FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2144015228> ?p ?o ?g. }

• W2144015228 endingPage "1103" @default.
• W2144015228 startingPage "1098" @default.
• W2144015228 abstract "We report mutations in the gene for topoisomerase I–binding RS protein (TOPORS) in patients with autosomal dominant retinitis pigmentosa (adRP) linked to chromosome 9p21.1 (locus RP31). A positional-cloning approach, together with the use of bioinformatics, identified TOPORS (comprising three exons and encoding a protein of 1,045 aa) as the gene responsible for adRP. Mutations that include an insertion and a deletion have been identified in two adRP-affected families—one French Canadian and one German family, respectively. Interestingly, a distinct phenotype is noted at the earlier stages of the disease, with an unusual perivascular cuff of retinal pigment epithelium atrophy, which was found surrounding the superior and inferior arcades in the retina. TOPORS is a RING domain–containing E3 ubiquitin ligase and localizes in the nucleus in speckled loci that are associated with promyelocytic leukemia bodies. The ubiquitous nature of TOPORS expression and a lack of mutant protein in patients are highly suggestive of haploinsufficiency, rather than a dominant negative effect, as the molecular mechanism of the disease and make rescue of the clinical phenotype amenable to somatic gene therapy. We report mutations in the gene for topoisomerase I–binding RS protein (TOPORS) in patients with autosomal dominant retinitis pigmentosa (adRP) linked to chromosome 9p21.1 (locus RP31). A positional-cloning approach, together with the use of bioinformatics, identified TOPORS (comprising three exons and encoding a protein of 1,045 aa) as the gene responsible for adRP. Mutations that include an insertion and a deletion have been identified in two adRP-affected families—one French Canadian and one German family, respectively. Interestingly, a distinct phenotype is noted at the earlier stages of the disease, with an unusual perivascular cuff of retinal pigment epithelium atrophy, which was found surrounding the superior and inferior arcades in the retina. TOPORS is a RING domain–containing E3 ubiquitin ligase and localizes in the nucleus in speckled loci that are associated with promyelocytic leukemia bodies. The ubiquitous nature of TOPORS expression and a lack of mutant protein in patients are highly suggestive of haploinsufficiency, rather than a dominant negative effect, as the molecular mechanism of the disease and make rescue of the clinical phenotype amenable to somatic gene therapy. Retinitis pigmentosa (RP) is a clinically and genetically heterogeneous disorder with an incidence of 1 in 3,500, or a total of 1.8 million people affected worldwide. Affected individuals experience a progressive degeneration of the photoreceptors, which eventually results in severe visual impairment. The mode of inheritance of RP can be autosomal dominant (adRP), autosomal recessive, X linked, or digenic.1Rivolta C Sharon D DeAngelis MM Dryja TP Retinitis pigmentosa and allied diseases: numerous diseases, genes, and inheritance patterns.Hum Mol Genet. 2002; 11: 1219-1227Crossref PubMed Google Scholar To date, at least 16 causative genes have been identified for adRP (RetNet) (MIM numbers 114760, 602225, 607643, 602275, 146690, 604485, 162080, 607301, 607300, 606419, 179605, 180380, 180721, 603937, 607331, and 607292), and the products of these genes are associated with photoreceptor structure; cellular function, including the phototransduction cascade; or gene expression, including transcription and mRNA splicing.2Hims MM Diager SP Inglehearn CF Retinitis pigmentosa: genes, proteins and prospects.Dev Ophthalmol. 2003; 37: 109-125Crossref PubMed Scopus (93) Google Scholar Recently, we reported a new locus for adRP (RP31) in a three-generation family based in the province of Quebec, Canada.3Papaioannou M Chakarova CF Prescott Q Waseem N Theis T Lopez I Gill B Koenekoop RK Bhattacharya SS A new locus (RP31) for autosomal dominant retinitis pigmentosa maps to chromosome 9p.Hum Genet. 2005; 118: 501-503Crossref PubMed Scopus (14) Google Scholar After exclusion of all known loci for adRP, a genomewide search established positive linkage to a marker from the short arm of chromosome 9 (LOD score of 6.3 at recombination fraction q=0). The linked region is flanked by markers D9S157 and AFMe153td9 on 9p22-p21.1, corresponding to a physical distance of 15 Mb.3Papaioannou M Chakarova CF Prescott Q Waseem N Theis T Lopez I Gill B Koenekoop RK Bhattacharya SS A new locus (RP31) for autosomal dominant retinitis pigmentosa maps to chromosome 9p.Hum Genet. 2005; 118: 501-503Crossref PubMed Scopus (14) Google Scholar Since the previous report,3Papaioannou M Chakarova CF Prescott Q Waseem N Theis T Lopez I Gill B Koenekoop RK Bhattacharya SS A new locus (RP31) for autosomal dominant retinitis pigmentosa maps to chromosome 9p.Hum Genet. 2005; 118: 501-503Crossref PubMed Scopus (14) Google Scholar 17 members with RP from this family, ranging in age from 8 to 64 years, were clinically reexamined at the Montreal Children’s Hospital Research Institute. Age at onset of symptoms ranged from 10 to 50 years and differed between the generations, and three affected patients were found to be asymptomatic. Visual acuities (range 20/20 to finger counting) were maintained in most patients, since 16 of 17 had better than 20/40 acuity, and 11 of 17 had 20/20 acuity at the most recent visit. Visual-field sizes ranged from 10° to 80°, and electroretinography (ERG) abnormalities were highly variable as well, with early rod dysfunction followed by cone defects. The earliest sign of disease (found in four children) was an unusual perivascular cuff of retinal pigment epithelium (RPE) atrophy, which was found surrounding the superior and inferior arcades (fig. 1). This progressed to a diffuse pigmentary retinopathy with choroidal sclerosis. Three patients with the disease haplotype were asymptomatic and had completely normal retinal appearance; nonetheless, their ERG abnormalities were similar to those in the symptomatic patients. This phenotype differs significantly from the clinical diagnosis associated with the other 16 published adRP gene defects. A detailed description of the phenotype will be published elsewhere. Linkage analysis spanning the disease locus on chromosome 9p21 refined the genetic interval to 14 Mb between markers IVS4-46G (NP_060395.3) and AFMa153td9; this critical region contains 48 known and 5 novel (hypothetical) genes. The list of genes (in order from telomere to centromere of chromosome 9) that have been systematically screened includes NP_060395.3, RPS6, ASAH3L, SLC24A2, MllT3, KIAA1797, NP_001010915.1 IFNB1, IFNW1, IFNA21, IFNA4, IFNA14, IFNA10, IFNA17, IFNA5, KLHL9, IFNA6, NP_008831.2, IFNA2, IFNA8, IFNA1, Q8WTY6, NP_795372.1, MTAP, NSGX, NP_478102.1, CDKN2A, CDKN2B, DMRTA1, ELAVL2 TUSC1, NP_079104.2, PLAA, CCDC2, LRRC19, TEK, NP_065692.1, MOBKL2B, IFNK, NP_659442.2, NP_689783.1, Q5T776, ACO1, DDX58, TOPORS (MIM 609507), NDUFB6, TAF1L, and NP_997723.1 (Ensembl). All exons and their respective acceptor- and donor-splice sites were directly analyzed from the PCR products with the use of ABI BigDye terminator cycle sequencing kit v3.1 (Applied Biosystems) on an ABI 3100 Genetic Analyzer. Most of the genes encode proteins with well-documented functions. From this list of 53 genes, 2 were prioritized for immediate screening because of their specific expression and known retinal function: the gene encoding retinal cone Na-Ca+K-exchanger (SLC24A2 [MIM 609838]), which is abundantly expressed in cone photoreceptors and retinal ganglion cells,4Sharon D Yamamoto H McGee TL Rabe V Szerencsei RT Winkfein RJ Prinsen CF Barnes CS Andreasson S Fishman GA et al.Mutated alleles of the rod and cone Na-Ca+K-exchanger genes in patients with retinal diseases.Invest Ophthalmol Vis Sci. 2002; 43: 1971-1979PubMed Google Scholar and the gene encoding embryonic-lethal abnormal visual RNA-binding protein involved in growth, differentiation, and posttranscriptional gene expression (ELAVL2 [MIM 601673]), which plays an important role in RNA processing.5Antic D Keene JD Embryonic lethal abnormal visual RNA-binding proteins involved in growth, differentiation, and posttranscriptional gene expression.Am J Hum Genet. 1997; 61: 273-278Abstract Full Text PDF PubMed Scopus (209) Google Scholar No disease-causing mutations were identified in these two genes. We then continued with our systematic mutation screening of all expressed genes from the candidate region. Several of the genes contained sequence changes that were also identified in healthy unrelated controls, confirming that the variant is benign. Sequence analysis of one of the genes, TOPORS (MIM 609923, NM_005802), a 13-kb gene with three exons,6Haluska P Saleem A Rasheed Z Ahmed F Su EW Liu LF Rubin EH Interaction between human topoisomerase I and a novel RING finger/arginine-serine protein.Nucleic Acids Res. 1999; 27: 2538-2544Crossref PubMed Scopus (71) Google Scholar revealed a heterozygous 1-bp insertion (c.2474_2475insA) in exon 3; this frameshift mutation segregates with the affected status and is predicted to result in a premature stop codon (p.Tyr825fs) (fig. 2A and 2B). We also identified a second TOPORS mutation, a 2-bp deletion (c.2552_2553delGA) in exon 3 leading to p.Arg851fs, in a small German family (fig. 2C and 2D). We did not detect these changes in a control panel of 200 individuals of white origin. Primer sequences for mutation analysis of all three exons of TOPORS are listed in table 1. The presence of two distinct heterozygous frameshift mutations in two independent families strongly supports the argument that mutations in TOPORS are responsible for RP31. Sequencing of the coding regions of all other genes in the RP31 critical region revealed only nonpathogenic sequence variants. The second TOPORS mutation was identified as a result of our screening of a panel of 65 unrelated German patients with adRP attending the Retina Clinic at University Eye Hospital, Tubingen. On the basis of these preliminary findings, it is likely that TOPORS mutations are a rare cause of retinal degeneration.Table 1Primers Used for PCR Amplification of TOPORS ExonsPrimer Sequence (5′→3′)ExonProduct Size (bp)ForwardReverseTemperature (C°)1628CGTCAGGTTACCGTTGCCATATTGCATTGCAACTAG572616GGCTGAGTACCAGTAACCACCAATCCACAGGTGCG613a847AGTAATGGGTCACTTAAGAAGAACTGTAAGTTCACG503b901ATTCCTCAGTTTATGAGACTATCACCAGAACTGTAAG483c864CTTCTGACAGTTCAGATGGAGCTCTGGACAGAGTCC563d914TAGCAGTTGGTCCAGAAGTTGTAACTACATCTTTAG573e997CAGATCAAGGAGCCTGTCTAGTAAGCTGCTAGCAGTATC60 Open table in a new tab The TOPORS gene encodes a major transcript of 3.1 kb, which produces a multidomain protein of 1,045 aa with an N-terminal RING-type zinc-finger domain (amino acids 103–141); five stretches enriched in proline, glutamic acid, serine, and threonine (PEST) residues, which are frequently characteristic of rapidly degraded proteins7Weger S Hammer E Heilbronn R Topors, a p53 and topoisomerase I binding protein, interacts with the adeno-associated virus (AAV-2) Rep78/68 proteins and enhances AAV-2 gene expression.J Gen Virol. 2002; 83: 511-516Crossref PubMed Scopus (28) Google Scholar; a bipartite nuclear localization signal; and a region rich in Arg-Ser (RS)8Lorick KL Jensen JP Fang S Ong AM Hatakeyama S Weissman AM RING fingers mediate ubiquitin-conjugating enzyme (E2)-dependent ubiquitination.Proc Natl Acad Sci USA. 1999; 96: 11364-11369Crossref PubMed Scopus (916) Google Scholar (fig. 3A). RT-PCR analysis revealed a broad tissue expression of TOPORS in human tissues, including the retina (fig. 3B). To examine the effect of disease-associated mutations, we performed immunoblotting of whole lymphoblastoid cell lysates from both families in affected and unaffected individuals, using an N-terminus mouse monoclonal TOPORS antibody (Abnova). The full-length TOPORS-immunoreactive band of 150 kDa is present in the lymphocytes of control and affected individuals; however, the mutations are predicted to delete 221 aa (∼30 kDa) and 175 aa (∼25 kDa) from the C-terminus of the protein in the French Canadian and German families, respectively. As a result, the truncated protein is expected to have a theoretical molecular weight of 120–125 kDa. Our analysis did not detect the predicted truncated TOPORS-immunoreactive bands in patient lymphocytes, indicating that the mutant protein is relatively unstable (fig. 4). The absence of the truncated protein in patients from both families suggests haploinsufficiency, rather than a dominant negative effect, as the molecular basis of the disease. TOPORS was identified initially in a screen of proteins that bind to the N-terminus of topoisomerase I and then as a protein that interacts with p53.6Haluska P Saleem A Rasheed Z Ahmed F Su EW Liu LF Rubin EH Interaction between human topoisomerase I and a novel RING finger/arginine-serine protein.Nucleic Acids Res. 1999; 27: 2538-2544Crossref PubMed Scopus (71) Google Scholar, 9Zhou R Wen H Ao SZ Identification of a novel gene encoding a p53-associated protein.Gene. 1999; 235: 93-101Crossref PubMed Scopus (39) Google Scholar Like other RING domain–containing proteins, TOPORS is an E3 ubiquitin ligase with specific E2 enzymes, and it can ubiquitinate p53.10Rajendra R Malegaonkar D Pungaliya P Marshall H Rasheed Z Brownell J Liu LF Lutzker S Saleem A Rubin EH Topors functions as an E3 ubiquitin ligase with specific E2 enzymes and ubiquitinates p53.J Biol Chem. 2004; 279: 36440-36444Crossref PubMed Scopus (149) Google Scholar It also undergoes modification by the small ubiquitin-like modifier SUMO-1.11Weger S Hammer E Engstler M The DNA topoisomerase I binding protein topors as a novel cellular target for SUMO-1 modification: characterization of domains necessary for subcellular localization and sumolation.Exp Cell Res. 2003; 290: 13-27Crossref PubMed Scopus (39) Google Scholar It is located in nuclear speckles that closely associate with promyelocytic leukemia nuclear bodies—nuclear compartments that have been implicated in transcription, DNA repair, viral defense, stress, cell-cycle regulation, proteolysis, and apoptosis.12Rasheed ZA Saleem A Ravee Y Pandolfi PP Rubin EH The topoisomerase I-binding RING protein, topors, is associated with promyelocytic leukemia nuclear bodies.Exp Cell Res. 2002; 277: 152-160Crossref PubMed Scopus (41) Google Scholar, 13Borden KL Pondering the promyelocytic leukemia protein (PML) puzzle: possible functions for PML nuclear bodies.Mol Cell Biol. 2002; 22: 5259-5269Crossref PubMed Scopus (259) Google Scholar In Drosophila, Topors (dTopors) ubiquitinates and regulates the activity of the transcriptional repressor Hairy.14Secombe J Parkhurst SM Drosophila Topors is a RING finger-containing protein that functions as a ubiquitin-protein isopeptide ligase for the hairy basic helix-loop-helix repressor protein.J Biol Chem. 2004; 279: 17126-17133Crossref PubMed Scopus (13) Google Scholar It also interacts with proteins of the gypsy insulator protein complex, where its influence on insulator activity has been shown to depend on its ubiquitin ligase activity.15Capelson M Corces VG The ubiquitin ligase dTopors directs the nuclear organization of a chromatin insulator.Mol Cell. 2005; 20: 105-116Abstract Full Text Full Text PDF PubMed Scopus (81) Google Scholar TOPORS contains an RS domain, which is implicated in pre-mRNA splicing. Mutations in three other proteins involved in mRNA splicing (PRPF3, PRPC8, and PRPF31) are also associated with RP.16Chakarova CF Hims MM Bolz H Abu-Safieh L Patel RJ Papaioannou MG Inglehearn CF Keen TJ Willis C Moore AT et al.Mutations in HPRP3, a third member of pre-mRNA splicing factor genes, implicated in autosomal dominant retinitis pigmentosa.Hum Mol Genet. 2002; 11: 87-92Crossref PubMed Google Scholar, 17McKie AB McHale JC Keen TJ Tarttelin EE Goliath R van Lith-Verhoeven JJ Greenberg J Ramesar RS Hoyng CB Cremers FP et al.Mutations in the pre-mRNA splicing factor gene PRPC8 in autosomal dominant retinitis pigmentosa (RP13).Hum Mol Genet. 2001; 10: 1555-1562Crossref PubMed Scopus (215) Google Scholar, 18Vithana EN Abu-Safieh L Allen MJ Carey A Papaioannou M Chakarova C Al-Maghtheh M Ebenezer ND Willis C Moore AT et al.A human homolog of yeast pre-mRNA splicing gene, PRP31, underlies autosomal dominant retinitis pigmentosa on chromosome 19q13.4 (RP11).Mol Cell. 2001; 8: 375-381Abstract Full Text Full Text PDF PubMed Scopus (248) Google Scholar By binding to specific sequences on pre-mRNA and interacting with other splicing factors via their RS domain, SR proteins mediate different intraspliceosomal contacts, thereby helping in splice-site selection and spliceosome assembly. Binding of SR proteins to exonic (intronic) splicing enhancers (silencers) helps in recruitment of U1 snRNP to the 5′ splice site and U2 snRNP to the branch point sequence.19Lorkovic ZJ Lopato S Pexa M Lehner R Barta A Interactions of Arabidopsis RS domain containing cyclophilins with SR proteins and U1 and U11 small nuclear ribonucleoprotein-specific proteins suggest their involvement in pre-mRNA splicing.J Biol Chem. 2004; 279: 33890-33898Crossref PubMed Scopus (54) Google Scholar However, TOPORS nuclear speckles do not colocalize with nuclear splicing speckles that contain other SR proteins—for example, SC35.11Weger S Hammer E Engstler M The DNA topoisomerase I binding protein topors as a novel cellular target for SUMO-1 modification: characterization of domains necessary for subcellular localization and sumolation.Exp Cell Res. 2003; 290: 13-27Crossref PubMed Scopus (39) Google Scholar A recent genomewide survey revealed a large complexity of RS domain–containing proteins in metazoans with functions not only in pre-mRNA splicing but also in chromatin remodeling, transcription by RNA polymerase II, and cell-cycle progression. We therefore predict that TOPORS not only may be involved in mRNA processing but also may have a more complex array of functions in mammalian cells.20Cazalla D Newton K Caceres JF A novel SR-related protein is required for the second step of pre-mRNA splicing.Mol Cell Biol. 2005; 25: 2969-2980Crossref PubMed Scopus (50) Google Scholar It is possible that the process underlying RP31 pathogenesis might be distinct from those operating in other forms of adRP where mutations have previously been identified in structural proteins and in transcription and splicing factors. Elucidation of its function in retinal photoreceptors and, more important, studies of its expression in photoreceptors and protein interactions in retina may provide new insight into the molecular basis of retinal degenerations. Finally, as stated above, the lack of mutant TOPORS protein in patients in the families reported here is highly suggestive of haploinsufficiency as the molecular basis of the disease and therefore makes rescue of the disease phenotype amenable to somatic gene therapy. Should haploinsufficiency explain the disease mechanism, targeted increase in the level of the wild-type protein in photoreceptor cells of patients should lead to rescue of the disease phenotype. With use of a viral vector (adeno-associated virus or lentivirus)–mediated gene-delivery system and subretinal injection, a functional copy of the gene can be delivered under the control of photoreceptor-specific promoters to achieve targeted expression in the appropriate cell type. Somatic-gene-therapy rescue has been achieved in several animal models of retinal degeneration, including the rds mouse, and may also prove to be a successful approach for this type of adRP.21Ali RR Sarra GM Stephens C Alwis MD Bainbridge JW Munro PM Fauser S Reichel MB Kinnon C Hunt DM et al.Restoration of photoreceptor ultrastructure and function in retinal degeneration slow mice by gene therapy.Nat Genet. 2000; 25: 306-310Crossref PubMed Scopus (284) Google Scholar, 22Bainbridge JW Tan MH Ali RR Gene therapy progress and prospects: the eye.Gene Ther. 2006; 13: 1191-1197Crossref PubMed Scopus (121) Google Scholar We thank the patients and their families for participating in this study. We thank C. Murga-Zamalloa and Beverly Scott for technical assistance. This work was supported by grants from The Foundation Fighting Blindness (to S.S.B.), European Union grants EVI-GENORET LSHG-CT-2005-512036 (to S.S.B., V.M., A.G., and C.P.H.) and RETNET MRTN-CT-2003-504003 (to S.S.B. and V.M.), a grant from Special Trustees of Moorfields Eye Hospital (to S.S.B.), National Institutes of Health grants EY007961 and EY007003 (to A.S.), Biotechnology and Biological Sciences Research Council grant BB/C514458/1 (to K.M.), Deutsche Forschungsgemeinschaft grant KFO134 (to B.W. and E.Z.), and grants from Research to Prevent Blindness (to R.K.K.), George M. O’Brien Kidney Research Foundation (to R.K.K.), Foundation Fighting Blindness-Canada (to R.K.K.), and Fonds de la Recherche en Santee du Quebec (to R.K.K.)." @default.
• W2144015228 created "2016-06-24" @default.
• W2144015228 creator A5001987528 @default.
• W2144015228 creator A5004568733 @default.
• W2144015228 creator A5008070566 @default.
• W2144015228 creator A5016157467 @default.
• W2144015228 creator A5021151726 @default.
• W2144015228 creator A5021294516 @default.
• W2144015228 creator A5027214058 @default.
• W2144015228 creator A5030739615 @default.
• W2144015228 creator A5037658943 @default.
• W2144015228 creator A5037669782 @default.
• W2144015228 creator A5039682959 @default.
• W2144015228 creator A5040643758 @default.
• W2144015228 creator A5041166839 @default.
• W2144015228 creator A5042014408 @default.
• W2144015228 creator A5047395507 @default.
• W2144015228 creator A5050544784 @default.
• W2144015228 creator A5051978813 @default.
• W2144015228 creator A5054822813 @default.
• W2144015228 creator A5061018460 @default.
• W2144015228 creator A5067293009 @default.
• W2144015228 creator A5068742650 @default.
• W2144015228 creator A5071651582 @default.
• W2144015228 creator A5078029401 @default.
• W2144015228 creator A5079464717 @default.
• W2144015228 creator A5084260018 @default.
• W2144015228 creator A5086674978 @default.
• W2144015228 date "2007-11-01" @default.
• W2144015228 modified "2023-10-17" @default.
• W2144015228 title "Mutations in TOPORS Cause Autosomal Dominant Retinitis Pigmentosa with Perivascular Retinal Pigment Epithelium Atrophy" @default.
• W2144015228 cites W1489169434 @default.
• W2144015228 cites W1588415812 @default.
• W2144015228 cites W1965996554 @default.
• W2144015228 cites W1977132553 @default.
• W2144015228 cites W1980730914 @default.
• W2144015228 cites W1986627314 @default.
• W2144015228 cites W1988485709 @default.
• W2144015228 cites W1991135240 @default.
• W2144015228 cites W2011340042 @default.
• W2144015228 cites W2013479320 @default.
• W2144015228 cites W2039149680 @default.
• W2144015228 cites W2058953370 @default.
• W2144015228 cites W2069078243 @default.
• W2144015228 cites W2087049842 @default.
• W2144015228 cites W2121710779 @default.
• W2144015228 cites W2126195093 @default.
• W2144015228 cites W2139298839 @default.
• W2144015228 cites W2142464825 @default.
• W2144015228 cites W2146906348 @default.
• W2144015228 cites W2161559093 @default.
• W2144015228 cites W2262687060 @default.
• W2144015228 doi "https://doi.org/10.1086/521953" @default.
• W2144015228 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/2265653" @default.
• W2144015228 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17924349" @default.
• W2144015228 hasPublicationYear "2007" @default.
• W2144015228 type Work @default.
• W2144015228 sameAs 2144015228 @default.
• W2144015228 citedByCount "74" @default.
• W2144015228 countsByYear W21440152282012 @default.
• W2144015228 countsByYear W21440152282013 @default.
• W2144015228 countsByYear W21440152282014 @default.
• W2144015228 countsByYear W21440152282015 @default.
• W2144015228 countsByYear W21440152282016 @default.
• W2144015228 countsByYear W21440152282017 @default.
• W2144015228 countsByYear W21440152282018 @default.
• W2144015228 countsByYear W21440152282019 @default.
• W2144015228 countsByYear W21440152282020 @default.
• W2144015228 countsByYear W21440152282021 @default.
• W2144015228 countsByYear W21440152282022 @default.
• W2144015228 countsByYear W21440152282023 @default.
• W2144015228 crossrefType "journal-article" @default.
• W2144015228 hasAuthorship W2144015228A5001987528 @default.
• W2144015228 hasAuthorship W2144015228A5004568733 @default.
• W2144015228 hasAuthorship W2144015228A5008070566 @default.
• W2144015228 hasAuthorship W2144015228A5016157467 @default.
• W2144015228 hasAuthorship W2144015228A5021151726 @default.
• W2144015228 hasAuthorship W2144015228A5021294516 @default.
• W2144015228 hasAuthorship W2144015228A5027214058 @default.
• W2144015228 hasAuthorship W2144015228A5030739615 @default.
• W2144015228 hasAuthorship W2144015228A5037658943 @default.
• W2144015228 hasAuthorship W2144015228A5037669782 @default.
• W2144015228 hasAuthorship W2144015228A5039682959 @default.
• W2144015228 hasAuthorship W2144015228A5040643758 @default.
• W2144015228 hasAuthorship W2144015228A5041166839 @default.
• W2144015228 hasAuthorship W2144015228A5042014408 @default.
• W2144015228 hasAuthorship W2144015228A5047395507 @default.
• W2144015228 hasAuthorship W2144015228A5050544784 @default.
• W2144015228 hasAuthorship W2144015228A5051978813 @default.
• W2144015228 hasAuthorship W2144015228A5054822813 @default.
• W2144015228 hasAuthorship W2144015228A5061018460 @default.
• W2144015228 hasAuthorship W2144015228A5067293009 @default.
• W2144015228 hasAuthorship W2144015228A5068742650 @default.
• W2144015228 hasAuthorship W2144015228A5071651582 @default.
• W2144015228 hasAuthorship W2144015228A5078029401 @default.
• W2144015228 hasAuthorship W2144015228A5079464717 @default.
• W2144015228 hasAuthorship W2144015228A5084260018 @default.
• W2144015228 hasAuthorship W2144015228A5086674978 @default.

• next