FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2143655571> ?p ?o ?g. }

• W2143655571 endingPage "8310" @default.
• W2143655571 startingPage "8298" @default.
• W2143655571 abstract "The gene regulatory functions of the human IL-2 receptor (IL-2R) were reconstituted in transiently transfected hepatoma cells. The combination of IL-2Rβ and -γ mediated a strong stimulation via the cytokine response element of the α1-acid glycoprotein gene and the hematopoietin receptor response element, but none via the IL-6 response element or the sis-inducible element. IL-2Rα enhanced 10-fold the sensitivity of the IL-2Rβ•γ complex to respond to IL-2 or IL-15, but did not modify the specificity or the magnitude of maximal gene regulation. A homodimerizing chimeric receptor G-CSFR-IL-2Rβ could mimic the IL-2R action. The IL-2R-mediated gene regulation was similar to that seen with receptors for IL-4 and IL-7, but differed from that for IL-6 type cytokines, thrombopoietin, erythropoietin, and growth hormone. The activation of STAT proteins by the IL-2R was assessed in transfected L-cells and COS-1 cells. Although IL-2R subunits were highly expressed in these cells, no STAT protein activation was detectable. Transient overexpression of JAK3 was unable to change the signaling specificity of the hematopoietin receptors in rat hepatoma, L-, and COS cells, but established a prominent activation of the IL-6 response elements by the IL-2R and IL-4R in HepG2 cells. The data support the model that the IL-2R and related hematopoietin receptors produce at least two separate signals which control gene expression. The gene regulatory functions of the human IL-2 receptor (IL-2R) were reconstituted in transiently transfected hepatoma cells. The combination of IL-2Rβ and -γ mediated a strong stimulation via the cytokine response element of the α1-acid glycoprotein gene and the hematopoietin receptor response element, but none via the IL-6 response element or the sis-inducible element. IL-2Rα enhanced 10-fold the sensitivity of the IL-2Rβ•γ complex to respond to IL-2 or IL-15, but did not modify the specificity or the magnitude of maximal gene regulation. A homodimerizing chimeric receptor G-CSFR-IL-2Rβ could mimic the IL-2R action. The IL-2R-mediated gene regulation was similar to that seen with receptors for IL-4 and IL-7, but differed from that for IL-6 type cytokines, thrombopoietin, erythropoietin, and growth hormone. The activation of STAT proteins by the IL-2R was assessed in transfected L-cells and COS-1 cells. Although IL-2R subunits were highly expressed in these cells, no STAT protein activation was detectable. Transient overexpression of JAK3 was unable to change the signaling specificity of the hematopoietin receptors in rat hepatoma, L-, and COS cells, but established a prominent activation of the IL-6 response elements by the IL-2R and IL-4R in HepG2 cells. The data support the model that the IL-2R and related hematopoietin receptors produce at least two separate signals which control gene expression. Hematopoietin receptors are members of a gene family characterized by common structural motifs in their extracellular and, in some cases, also in their intracellular domains(1Bazan J.F. Proc. Natl. Acad. Sci. U. S. A. 1990; 80: 6934-6938Crossref Scopus (1881) Google Scholar, 2Miyajima A. Kitamura T. Harada N. Yokota T. Arai K. Annu. Rev. Immunol. 1992; 10: 295-331Crossref PubMed Scopus (540) Google Scholar). Several groups of receptors within this family have been identified based on the shared use of signaling subunits. The groups include those depending on the IL-2Rγ 1The abbreviations used are: IL-interleukinAGPα1-acid glycoproteinAPPacute phase proteinCATchloramphenicol acetyltransferaseDREdistal regulatory elementEPOerythropoietinG-CSFgranulocyte-colony stimulatory factorGHgrowth hormoneGMSAgel mobility shift assayGREglucocorticoid response elementHPhaptoglobinHRREhematopoietin receptor response elementCytREcytokine response elementJAKJanus kinaseLIFleukemia inhibitory factorIFNinterferon-RreceptorPRLprolactinSIEsis-inducible elementSIFsis-inducible factorSTATsignal transducer and activator of transcription. (receptors for IL-2, −4, −7, −9, −13, and −15)(3Leonard W.J. Noguchi M. Russell S.M. McBride O.W. Immunol. Rev. 1994; 138: 61-86Crossref PubMed Scopus (161) Google Scholar, 4Noguchi M. Adelstein S. Cao X. Leonard W.J. J. Biol. Chem. 1993; 268: 13601-13608Abstract Full Text PDF PubMed Google Scholar, 5Kondo M. Takeshita T. Ishii N. Nakamura M. Watanabe S. Arai K. Sugamura K. Science. 1993; 262: 1874-1877Crossref PubMed Scopus (735) Google Scholar, 6Russell S.M. Keegan A.D. Harada N. Nakamura Y. Noguchi M. Leland P. Friedmann M.C. Miyajima A. Puri R. Paul W.E. Leonard W.J. Science. 1994; 262: 1880-1883Crossref Scopus (743) Google Scholar), the IL-3Rβ (receptors for IL-3, −5, and GM-CSF)(2Miyajima A. Kitamura T. Harada N. Yokota T. Arai K. Annu. Rev. Immunol. 1992; 10: 295-331Crossref PubMed Scopus (540) Google Scholar), and gp130 (receptors for IL-6, IL-11, LIF, oncostatin M, and CNTF)(7Murakami M. Hibi M. Nakagawa N. Nakagawa T. Yasukama K. Yamanishi K. Taga T. Kishimoto T. Science. 1993; 260: 1808-1810Crossref PubMed Scopus (645) Google Scholar, 8Stahl N. Yancopoulos G.D. Cell. 1993; 74: 587-590Abstract Full Text PDF PubMed Scopus (386) Google Scholar). Homodimeric hematopoietin receptors include those for G-CSF(9Fukunaga R. Ishizaka-Ikeda E. Pan C.X. Seto Y. Nagata S. EMBO J. 1991; 10: 2855-2865Crossref PubMed Scopus (271) Google Scholar, 10Ziegler S.F. Bird T.A. Morella K.K. Mosley D. Gearing D. Baumann H. Mol. Cell. Biol. 1993; 13: 2384-2390Crossref PubMed Scopus (111) Google Scholar), EPO(11Watowich S.S. Yoshimura A. Longmore G.D. Hilton D.J. Yoshimura Y. Lodish H.F. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 2140-2144Crossref PubMed Scopus (273) Google Scholar), prolactin(12Ultsch M. de Vos A.M. J. Mol. Biol. 1993; 231: 1133-1136Crossref PubMed Scopus (34) Google Scholar), growth hormone(13de Vos A.M. Ultsch M. Kossiakoff A.A. Science. 1992; 255: 306-312Crossref PubMed Scopus (2029) Google Scholar), and probably thrombopoietin(14de Sauvage F.J. Hass P.E. Spencer S.D. Malloy B.E. Gurney A.L. Spencer S.A. Darbonne W.C. Henzel W.J. Wong S.C. Kuang W.-J. Oles K.J. Hultgren B. Solberg Jr., L.A. Goeddel D.V. Eaton D.L. Nature. 1994; 369: 533-538Crossref PubMed Scopus (1225) Google Scholar, 15Lok S. Kaushansky K. Holly R.D. Kuijper J.L. Lofton-Day C.E. Oort P.J. Grant F.J. Heipel M.D. Burkhead S.K. Kramer J.M. Bell L.A. Sprecher C.A. Blumberg H. Johnson R. Prunkard D. Ching A.F.T. Mathewes S.L. Bailey M.C. Forstrom J.W. Buddle M.M. Osborn S.G. Evans S.J. Sheppard P.O. Presnell S.R. O'Hara P.J. Hagen F.S. Roth G.J. Foster D.C. Nature. 1994; 369: 565-568Crossref PubMed Scopus (1044) Google Scholar). interleukin α1-acid glycoprotein acute phase protein chloramphenicol acetyltransferase distal regulatory element erythropoietin granulocyte-colony stimulatory factor growth hormone gel mobility shift assay glucocorticoid response element haptoglobin hematopoietin receptor response element cytokine response element Janus kinase leukemia inhibitory factor interferon receptor prolactin sis-inducible element sis-inducible factor signal transducer and activator of transcription. Each hematopoietin receptor has been associated with control of proliferation of hematopoietic cells. A modulating effect on transcription of early growth response genes, such as c-fos, c-jun, junB, and c-myc, has been demonstrated for several of these receptors(10Ziegler S.F. Bird T.A. Morella K.K. Mosley D. Gearing D. Baumann H. Mol. Cell. Biol. 1993; 13: 2384-2390Crossref PubMed Scopus (111) Google Scholar, 16Shibuya H. Yoneyama M. Ninomiya-Tsuji J. Matsumoto K. Taniguchi T. Cell. 1992; 70: 57-67Abstract Full Text PDF PubMed Scopus (210) Google Scholar, 17Sato N. Salamaki K. Terada N. Arai K. Miyajima A. EMBO J. 1993; 12: 4181-4189Crossref PubMed Scopus (330) Google Scholar, 18Fukunaga R. Ishizaka-Ikeda E. Nagata S. Cell. 1993; 74: 1079-1087Abstract Full Text PDF PubMed Scopus (237) Google Scholar, 19Miura O. Cleveland J.L. Ihle J.N. Mol. Cell. Biol. 1993; 13: 1788-1795Crossref PubMed Scopus (136) Google Scholar, 20Minami Y. Oishi I. Liu Z.-J. Nakagawa S. Miyazaki T. Taniguchi T. J. Immunol. 1994; 152: 5680-5690PubMed Google Scholar). However, the function of hematopoietin receptors, whose expression has been maintained during the course of cell differentiation, appears to involve the transcriptional control of differentiated genes such as neuropeptide genes by LIF and CNTF in neuronal cells(21Rao M.S. Symes A. Malik N. Sohyab M. Fink J.S. Landis S.C. Neuroreport. 1992; 3: 865-868Crossref PubMed Scopus (49) Google Scholar, 22Rao M.S. Tyrrell S. Landis S.C. Patterson P.H. Dev. Biol. 1992; 150: 281-293Crossref PubMed Scopus (141) Google Scholar), genes for myeloperoxidase, elastase, and G-CSFR by G-CSF in granulocytes(18Fukunaga R. Ishizaka-Ikeda E. Nagata S. Cell. 1993; 74: 1079-1087Abstract Full Text PDF PubMed Scopus (237) Google Scholar, 23Steinman R.A. Tweardy D.J. Blood. 1994; 83: 119-127Crossref PubMed Google Scholar, 24Bancroft G.J. Curr. Opin. Immunol. 1994; 5: 503-510Crossref Scopus (282) Google Scholar, 25Tripp C.S. Wolf S.F. Unanue E.R. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 3725-3729Crossref PubMed Scopus (754) Google Scholar), cytokine genes by IL-2, IL-15, and IL-12 in NK cells(24Bancroft G.J. Curr. Opin. Immunol. 1994; 5: 503-510Crossref Scopus (282) Google Scholar, 25Tripp C.S. Wolf S.F. Unanue E.R. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 3725-3729Crossref PubMed Scopus (754) Google Scholar, 26Carson W.E. Giri J.G. Lindemann M.J. Linett M.C. Ahdieh M. Anderson D. Eisenmann J. Grabstein K. Caligiuri M.A. J. Exp. Med. 1994; 180: 1395-1403Crossref PubMed Scopus (971) Google Scholar), or acute phase plasma protein genes by IL-6-type cytokines in hepatic cells(27Baumann H. Marinkovic-Pajovic S. Won K.-A. Jones V.E. Campos S.P. Jahreis G.P. Morella K.K. Polyfunctional Cytokines: IL-6 and LIF. Vol. 167. Wiley, Chichester, UK1992: 100-124Google Scholar). A major unanswered question is whether the regulation of proliferation and of differentiated gene expression by a given hematopoietin receptor is mediated by identical or distinct signal-transducing mechanisms. The intracellular initiation of signal transduction by ligand-occupied hematopoietin receptors involves an immediate phosphorylation of the receptor cytoplasmic domain concomitant with the activation of receptor-associated protein tyrosine kinases. These protein tyrosine kinases, depending upon the cell type, include members of the Janus kinase family (JAK/Tyk) (28Darnell Jr., J.E. Kerr I.M. Stark G.R. Science. 1994; 264: 1415-1421Crossref PubMed Scopus (5062) Google Scholar, 29Ihle J.N. Witthuhn B.A. Quelle F.W. Yamamoto K. Thierfelder W.E. Kreider B. Silvennoinen O. Trends Biochem. Sci. 1994; 19: 222-227Abstract Full Text PDF PubMed Scopus (598) Google Scholar) and src-related protein tyrosine kinases(30Hatakeyama M. Mori H. Doi T. Taniguchi T. Cell. 1989; 59: 837-845Abstract Full Text PDF PubMed Google Scholar, 31Torrigoe T. Saragovi H.V. Reed J.C. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 2674-2678Crossref PubMed Scopus (86) Google Scholar, 32Ernst M. Gearing D.P. Dunn A.R. EMBO J. 1994; 13: 1574-1584Crossref PubMed Scopus (139) Google Scholar, 33Corey S.J. Burkhardt A.L. Bolen J.B. Geahlen R.L. Tkatch L.S. Tweardy D.J. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 4683-4687Crossref PubMed Scopus (207) Google Scholar). The change in the phosphorylation state of the receptor promotes the binding of the STAT (signal transducer and activation of transcription) proteins to the receptor(28Darnell Jr., J.E. Kerr I.M. Stark G.R. Science. 1994; 264: 1415-1421Crossref PubMed Scopus (5062) Google Scholar, 29Ihle J.N. Witthuhn B.A. Quelle F.W. Yamamoto K. Thierfelder W.E. Kreider B. Silvennoinen O. Trends Biochem. Sci. 1994; 19: 222-227Abstract Full Text PDF PubMed Scopus (598) Google Scholar). One of the consequences of protein tyrosine kinase action is the phosphorylation of the receptor-recruited STAT protein(s) that lead to the STAT protein dimerization and activation of DNA binding activity (34Shuai K. Horvath C.M. Tsai-Huang L.H. Qureshi S. Cowburn D. Darnell Jr., J.E. Cell. 1994; 76: 821-827Abstract Full Text PDF PubMed Scopus (687) Google Scholar). STAT protein complexes binding to the sis-inducible element (SIE) of the c-fos gene, termed SIF, for example, has been recognized to be a common target of growth factors and hematopoietin receptor signals(35Sadowski H.B. Shuai K. Darnell Jr., J.E. Gilman M.Z. Science. 1993; 261: 1739-1744Crossref PubMed Scopus (642) Google Scholar). Components of the DNA-bound complexes include dimers of STAT-1, primarily activated by IFNγ(36Fu X.-Y. Schindler C. Improta T. Albersold R.H. Darnell Jr., J.E. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 7840-7843Crossref PubMed Scopus (453) Google Scholar), STAT-3 (or APFR) (34Shuai K. Horvath C.M. Tsai-Huang L.H. Qureshi S. Cowburn D. Darnell Jr., J.E. Cell. 1994; 76: 821-827Abstract Full Text PDF PubMed Scopus (687) Google Scholar, 37Zhong Z. Wen Z. Darnell Jr., J.E. Science. 1994; 264: 95-98Crossref PubMed Scopus (1735) Google Scholar, 38Akira S. Nishio Y. Inoue M. Wang X.-J. Wei S. Matsusaka T. Yoshida K. Sudo T. Naruto M. Kishimoto T. Cell. 1994; 77: 63-71Abstract Full Text PDF PubMed Scopus (877) Google Scholar) activated by IL-6-type cytokine, STAT-5 activated by prolactin(39Wakao H. Gouilleux F. Groner B. EMBO J. 1994; 13: 2182-2191Crossref PubMed Scopus (717) Google Scholar), and IL-4 STAT (or STAT-6) activated by IL-4(40Kotanides H. Reich N.C. Science. 1993; 262: 1265-1267Crossref PubMed Scopus (231) Google Scholar, 41Hou J. Schindler U. Henzel W.J. Ho T.C. Brasseur M. McKnight S.L. Science. 1994; 265: 1701-1706Crossref PubMed Scopus (731) Google Scholar). Structure/function analyses of hematopoietin receptor subunits suggest that distinct subregions of the cytoplasmic domains of the signaling receptor subunits control specific cell responses, such as the regulation of early growth response genes by IL-2Rβ (20Minami Y. Oishi I. Liu Z.-J. Nakagawa S. Miyazaki T. Taniguchi T. J. Immunol. 1994; 152: 5680-5690PubMed Google Scholar, 42Asao H. Takeshita T. Ishii N. Kumaki S. Nakamura M. Sugamura K. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 4127-4131Crossref PubMed Scopus (114) Google Scholar) and IL-3Rβ (as part of the GM-CSFR)(17Sato N. Salamaki K. Terada N. Arai K. Miyajima A. EMBO J. 1993; 12: 4181-4189Crossref PubMed Scopus (330) Google Scholar), and differentiated genes in monocytic, neuroblastoma, and hepatic cells by gp130, LIFR, and G-CSFR (7Murakami M. Hibi M. Nakagawa N. Nakagawa T. Yasukama K. Yamanishi K. Taga T. Kishimoto T. Science. 1993; 260: 1808-1810Crossref PubMed Scopus (645) Google Scholar, 9Fukunaga R. Ishizaka-Ikeda E. Pan C.X. Seto Y. Nagata S. EMBO J. 1991; 10: 2855-2865Crossref PubMed Scopus (271) Google Scholar, 10Ziegler S.F. Bird T.A. Morella K.K. Mosley D. Gearing D. Baumann H. Mol. Cell. Biol. 1993; 13: 2384-2390Crossref PubMed Scopus (111) Google Scholar, 43Baumann H. Symes A.J. Comeau M.R. Morella K.K. Wang Y. Friend D. Ziegler S.F. Fink J.S. Gearing D. Mol. Cell. Biol. 1994; 14: 138-146Crossref PubMed Google Scholar). To assess the complexity of intracellular signaling pathways which are activated by various hematopoietin receptor types and which control expression of differentiated genes, we developed tissue culture systems in which receptor-specific gene regulatory functions were reconstituted(44Baumann H. Ziegler S.F. Mosley B. Morella K.K. Pajovic S. Gearing D.P. J. Biol. Chem. 1993; 268: 8414-8417Abstract Full Text PDF PubMed Google Scholar, 45Baumann H. Gearing D. Ziegler S.F. J. Biol. Chem. 1994; 269: 16297-16304Abstract Full Text PDF PubMed Google Scholar). By applying this experimental approach, we have established a sensitive assay system for defining common signaling mechanisms utilized by seemingly related receptor structures. In this study, we used rat and human hepatoma, L-, and COS cells for probing the interaction of IL-2R and representative members of the other hematopoietin receptor groups with the intracellular signal transduction machinery. Receptor functions were determined in rat hepatoma H-35 cells (subclonal line of clone T-7-18; (46Baumann H. Prowse K.R. Marinkovic S. Won K.-A. Jahreis G.P. Ann. N. Y. Acad. Sci. 1989; 557: 280-297Crossref PubMed Scopus (199) Google Scholar)), human HepG2 cells(47Knowles B.B. Howe C.C. Aden D.P. Science. 1980; 209: 497-499Crossref PubMed Scopus (1508) Google Scholar), COS-1 cells and mouse L(tk−) cells. The cells were cultured in Dulbecco's modified Eagle's medium (H-35 and L-cells) or minimal essential medium (HepG2 and COS-1 cells) containing 10% fetal calf serum, penicillin, streptomycin, and gentamycin. For comparison of SIF activation, we used CTLL-2 cells which were cultured in RPMI containing 10% fetal calf serum supplemented with 250 units/ml IL-2. The cells were transferred to IL-2-free medium 16 h prior to restimulation with IL-2. Dr. William Carlson, RPCI, provided highly enriched fractions (≥97%) of human NK cells (CD56+ CD3−) prepared from peripheral blood leukocytes as described(26Carson W.E. Giri J.G. Lindemann M.J. Linett M.C. Ahdieh M. Anderson D. Eisenmann J. Grabstein K. Caligiuri M.A. J. Exp. Med. 1994; 180: 1395-1403Crossref PubMed Scopus (971) Google Scholar, 48Matos M. Schnier G. Beecher M.S. Ashman L. Williams D. Caligiuri M.A. J. Exp. Med. 1993; 178: 1079-1084Crossref PubMed Scopus (130) Google Scholar). All cytokine treatments occurred in serum-free minimal essential medium. Purified human recombinant cytokines were used at the following concentrations except where otherwise indicated: 100 ng/ml IL-2 (Cetus Corp.), IL-15, G-CSF, LIF (Immunex Corp.), IL-6 (Genetics Institute), and growth hormone (Genentech); 40 units/ml of Epo (Amgen); 10 ng of IFNγ (Genentech) and 0.5 ng/ml IL-1β (Immunex Corp.). Ligand-independent activation of G-CSFR-gp130 (49Baumann H. Strassmann G. J. Immunol. 1993; 151: 1456-1462PubMed Google Scholar) was achieved by 0.5 mM suramin (provided by Dr. G. Strassmann, Otsuka America Pharmaceutical). IL-2Rα function was inhibited by adding 1 μg/ml anti-TAC (= anti-IL-2Rα) (provided by Dr. Steven Greenberg, RPCI) to the assay medium containing the cytokines. Control cultures received nonspecific immunoglobulins. The expression vectors used in this study are summarized in Table 1, and several of these have been described before: human G-CSFR (isoform D7 or 130-amino acid residue full-length cytoplasmic domain(50Larsen A. Davis T. Curtis B.M. Gimpel S. Sims J.E. Cosman D. Park L. Sorensen E. Mach C.J. Smith C.A. J. Exp. Med. 1990; 172: 1559-1570Crossref PubMed Scopus (169) Google Scholar)), G-CSFR with truncated cytoplasmic domains to 96, 56, 27, and 1 (=Δcyto) amino acid residues(10Ziegler S.F. Bird T.A. Morella K.K. Mosley D. Gearing D. Baumann H. Mol. Cell. Biol. 1993; 13: 2384-2390Crossref PubMed Scopus (111) Google Scholar), IL-2Rβ(51Hatakeyama M. Tsudo M. Minamoto S. Kono T. Doi T. Miyata T. Miyasaka M. Taniguchi T. Science. 1989; 244: 551-556Crossref PubMed Scopus (562) Google Scholar), IL-2Rγ 2Ziegler, S. F., Morella, K. K., Anderson, D., Kumaki, N., Leonard, W. J., Cosman, D., and Baumann, H.(1995) Eur. J. Immunol., in press. (52Takeshita T. Asao H. Ohtani K. Ishii N. Kumaki S. Tanaka N. Munakata H. Nakamura M. Sugamura K. Science. 1992; 257: 379-382Crossref PubMed Scopus (813) Google Scholar), IL-2Rγ(Δcyto)(4Noguchi M. Adelstein S. Cao X. Leonard W.J. J. Biol. Chem. 1993; 268: 13601-13608Abstract Full Text PDF PubMed Google Scholar), IL-4R(53Mosley B. Beckmann M.P. March C.J. Idzerda R.L. Gimpel S.D. Vanden Bos T. Friend D. Alpert A. Anderson D. Jackson J. Wignall J.M. Smith C. Gallis B. Sims J.E. Urdal D. Widmer M.B. Cosman D. Park L.S. Cell. 1989; 59: 335-348Abstract Full Text PDF PubMed Scopus (487) Google Scholar), IL-7R(54Goodwin R.G. Friend D. Ziegler S.F. Jerzy R. Falk B.A. Gimpel S. Cosman D. Dower S.K. March C.J. Namen A.E. Park L.S. Cell. 1990; 60: 941-951Abstract Full Text PDF PubMed Scopus (489) Google Scholar), and murine EpoR(55Witthuhn B.A. Quelle F.W. Silvennoinen O. Yi T. Tang B. Miura D. Ihle J.N. Cell. 1993; 74: 227-236Abstract Full Text PDF PubMed Scopus (1008) Google Scholar). The chimeric receptor constructs contained the extracellular domain of G-CSFR and the transmembrane and cytoplasmic domains of the following receptors: full-length or 150-amino acid residues of human LIFR (G-CSFR-LIFR and G-CSFR-LIFR(150))(43Baumann H. Symes A.J. Comeau M.R. Morella K.K. Wang Y. Friend D. Ziegler S.F. Fink J.S. Gearing D. Mol. Cell. Biol. 1994; 14: 138-146Crossref PubMed Google Scholar), gp130 (G-CSFR-gp130)(43Baumann H. Symes A.J. Comeau M.R. Morella K.K. Wang Y. Friend D. Ziegler S.F. Fink J.S. Gearing D. Mol. Cell. Biol. 1994; 14: 138-146Crossref PubMed Google Scholar), c-mpl (G-CSFR-MPL)(56Vigon I. Florindo C. Fichelson S. Guenet J.-L. Mattei M.G. Souyri M. Cosman D. Gisselbrecht S. Oncogene. 1993; 8: 2607-2615PubMed Google Scholar), and IL-2Rγ (G-CSFR-IL-2Rγ).2 G-CSFR-IL-2Rβ was constructed as follows. The polymerase chain reaction primer pair, (5′) GCTGAATTCCTGGGAAGGACACC and (3′) TATGCGGCCGCTACACCAAGTGAGTTGG, was used to synthesize the transmembrane and cytoplasmic domain of the human IL-2Rβ(51Hatakeyama M. Tsudo M. Minamoto S. Kono T. Doi T. Miyata T. Miyasaka M. Taniguchi T. Science. 1989; 244: 551-556Crossref PubMed Scopus (562) Google Scholar). The fragment was digested with EcoRI and NotI, ligated with Asp718-EcoRI-digested fragment encoding the extracellular domain of G-CSFR, and then inserted into pCD302(53Mosley B. Beckmann M.P. March C.J. Idzerda R.L. Gimpel S.D. Vanden Bos T. Friend D. Alpert A. Anderson D. Jackson J. Wignall J.M. Smith C. Gallis B. Sims J.E. Urdal D. Widmer M.B. Cosman D. Park L.S. Cell. 1989; 59: 335-348Abstract Full Text PDF PubMed Scopus (487) Google Scholar). The expression vectors for human IL-2Rα(57Leonard W.J. Pepper J.M. Crabtree G.R. Rudikoff S. Pumphrey J. Robb R.J. Soetlik P.B. Pfeffer N. Waldmann T.A. Greene W.C. Nature. 1984; 311: 626-631Crossref PubMed Scopus (607) Google Scholar), rabbit GHR (provided by Dr. W. I. Wood, Genentech), and mouse JAK3 (58Witthuhn B.A. Silvennoinen O. Miura O. Lal K.S. Cwik C. Liu E.T. Ihle J.N. Nature. 1994; 370: 153-157Crossref PubMed Scopus (538) Google Scholar) were constructed by inserting the blunt-ended full-length cDNA into the SmaI site of pCD(59Pruitt S.C. Gene (Amst.). 1988; 66: 121-134Crossref PubMed Scopus (22) Google Scholar).Table I Open table in a new tab Cytokine response was defined by the stimulation of the CAT gene constructs listed in Table 1. The CAT gene constructs with the AGP gene-derived elements included pAGP(3 × DRE)-GRE-CAT (containing 3 copies of the 142-base pair distal regulatory elements linked to the promoter region −120 to +20 of the rat AGP gene; (66Prowse K.R. Baumann H. Mol. Cell. Biol. 1988; 8: 42-51Crossref PubMed Scopus (77) Google Scholar)), p(4 × CytRE)-SV-CAT and p(4 × IL-1RE)-SV-CAT (containing 4 tandem copies of the region AB (=CytRE or 1-62 of the DRE) and IL-1RE (1-36 of the DRE), respectively, 5′ to the minimal SV40 promoter in pSV-CAT; (60Won K.-A. Baumann H. Mol. Cell. Biol. 1990; 10: 3965-3978Crossref PubMed Google Scholar)). The IL-6 signal-specific reporter gene constructs were pHX(5 × IL-6RE)-CAT containing 5 tandem copies of the IL-6RE of the rat hemopexin gene in the Bgl2 site of pCAT promoter vector (Promega)(61Immenschuh S. Nagae Y. Satoh H. Baumann H. Muller-Eberhard U. J. Biol. Chem. 1994; 269: 12654-12661Abstract Full Text PDF PubMed Google Scholar); pHP(5 × IL-6RE)-CAT containing 5 tandem copies of the B-element core sequence of the rat haptoglobin gene (62Marinkovic S. Baumann H. Mol. Cell. Biol. 1990; 10: 1573-1583Crossref PubMed Scopus (89) Google Scholar) 5′-GATCCGTGGTTACTGGAACAGTA-3′ into the Bgl2 site of pCAT, and pβFB(350)-CAT containing 350 base pairs of the 5′-flanking region of the rat β-fibrinogen gene in pOCAT(63Baumann H. Jahreis G.P. Morella K.K. J. Biol. Chem. 1990; 265: 22275-22281Abstract Full Text PDF PubMed Google Scholar). For testing the signaling by nonhepatic receptors, we also included p(4 × SIE)-CAT (containing 4 tandem copies of the high affinity SIEm67 5′-GATCCATTTCCCGTAAATCA-3′ (35Sadowski H.B. Shuai K. Darnell Jr., J.E. Gilman M.Z. Science. 1993; 261: 1739-1744Crossref PubMed Scopus (642) Google Scholar) in the Bgl2 site of pCAT); 3C.-F. Lai, S. Immenschuh, D. P. Gearing, S. F. Ziegler, and H. Baumann, submitted for publication. and pHRRE-CAT (containing 8 tandem copies of the modified IL-6RE/APRE sequence, 5′-GATCCATCCTTCTGGGAATTCTGATCA-3′ in the Bgl2 site of pCAT vector.3 H-35, L-, and COS-1 cells were transfected as described previously (45Baumann H. Gearing D. Ziegler S.F. J. Biol. Chem. 1994; 269: 16297-16304Abstract Full Text PDF PubMed Google Scholar) by using the DEAE-dextran method (64Lopata M.A. Cleveland D.W. Sollner-Webb H. Nucleic Acids Res. 1984; 12: 5707-5717Crossref PubMed Scopus (517) Google Scholar) and HepG2 cells by the calcium phosphate method(65Graham F.L. Van der Eb A.J. Virology. 1973; 52: 456-461Crossref PubMed Scopus (6499) Google Scholar). For CAT gene expression analysis, the cells were transfected with plasmid DNA mixtures (10 μg in 1 ml per 10-cm dish), consisting of 6.6 μg of CAT plasmid, 1 μg of receptor expression vectors, and, where required, supplemented with pCD-JAK3 or empty expression vectors. pIE-MUP (1.3 μg) served as an internal transfection marker(66Prowse K.R. Baumann H. Mol. Cell. Biol. 1988; 8: 42-51Crossref PubMed Scopus (77) Google Scholar). After a 16-h recovery period, the transfected cell culture was subdivided into a 6-well cluster plate, and, 24 h later, the subcultures were treated with cytokines for 24 h. The CAT activities in cell extracts were determined and normalized to the amount of the major urinary proteins derived from pIE-MUP (44Baumann H. Ziegler S.F. Mosley B. Morella K.K. Pajovic S. Gearing D.P. J. Biol. Chem. 1993; 268: 8414-8417Abstract Full Text PDF PubMed Google Scholar, 66Prowse K.R. Baumann H. Mol. Cell. Biol. 1988; 8: 42-51Crossref PubMed Scopus (77) Google Scholar) and the values expressed relative to the untreated control cultures (defined as 1.0). For analyzing receptor expression and SIF activation, L- and COS-1 cells in 15-cm diameter culture dishes were transfected with 30 μg of receptor expression vector in 3 ml. The transfected cultures were subdivided and, after a 24-h recovery, maintained for an additional 16 h in serum-free medium. Cytokine treatments were then carried out for 15 min (except where indicated). Whole cell, cytosolic, and nuclear extracts were prepared according to the procedure of Sadowski et al.(35Sadowski H.B. Shuai K. Darnell Jr., J.E. Gilman M.Z. Science. 1993; 261: 1739-1744Crossref PubMed Scopus (642) Google Scholar). The double-stranded SIEm67 oligonucleotide was labeled by fill-in reaction using Klenow fragment of polymerase α and [32P]dCTP. Whole cell extracts (5 μl) or nuclear proteins (10 μg) were preincubated in a 20-μl reaction volume with 5 μg of poly(dI-dC) for 15 min on ice followed by the addition of labeled probe (20,000 cpm), and the binding reaction continued for 15 min at room temperature. Ten μl of the reaction mixture were loaded onto a 4% polyacrylamide gel in 0.5 × Tris borate EDTA buffer. In all GMSA experiments, a binding reaction with nuclear extracts from H-35 cells treated for 15 min with IL-6 was included as an internal standard. The radioactive pattern was visualized by autoradiography. RNA was extracted from cells 40-48 h after transfection (67Chirgwin J.M. Przybyla A.E. MacDonald R.J. Rutter W.J. Biochemistry. 1979; 18: 5294-5299Crossref PubMed Scopus (16652) Google Scholar). Twenty μg of total cell RNA were separated on formaldehyde-containing agarose gel, transferred to nitrocellulose membrane, and hybridized to 32P-labeled cDNA encoding IL-2Rβ, IL-2Rγ, or JAK3(58Witthuhn B.A. Silvennoinen O. Miura O. Lal K.S. Cwik C. Liu E.T. Ihle J.N. Nature. 1994; 370: 153-157Crossref PubMed Scopus (538) Google Scholar), a 1-kilobase Asp718-EcoRI cDNA fragment encoding the extracellular domain of G-CSFR(45Baumann H. Gearing D. Ziegler S.F. J. Biol. Chem. 1994; 269: 16297-16304Abstract Full Text PDF PubMed Google Scholar). To identify the expression of the chimeric G-CSFR protein, transfected cells were washed three times with phosphate-buffered saline, scraped off the dish, and collected by centrifugation. Cells were solubilized in lysis buffer (106 cells per 100 μl) containing 50 mM Tris, 150 mM NaCl, 1% Triton X-100, 0.5 mM Na3VO4, 1 mM phenylmethylsulfonyl fluoride, 1 mM EDTA, 10 μg of aprotinin, and 10 μg of leupeptin. After 20 min on ice, the extracts were centrifuged for 10 min at 25,000 × g. The supernatants were pretreated with 20 μl of Protein G-Sepharose beads (Pharmacia Biotech Inc.) for 1 h and then reacted for 16 h with 5 μl of rabbit anti-human G-CSFR serum(33Corey S.J. Burkhardt A.L. Bolen J.B. Geahlen R.L. Tkatch L.S. Tweardy D.J. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 4683-4687Crossref PubMed Scopus (207) Google Scholar). The immune complexes were collected on Protein G-Sepharose beads and eluted by washing four times with lysis buffer. After solubilization by boiling in SDS sample buffer, proteins were separated on a 6% SDS-polyacrylamide gel and electroblotted onto Immobilon membrane (Millipore). The membrane was incubated for 6 h with sheep anti-human G-CSFR. This sheep antiserum was generated in collaboration with Greystone Therapeutics, Inc. by intranodal injection of maltose binding protein fused to the extracellular domain of human G-CSFR (residues 48 to 316). The membrane was then treated with rabbit anti-goat immunoglobulin followed by alkaline phosphatase-conjugated goat anti-rabbit immunoglobulin (Bio-Rad). The Western blot was developed with a 5-bromo-4-chloro-3-indolyl phosphat" @default.
• W2143655571 created "2016-06-24" @default.
• W2143655571 creator A5005215310 @default.
• W2143655571 creator A5011770851 @default.
• W2143655571 creator A5012558697 @default.
• W2143655571 creator A5019661712 @default.
• W2143655571 creator A5023671322 @default.
• W2143655571 creator A5031281083 @default.
• W2143655571 creator A5032330582 @default.
• W2143655571 creator A5033429257 @default.
• W2143655571 creator A5038597237 @default.
• W2143655571 creator A5050390918 @default.
• W2143655571 creator A5063519553 @default.
• W2143655571 creator A5071331596 @default.
• W2143655571 creator A5075582179 @default.
• W2143655571 creator A5079781502 @default.
• W2143655571 creator A5086210315 @default.
• W2143655571 date "1995-04-01" @default.
• W2143655571 modified "2023-10-16" @default.
• W2143655571 title "The Action of Interleukin-2 Receptor Subunits Defines a New Type of Signaling Mechanism for Hematopoietin Receptors in Hepatic Cells and Fibroblasts" @default.
• W2143655571 cites W1482697637 @default.
• W2143655571 cites W1482774511 @default.
• W2143655571 cites W1494986506 @default.
• W2143655571 cites W1496753957 @default.
• W2143655571 cites W1520825376 @default.
• W2143655571 cites W1549718325 @default.
• W2143655571 cites W1561546882 @default.
• W2143655571 cites W1567604499 @default.
• W2143655571 cites W1583763012 @default.
• W2143655571 cites W1587018460 @default.
• W2143655571 cites W1590620778 @default.
• W2143655571 cites W1606610410 @default.
• W2143655571 cites W1694771231 @default.
• W2143655571 cites W1835174359 @default.
• W2143655571 cites W1844649556 @default.
• W2143655571 cites W1932590521 @default.
• W2143655571 cites W1942718916 @default.
• W2143655571 cites W1964323924 @default.
• W2143655571 cites W1965372133 @default.
• W2143655571 cites W1965375035 @default.
• W2143655571 cites W1967112185 @default.
• W2143655571 cites W1970197409 @default.
• W2143655571 cites W1971500432 @default.
• W2143655571 cites W1971908211 @default.
• W2143655571 cites W1972927903 @default.
• W2143655571 cites W1974656027 @default.
• W2143655571 cites W1979676829 @default.
• W2143655571 cites W1981799488 @default.
• W2143655571 cites W1983612778 @default.
• W2143655571 cites W1986763765 @default.
• W2143655571 cites W1989398126 @default.
• W2143655571 cites W1994584656 @default.
• W2143655571 cites W1999028040 @default.
• W2143655571 cites W2006073656 @default.
• W2143655571 cites W2018574052 @default.
• W2143655571 cites W2020211894 @default.
• W2143655571 cites W2025864476 @default.
• W2143655571 cites W2027076688 @default.
• W2143655571 cites W2027286533 @default.
• W2143655571 cites W2029275361 @default.
• W2143655571 cites W2030922722 @default.
• W2143655571 cites W2031535630 @default.
• W2143655571 cites W2034974668 @default.
• W2143655571 cites W2037540469 @default.
• W2143655571 cites W2038260402 @default.
• W2143655571 cites W2043803403 @default.
• W2143655571 cites W2044331993 @default.
• W2143655571 cites W2048268320 @default.
• W2143655571 cites W2052172628 @default.
• W2143655571 cites W2052779439 @default.
• W2143655571 cites W2057204569 @default.
• W2143655571 cites W2058211248 @default.
• W2143655571 cites W2059782202 @default.
• W2143655571 cites W2060333964 @default.
• W2143655571 cites W2062005942 @default.
• W2143655571 cites W2063814906 @default.
• W2143655571 cites W2070395474 @default.
• W2143655571 cites W2070983284 @default.
• W2143655571 cites W2072252693 @default.
• W2143655571 cites W2072585523 @default.
• W2143655571 cites W2083878154 @default.
• W2143655571 cites W2094111001 @default.
• W2143655571 cites W2096746841 @default.
• W2143655571 cites W2097069418 @default.
• W2143655571 cites W2109389988 @default.
• W2143655571 cites W2120056767 @default.
• W2143655571 cites W2126707217 @default.
• W2143655571 cites W2130166519 @default.
• W2143655571 cites W2134818464 @default.
• W2143655571 cites W2138658167 @default.
• W2143655571 cites W2139613570 @default.
• W2143655571 cites W2149563853 @default.
• W2143655571 cites W2153011776 @default.
• W2143655571 cites W2167951497 @default.
• W2143655571 cites W2176790322 @default.
• W2143655571 cites W2399702748 @default.
• W2143655571 cites W2403213121 @default.
• W2143655571 cites W4235751459 @default.

• next