc.m607617200" @default.
• W2143453595 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17001075" @default.
• W2143453595 hasPublicationYear "2006" @default.
• W2143453595 type Work @default.
• W2143453595 sameAs 2143453595 @default.
• W2143453595 citedByCount "14" @default.
• W2143453595 countsByYear W21434535952014 @default.
• W2143453595 countsByYear W21434535952015 @default.
• W2143453595 countsByYear W21434535952016 @default.
• W2143453595 countsByYear W21434535952018 @default.
• W2143453595 countsByYear W21434535952019 @default.
• W2143453595 countsByYear W21434535952022 @default.
• W2143453595 countsByYear W21434535952023 @default.
• W2143453595 crossrefType "journal-article" @default.
• W2143453595 hasAuthorship W2143453595A5006440138 @default.
• W2143453595 hasAuthorship W2143453595A5016951786 @default.
• W2143453595 hasAuthorship W2143453595A5018678780 @default.
• W2143453595 hasAuthorship W2143453595A5020986127 @default.
• W2143453595 hasAuthorship W2143453595A5022173939 @default.
• W2143453595 hasAuthorship W2143453595A5041541957 @default.
• W2143453595 hasAuthorship W2143453595A5051669470 @default.
• W2143453595 hasAuthorship W2143453595A5052112949 @default.
• W2143453595 hasAuthorship W2143453595A5053027227 @default.
• W2143453595 hasAuthorship W2143453595A5059682608 @default.
• W2143453595 hasAuthorship W2143453595A5062773923 @default.
• W2143453595 hasAuthorship W2143453595A5072862133 @default.
• W2143453595 hasAuthorship W2143453595A5078946015 @default.
• W2143453595 hasAuthorship W2143453595A5080245599 @default.
• W2143453595 hasAuthorship W2143453595A5088292790 @default.
• W2143453595 hasBestOaLocation W21434535951 @default.

• next