FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2144979082> ?p ?o ?g. }

• W2144979082 endingPage "11611" @default.
• W2144979082 startingPage "11601" @default.
• W2144979082 abstract "The 5′-untranslated region (5′-UTR) is the most conserved part of the HIV-1 RNA genome, and it contains regulatory motifs that mediate various steps in the viral life cycle. Previous work showed that the 5′-terminal 290 nucleotides of HIV-1 RNA adopt two mutually exclusive secondary structures, long distance interaction (LDI) and branched multiple hairpin (BMH). BMH has multiple hairpins, including the dimer initiation signal (DIS) hairpin that mediates RNA dimerization. LDI contains a long distance base-pairing interaction that occludes the DIS region. Consequently, the two conformations differ in their ability to form RNA dimers. In this study, we have presented evidence that the full-length 5′-UTR also adopts the LDI and BMH conformations. The downstream 290–352 region, including the Gag start codon, folds differently in the context of the LDI and BMH structures. These nucleotides form an extended hairpin structure in the LDI conformation, but the same sequences create a novel long distance interaction with upstream U5 sequences in the BMH conformation. The presence of this U5-AUG duplex was confirmed by computer-assisted RNA structure prediction, biochemical analyses, and a phylogenetic survey of different virus isolates. The U5-AUG duplex may influence translation of the Gag protein because it occludes the start codon of the Gag open reading frame. The 5′-untranslated region (5′-UTR) is the most conserved part of the HIV-1 RNA genome, and it contains regulatory motifs that mediate various steps in the viral life cycle. Previous work showed that the 5′-terminal 290 nucleotides of HIV-1 RNA adopt two mutually exclusive secondary structures, long distance interaction (LDI) and branched multiple hairpin (BMH). BMH has multiple hairpins, including the dimer initiation signal (DIS) hairpin that mediates RNA dimerization. LDI contains a long distance base-pairing interaction that occludes the DIS region. Consequently, the two conformations differ in their ability to form RNA dimers. In this study, we have presented evidence that the full-length 5′-UTR also adopts the LDI and BMH conformations. The downstream 290–352 region, including the Gag start codon, folds differently in the context of the LDI and BMH structures. These nucleotides form an extended hairpin structure in the LDI conformation, but the same sequences create a novel long distance interaction with upstream U5 sequences in the BMH conformation. The presence of this U5-AUG duplex was confirmed by computer-assisted RNA structure prediction, biochemical analyses, and a phylogenetic survey of different virus isolates. The U5-AUG duplex may influence translation of the Gag protein because it occludes the start codon of the Gag open reading frame. human immunodeficiency virus type I 5′-untranslated region nucleotides long distance interaction branched multiple hairpin dimer initiation signal repeat transactivation region polyadenylation primer activation signal primer binding site splice donor nucleocapsid open reading frame dimethylsulfate reverse transcriptase, wt, wild-type simian immunodeficiency virus Human immunodeficiency virus type 1 (HIV-1)1 virions contain two full-length positive-stranded RNA molecules as genome. The full-length RNA not only serves as viral genome but also functions as an mRNA to encode the Gag and Gag-Pol polyproteins. The highly structured 5′-UTR is the most conserved part of the HIV-1 genome and is involved in several steps of the viral replication cycle (1Berkhout B. Progr. Nucleic Acid Res. Mol. Biol. 1996; 54: 1-34Google Scholar). Distinct functions have been assigned to individual sequence and/or structure motifs (presented in different colors in Fig. 1 A). The 5′-UTR consists of an upstream repeat (R) region that recurs at the 3′-terminus of the HIV-1 genome and that comprises TAR and the polyadenylation (poly(A)) signal. The well characterized TAR hairpin mediates transcription activation by binding of the viral Tat protein and the cellular protein, cyclin T (2Puglisi J.D. Tan R. Calnan B.J. Frankel A.D. Williamson J.R. Science. 1992; 257: 76-80Google Scholar, 3Aboul-ela F. Karn J. Varani G. J. Mol. Biol. 1995; 253: 313-332Google Scholar, 4Aboul-ela F. Karn J. Varani G. Nucleic Acids Res. 1996; 24: 3974-3981Google Scholar, 5Ippolito J.A. Steitz T.A. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 9819-9824Google Scholar, 6Berkhout B. Nucleic Acids Res. 1992; 20: 27-31Google Scholar, 7Klaver B. Berkhout B. EMBO J. 1994; 13: 2650-2659Google Scholar, 8Dingwall C. Ernberg I. Gait M.J. Green S.M. Heaphy S. Karn J. Lowe A.D. Singh M. Skinner M.A. Valerio R. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 6925-6929Google Scholar, 9Wei P. Garber M.E. Fang S.-M. Fisher W.H. Jones K.A. Cell. 1998; 92: 451-462Google Scholar, 10Berkhout B. Silverman R.H. Jeang K.T. Cell. 1989; 59: 273-282Google Scholar). The poly(A) hairpin inhibits premature polyadenylation of the nascent RNA by masking of the AAUAAA polyadenylation signal (11Klasens B.I.F. Das A.T. Berkhout B. Nucleic Acids Res. 1998; 26: 1870-1876Google Scholar, 12Klasens B.I.F. Thiesen M. Virtanen A. Berkhout B. Nucleic Acids Res. 1999; 27: 446-454Google Scholar). The U5 region is located downstream of the R region and contains two important signals for reverse transcription, the primer activation signal (PAS) and the primer binding site (PBS) (13Beerens N. Groot F. Berkhout B. J. Biol. Chem. 2001; 276: 31247-31256Google Scholar, 14Beerens N. Berkhout B. J. Virol. 2002; 76: 2329-2339Google Scholar). Additional essential motifs are located further downstream in the 5′-UTR. These include the RNA dimer initiation signal (DIS), the major splice donor site (SD) that is required for the generation of subgenomic mRNAs, the packaging signal (Ψ) that is required for the assembly of infectious virus particles, and a hairpin motif that includes the Gag start codon (15Laughrea M. Jette L. Biochemistry. 1994; 33: 13464-13474Google Scholar, 16Lever A. Gottlinger H. Haseltine W. Sodroski J. J. Virol. 1989; 63: 4085-4087Google Scholar, 17Aldovini A. Young R.A. J. Virol. 1990; 64: 1920-1926Google Scholar, 18Harrison G.P. Lever A.M.L. J. Virol. 1992; 66: 4144-4153Google Scholar, 19Baudin F. Marquet R. Isel C. Darlix J.L. Ehresmann B. Ehresmann C. J. Mol. Biol. 1993; 229: 382-397Google Scholar, 20Clavel F. Orenstein J.M. J. Virol. 1990; 64: 5230-5234Google Scholar, 21Purcell D.F.J. Martin M.A. J. Virol. 1993; 67: 6365-6378Google Scholar, 22O'Reilly M.M. McNally M.T. Beemon K.L. Virology. 1995; 213: 373-385Google Scholar, 23Kerwood D.J. Cavaluzzi M.J. Borer P.N. Biochemistry. 2001; 40: 14518-14529Google Scholar). The secondary structure of the HIV-1 5′-UTR has been studied extensively, and a variety of structure models have been proposed (1Berkhout B. Progr. Nucleic Acid Res. Mol. Biol. 1996; 54: 1-34Google Scholar,18Harrison G.P. Lever A.M.L. J. Virol. 1992; 66: 4144-4153Google Scholar, 19Baudin F. Marquet R. Isel C. Darlix J.L. Ehresmann B. Ehresmann C. J. Mol. Biol. 1993; 229: 382-397Google Scholar). Recently, the 5′-UTR was shown to fold alternative secondary structures (Fig. 1 A) (24Huthoff H. Berkhout B. RNA. 2001; 7 (N. Y.): 143-157Google Scholar). The ground state conformation is formed by a long distanceinteraction of the poly(A) and DIS regions and is termed LDI. The alternative, metastable conformation is a branched structure with multiple hairpins and is termed BMH. The two conformations differ in their ability to form RNA dimers. The DIS sequence is masked in the LDI conformation by long distance base pairing with upstream sequences, thus preventing dimer formation. In contrast, the DIS hairpin with the palindromic loop sequence is folded in the BMH structure. Thus, BMH RNA is able to engage in a kissing-loop interaction with the DIS palindrome of a second RNA molecule, thereby forming loose dimers (15Laughrea M. Jette L. Biochemistry. 1994; 33: 13464-13474Google Scholar, 25Skripkin E. Paillart J.C. Marquet R. Ehresmann B. Ehresmann C. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 4945-4949Google Scholar, 26Paillart J.C. Marquet R. Skripkin E. Ehresmann B. Ehresmann C. J. Biol. Chem. 1994; 269: 27486-27493Google Scholar, 27Muriaux D. Girard P.-M. Bonnet-Mathoniere B. Paoletti J. J. Biol. Chem. 1995; 270: 8209-8216Google Scholar, 28Clever J.L. Wong M.L. Parslow T.G. J. Virol. 1996; 70: 5902-5908Google Scholar, 29Haddrick M. Lear A.L. Cann A.J. Heaphy S. J. Mol. Biol. 1996; 259: 58-68Google Scholar, 30Laughrea M. Jette L. Biochemistry. 1996; 35: 9366-9374Google Scholar). Heat treatment or incubation with the HIV-1 nucleocapsid (NC) protein triggers the formation of a tight dimer with extended inter-strand base pairing (15Laughrea M. Jette L. Biochemistry. 1994; 33: 13464-13474Google Scholar, 25Skripkin E. Paillart J.C. Marquet R. Ehresmann B. Ehresmann C. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 4945-4949Google Scholar, 28Clever J.L. Wong M.L. Parslow T.G. J. Virol. 1996; 70: 5902-5908Google Scholar, 31Muriaux D. Fosse P. Paoletti J. Biochemistry. 1996; 35: 5075-5082Google Scholar). Interestingly, the NC protein also mediates the switch from LDI to BMH (24Huthoff H. Berkhout B. RNA. 2001; 7 (N. Y.): 143-157Google Scholar). This RNA switch mechanism may allow regulation and appropriate timing of the different 5′-UTR functions. For instance, the HIV-1 genomic RNA should be translated into the Gag and Gag-Pol proteins prior to RNA dimerization and packaging into assembling virions. The LDI and BMH structures have been studied in transcripts that comprise the 5′-terminal 290 nucleotides (nts) of the HIV-1 leader RNA. Because the SD site is located at nucleotide position 289, these results suggest that both genomic and subgenomic HIV-1 mRNAs can fold the LDI conformation. The 5′-UTR of the genomic HIV-1 RNA consists of 335 nucleotides up to the AUG start codon of the Gag open reading frame (ORF). In this work, we studied the folding of the downstream leader region 290–368 that contains the SD and Ψ signals and part of the Gag ORF. Computer-assisted folding and a phylogenetic survey of the leader RNA of different primate lentiviruses revealed a novel long distance interaction between U5 sequences and the Gag initiation codon: the U5-AUG duplex. The proposed U5-AUG long distance interaction was analyzed by mutational analysis, polyacrylamide gel electrophoresis, and RNA structure probing. The U5-AUG long distance interaction is formed exclusively in the BMH structure and not in the alternative LDI fold. The duplex is of particular interest because it occludes the AUG start codon of the Gag ORF, and it therefore has the potential to be involved in regulation of mRNA translation. Computer-assisted RNA secondary structure predictions were performed using the Mfold version 3.0 algorithm (32Mathews D.H. Sabina J. Zuker M. Turner D.H. J. Mol. Biol. 1999; 288: 911-940Google Scholar, 33Zuker M. Turner D.H. Barciszewski J. Clark B.F.C. Algorithms and Thermodynamics for RNA Secondary Structure Prediction: A Practical Guide. Kluwer Academic Publishers, Dordrecht/Boston/London1999: 11-43Google Scholar) offered by the MBCMR Mfold server (mfold.burnet.edu.au/). Standard settings were used for all folding jobs (37 °C and 1.0 m NaCl, with a 5% suboptimality range). Folding was performed with sequences comprising nucleotides 1–368 of the genomic RNA sequence of the wild-type (wt) and mutant HIV-1 LAI RNA. Phylogenetic studies were based on MFold data obtained with 500-nucleotide leader fragments of the primate lentiviral genomes. For mutation of the HIV-1 leader RNA, we used the plasmid Blue-5′LTR (34Klaver B. Berkhout B. J. Virol. 1994; 68: 3830-3840Google Scholar). This pBluescript-derived construct contains the XbaI-ClaI fragment of the infectious pLAI clone, including the 5′-LTR, the complete 5′-UTR, and part of the Gag ORF (−454/+376). Mutations were created by a standard PCR mutagenesis protocol. For construction of the s1 mutation, oligonucleotide primers TA007 (5′-CCC76AAGCTTGCCTTGAGTGCTTCAAGTAGTGTGCACCCATCTGTTGTGTGACTCT GG130-3′) and AD-GAG (complementary to position 442–462 of the HIV-1 genome) were used in a standard PCR reaction. For the w1 and w2 mutations, we used the forward primers TA009 (5′-CCC76AAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGTTTGTCTGTTGTGTG ACTCTGG130-3′) and TA008 (5′-CCC76AAAGCTTGCCTTGAGTGCTTCAAGTAGTGTG GAAAGTCTGTTGTGTGACTCTGG130-3′). The mutated nucleotides are underlined, and the nucleotide positions of the HIV-1 sequence are indicated in superscript. The sequence of the PCR products was confirmed by sequencing. The mutant PCR products were digested by HindIII and ClaI and cloned into the Blue-5′LTR vector. The XbaI-ClaI fragments were subsequently cloned into pLAI-R37, a derivative of the full-length infectious clone pLAI (35Berkhout B. van Wamel J. Klaver B. J. Mol. Biol. 1995; 252: 59-69Google Scholar). The mutant proviral constructs were designated pLAI-s1, -w1, and -w2. Transfection of the SupT1 cell line was performed by electroporation, and CA-p24 levels were determined as described previously (13Beerens N. Groot F. Berkhout B. J. Biol. Chem. 2001; 276: 31247-31256Google Scholar, 36Back N.K.T. Nijhuis M. Keulen W. Boucher C.A.B. Oude Essink B.B. van Kuilenburg A.B.P. Van Gennip A.H. Berkhout B. EMBO J. 1996; 15: 4040-4049Google Scholar). pLAI, pLAI-s1, -w1, and -w2 plasmids were used as template in a PCR reaction with primers T7–2 (corresponding to position 1–18 of the HIV-1 genome with an upstream T7 RNA promoter sequence) and R:A368-A347 (complementary to 368–347 of the HIV-1 genome). The PCR products were ethanol-precipitated and used forin vitro transcription by T7 RNA polymerase with [α-32P]dCTP according to the manufacturer's protocol (MEGAshortscript T7 transcription kit, Ambion, Inc.). Transcription reactions were stopped by addition of formamide-containing loading buffer and applied to 5% denaturing polyacrylamide gels. Gel slices containing the radiolabeled transcript were excised and soaked in TBE buffer (90 mm Tris borate, 2 mm EDTA) overnight at room temperature to elute the RNA. The RNA was ethanol-precipitated and dissolved in water. Equal amounts of RNA were heat-denatured and slowly renatured in the presence of dimerization buffer L (40 mm NaCl, 0.1 mmMgCl2, 10 mm Tris-HCl, pH 7.5). Aliquots were analyzed on polyacrylamide gels in 0.25 × TBE (22.5 mm Tris borate, 0.5 mm EDTA) and 0.25 × TBM (22.5 mm Tris borate, 0.1 mmMgCl2), either with a formamide-containing buffer or non-denaturing loading buffer. Gels were dried and applied to a Storm PhosphoImager. We used the computer program ImageQuant 5.0 (Amersham Biosciences) to quantify the RNA signals. The dimerization yield was determined by dividing the amount of dimer by the total amount of RNA (dimer plus monomer). pLAI and pLAI-s1 plasmids were used as templates in a PCR reaction with primers T7–2 and TA015 (complementary to 442–462 of HIV-1 genome). The PCR products were ethanol-precipitated and used for in vitrotranscription with the Ambion MEGAshortscript T7 transcription kit. Transcripts were DNase I-treated, phenol-extracted, ethanol-precipitated, and dissolved in water. The RNA samples were heat-denatured, followed by addition of sodium cacodylate (pH 7.0) and MgCl2 to a final concentration of 100 and 1 mm. The RNA (10 μg) was treated at room temperature with 2 μl of kethoxal for 10 min, with 1 μl of dimethylsulfate (DMS) for 5 min, or mock-treated. The reactions were stopped by addition of 50 μg ofEscherichia coli tRNA. The RNA was ethanol-precipitated and dissolved in 22 μl of water, and 4 μl was used in a primer extension assay with 5′-end-labeled oligonucleotide primers. Antisense primers reverse poly(A) 104/77 (complementary to 77–104 of the HIV-1 genome), cn3 (complementary to position 133–161), lys21 (complementary to 182–202), R:G290-G270 (complementary to 270–290), R:A368-A347, and TA015 were end-labeled with [γ-32P]ATP and T4 polynucleotide kinase. The kinase was inactivated at 80 °C for 10 min. For a primer extension reaction, 2 ng of the labeled probe was heat annealed to the RNA in 83 mm Tris-HCl (pH 7.5) and 125 mm KCl. Avian myeloblastoma virus reverse transcriptase (RT, 5 units) was added in RT buffer to yield a mixture with 3 mm MgCl2, 10 mm dithiothreitol, 10 μm dNTP, and 50 μg/ml actinomycin D. The reactions were incubated at 37 °C for 1 h and stopped by the addition of 200 mm NaOH and an additional incubation of 20 min. The samples were ethanol-precipitated, dissolved in formamide loading buffer, and applied to 10% polyacrylamide sequencing gels. The products were visualized by a Storm PhosphoImager. Previous work by Huthoff and Berkhout (24Huthoff H. Berkhout B. RNA. 2001; 7 (N. Y.): 143-157Google Scholar) showed that the HIV leader RNA is able to form two mutually exclusive secondary structures. In the ground state structure, the leader RNA adopts the LDI conformation that is based on an interaction between the poly(A) and DIS regions. In the presence of the viral NC protein, the LDI conformation switches to the BMH conformation that presents the poly(A) and DIS hairpins. Studies thus far have focused on transcripts that comprise the 5′-terminal 290 nucleotides of the HIV-1 leader RNA. In this study, we have analyzed the RNA folding of the complete 5′-UTR. Using the MFold computer program, we identified a novel long distance interaction that includes the start codon of the Gag ORF. This base-pairing possibility occurs between nucleotides 105–115 in the U5 region and 334–344 surrounding the AUG initiation codon and is termed the U5-AUG duplex. These two sequence elements are marked in the linear presentation of the 5′-UTR and the LDI and BMH structures (Fig.1 A). The duplex consists of 11 consecutive base pairs, including four G-U base pairs (Fig.1 B). The MFold results indicate that formation of the U5-AUG duplex occurs exclusively in BMH-like structures and not in the LDI conformation (results not shown). To test for the presence of the U5-AUG duplex, we designed mutants that either strengthen or weaken the base pairing interaction (Fig.1 C). The duplex is stabilized in the s1 mutant by substitution of three G-U base pairs by one G-C and two A-U base pairs. The duplex is destabilized in the w1 and w2 mutants by replacing the central C-G base pairs either by U-G base pairs or by A-G mismatches, respectively. We first set out to determine the dimerization properties of the wt and mutant transcripts on a non-denaturing gel. Radiolabeled transcripts of the genomic RNA (nts 1–368) were synthesized in vitro, incubated at RNA dimerization conditions, and analyzed on gel (Fig. 2 A). RNA monomers and dimers were detected for all transcripts in TBE and TBM gels. The most noticeable observation is that the s1 transcript with the stabilized U5-AUG duplex migrates faster in TBM gels than the wt transcript. Formamide-denatured samples were included as control (indicated above the lanes), and the remarkable migration of the s1 transcript is lost upon denaturation. The s1 dimer also migrates faster than the wt dimer in the TBE gels, but the fast migrating s1 monomer is observed as a diffuse band. Apparently, Mg2+ in the gel is required to stabilize the U5-AUG duplex in s1 monomers. The results of two experiments were quantified to calculate the level of RNA dimerization for the wt and mutant transcripts (Fig. 2 B). The TBM gel shows both dimer types (loose and tight dimers), whereas only tight dimers are detected on TBE gels. The small difference in dimerization efficiencies in TBE versus TBM gels is therefore likely because of the presence of loose dimers on the latter gel type. The mutant transcripts s1, w1, and w2 dimerize more efficiently than the wt transcript, independent of the presence of Mg2+. Apparently, all mutations in the U5 motif result in elevated levels of RNA dimerization, which may be because of their destabilizing effect on the LDI conformation. To test whether the fast migration of the s1 transcript is caused by stabilization of the U5-AUG interaction, we created a set of double mutants (Fig. 1 D). The downstream segment 334–343 of the U5-AUG duplex was substituted by sequences that disrupt or weaken base pairing. The three central C-G base pairs were opened in the AUG3 mutant, and nearly all base pairs were disrupted in the AUG10 mutant. The destabilizing mutations were introduced both in the wt and s1 mutant transcripts. The wt and mutant transcripts were subjected to non-denaturing gel electrophoresis (Fig.3 A). Most importantly, opening of the U5-AUG duplex in the s1-AUG3 and s1-AUG10 mutants corrects the unusual migration of the s1 transcript. The AUG3 and -10 mutations have no effect on the migration of the wt transcript. These results confirm that formation of the U5-AUG duplex in transcript s1 induces a conformation in the HIV-1 leader RNA that migrates relatively fast during gel electrophoresis. We also quantified the dimerization efficiencies of this set of mutants (Fig. 3 B). The wt transcript shows a moderate increase in dimerization efficiency upon introduction of the AUG3 or -10 mutations (from 30 to 34% dimers). The s1 transcript shows increased dimerization (60% dimers), and this effect is countered by the AUG3 or -10 mutations (47% dimers). Thus, the increased dimerization efficiency of the s1 transcript is caused, at least partially, by stabilization of the U5-AUG duplex in the BMH context. We next set out to determine the secondary structure of the wt and s1 mutant transcript (1–462) by RNA structure probing. Because the fast migrating s1 structure was only visible in the presence of Mg2+ (Fig. 2), the transcripts were heat-denatured and refolded in the presence of Mg2+. The transcripts were treated with limiting amounts of kethoxal or DMS and subsequently used as template for reverse transcription with several antisense DNA primers. The cDNA products were analyzed by denaturing gel electrophoresis. The complete set of probing data is listed in Table I. To facilitate the discussion of this complex data set, we will first present the new secondary structure models in Fig. 4. The wt RNA is folded in the ground state LDI conformation, in which the poly(A) and DIS regions (marked orange and pink) are base paired in a long distance interaction that extends the stem of the PBS domain. The downstream region 282–352 folds an extended stem-loop structure with three internal loops and a GGAG loop (markedyellow). The top of this extended hairpin is, in fact, the previously described Ψ or SL3 hairpin that is required for viral RNA packaging (37Zeffman A. Hassard S. Varani G. Lever A. J. Mol. Biol. 2000; 297: 877-893Google Scholar). We termed the extended hairpin ΨE. The SD site (marked gray) is located within an internal loop of ΨE. The Gag initiation codon (marked by anasterisk) is located in the central internal loop and the adjacent stem segment of ΨE. The downstream Gag sequences (nts 358–367) are possibly engaged in long distance base pairing with nucleotides 60–67 in the R region directly downstream of TAR. This interaction is termed the R-Gag duplex. In contrast, the s1 mutant RNA folds the BMH structure that exposes both the poly(A) and DIS hairpins. The downstream sequences in s1 RNA fold the SD hairpin and the short version of the Ψ hairpin, and the leader domain is closed by the U5-AUG duplex (105–115 pairs with 334–344).Table ISecondary structure probing of the wt and s1 mutant leader RNAReactivity of wt and s1 RNA to kethoxal (G-specific) and DMS (A- and C-specific) were estimated and classified into five categories: +++ = highly reactive, ++ = reactive, + = moderately reactive, +/− = marginally reactive, − = not reactive. The sequences that constitute the U5-AUG duplex are indicated by outlined boxes and the Gag initiation codon is indicated in bold. The sequence substitutions in the s1 RNA are indicated in italics. s indicates reverse transcription stops. Open table in a new tab Reactivity of wt and s1 RNA to kethoxal (G-specific) and DMS (A- and C-specific) were estimated and classified into five categories: +++ = highly reactive, ++ = reactive, + = moderately reactive, +/− = marginally reactive, − = not reactive. The sequences that constitute the U5-AUG duplex are indicated by outlined boxes and the Gag initiation codon is indicated in bold. The sequence substitutions in the s1 RNA are indicated in italics. s indicates reverse transcription stops. The structures shown in Fig. 4 are consistent with the MFold analyses. The LDI conformation with the extended PBS stem and the extended ΨE hairpin is the most stable structure adopted by the wt RNA. The BMH folding with the multiple hairpins (poly(A), DIS, SD, and short Ψ) and the novel U5-AUG duplex is the most stable structure adopted by s1 RNA. Apparently, the metastable BMH folding is facilitated by stabilization of the U5-AUG interaction. We previously demonstrated that the BMH fold can also be triggered by stabilization of the poly(A) or the DIS hairpin (24Huthoff H. Berkhout B. RNA. 2001; 7 (N. Y.): 143-157Google Scholar). Few leader RNA motifs do not change their structure during the LDI to BMH switch: the TAR hairpin (nts 1–57, marked green), the upper primer activation signal/primer binding site domain (nts 116–239, markedlilac and blue), and the short Ψ hairpin (nts 305–331, marked yellow). The constitutive folding of the TAR and PBS domains in the LDI and BMH structures was described previously (24Huthoff H. Berkhout B. RNA. 2001; 7 (N. Y.): 143-157Google Scholar). Apparently, these structures fold autonomously, suggesting that their biological function is independent of the LDI/BMH switch. The structure probing data of the wt and s1 RNA are presented to highlight the differences between the LDI and BMH structures. There are three regions that differ significantly in accessibility to the single strand-specific reagents kethoxal and DMS in the two transcripts. The first region is segment 105–115 of the U5-AUG duplex in which the s1 mutations were introduced (Fig.5 A). G106 and G108 are accessible to kethoxal in the wt transcript, whereas G106 and A108 are not sensitive to kethoxal and DMS in the s1 transcript. Apparently, these nucleotides are base-paired in the s1 transcript. Interestingly, the control primer extension reaction yields two major stop products on the s1 RNA template at position U118 and U120(marked s in Table I). Because the wt transcript has an identical sequence, it is likely that the RT enzyme is stopped by a structure that is specific for the s1 template. Apparently, the RT enzyme stopped three and five nucleotides before reaching the U5-AUG duplex. The second region that shows differential s1-wt reactivity concerns the sequences flanking the Gag initiation codon (Fig.5 B). Purines 332–336 are exclusively accessible to kethoxal and DMS in the wt transcript, indicating that these nucleotides are single-stranded. The third region that exhibits major probing differences is domain 235–242 (Fig. 5 C). This sequence is completely sensitive to kethoxal and DMS in the s1 transcript, whereas it is only partially sensitive in the wt transcript. Together, these results support the folding of the U5-AUG interaction in the s1 mutant transcript. As a result, nucleotides 240–242 become single-stranded exclusively in the BMH fold of the s1 transcript (Figs. 4 and5 C). These nucleotides are paired to nucleotides 113–115 in the LDI conformation of the wt transcript.Figure 5RNA structure probing data for the wt and s1 transcripts. Each gel segment shows the primer extension products of wt and s1 transcripts after mock treatment (−) or treatment with limiting amounts of the G-specific reagent kethoxal (K) and the A/C-specific chemical DMS (D). The relevant parts of the LDI and BMH structure are shown on the left andright, respectively. Nucleotide positions that are discussed in the text are indicated. The s1 mutations are indicated byarrows. A, nts 92–124. B, nts 322–338. C, nts 209–241. D, nts 53–90.E, nts 253–282.View Large Image Figure ViewerDownload (PPT) The poly(A) and DIS regions also react differently in the wt and s1 transcripts (Fig. 5 D). All five A residues of the poly(A) signal 73AAUAAA78 are equally accessible to DMS in the wt transcript, confirming that the poly(A) signal is single-stranded as in the LDI structure. In contrast,73AA74 is less exposed to DMS than76AAA78 in the s1 transcript, indicating that the poly(A) hairpin of the BMH conformation is formed. We previously used this differential reactivity within the poly(A) signal to differentiate between the LDI and BMH structures (24Huthoff H. Berkhout B. RNA. 2001; 7 (N. Y.): 143-157Google Scholar). Several nucleotides in the DIS region (264 and 274–276) are more exposed in wt RNA compared with s1 RNA, confirming the LDI fold of wt RNA (Fig.5 E). In contrast, A263 is exclusively DMS-sensitive in the s1 transcript, consistent with the folding of the DIS hairpin in the BMH structure. These combined results confirm that the wt transcript adopts the LDI conformation as the ground state structure and the s1 mutations force the RNA into the alternative BMH fold. Slight differences in reactivity between the two transcripts are also observed for positions 66–68, 274–305, and 356 (Table I). For instance, G290 and G292 are more reactive and G298 is less reactive in s1 RNA. These differences led to the proposed folding of the SD hairpin in the BMH structure and the ΨE hairpin and R-Gag duplex in the LDI conformation (Fig.4). The nucleotides in the bottom stem segment of ΨE and in the R-Gag duplex are moderately accessible to kethoxal/DMS (Table I), suggesting that these RNA structures are metastable. We have shown that the s1 mutant folds the U5-AUG duplex as part of the BMH fold. The U5-AUG interaction is not present in th" @default.
• W2144979082 created "2016-06-24" @default.
• W2144979082 creator A5019287445 @default.
• W2144979082 creator A5090253321 @default.
• W2144979082 date "2003-03-01" @default.
• W2144979082 modified "2023-10-13" @default.
• W2144979082 title "A Novel Long Distance Base-pairing Interaction in Human Immunodeficiency Virus Type 1 RNA Occludes the Gag Start Codon" @default.
• W2144979082 cites W1494641947 @default.
• W2144979082 cites W1547414471 @default.
• W2144979082 cites W1551381216 @default.
• W2144979082 cites W1588071325 @default.
• W2144979082 cites W1605873417 @default.
• W2144979082 cites W1653354461 @default.
• W2144979082 cites W1745115363 @default.
• W2144979082 cites W1819107170 @default.
• W2144979082 cites W1857344328 @default.
• W2144979082 cites W1870661610 @default.
• W2144979082 cites W1880169023 @default.
• W2144979082 cites W1975158050 @default.
• W2144979082 cites W1980779739 @default.
• W2144979082 cites W1985665571 @default.
• W2144979082 cites W1999065241 @default.
• W2144979082 cites W2001939628 @default.
• W2144979082 cites W2002680288 @default.
• W2144979082 cites W2009818318 @default.
• W2144979082 cites W2032467322 @default.
• W2144979082 cites W2034932609 @default.
• W2144979082 cites W2038224644 @default.
• W2144979082 cites W2040800446 @default.
• W2144979082 cites W2043961657 @default.
• W2144979082 cites W2046854154 @default.
• W2144979082 cites W2050122573 @default.
• W2144979082 cites W2053095510 @default.
• W2144979082 cites W2053169852 @default.
• W2144979082 cites W2057465425 @default.
• W2144979082 cites W2063870558 @default.
• W2144979082 cites W2064093220 @default.
• W2144979082 cites W2066701009 @default.
• W2144979082 cites W2070171685 @default.
• W2144979082 cites W2072528655 @default.
• W2144979082 cites W2075688547 @default.
• W2144979082 cites W2077246276 @default.
• W2144979082 cites W2081699233 @default.
• W2144979082 cites W2084500213 @default.
• W2144979082 cites W2084950106 @default.
• W2144979082 cites W2085392378 @default.
• W2144979082 cites W2096985241 @default.
• W2144979082 cites W2104741425 @default.
• W2144979082 cites W2118127319 @default.
• W2144979082 cites W2119431042 @default.
• W2144979082 cites W2122273986 @default.
• W2144979082 cites W2128331964 @default.
• W2144979082 cites W2132833862 @default.
• W2144979082 cites W2135025383 @default.
• W2144979082 cites W2138819288 @default.
• W2144979082 cites W2139653511 @default.
• W2144979082 cites W2141645679 @default.
• W2144979082 cites W2149098649 @default.
• W2144979082 cites W2152114427 @default.
• W2144979082 cites W2158420057 @default.
• W2144979082 cites W2160741454 @default.
• W2144979082 cites W2163604069 @default.
• W2144979082 cites W2164151366 @default.
• W2144979082 cites W2166805704 @default.
• W2144979082 cites W31182719 @default.
• W2144979082 cites W89943134 @default.
• W2144979082 doi "https://doi.org/10.1074/jbc.m210291200" @default.
• W2144979082 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12458192" @default.
• W2144979082 hasPublicationYear "2003" @default.
• W2144979082 type Work @default.
• W2144979082 sameAs 2144979082 @default.
• W2144979082 citedByCount "174" @default.
• W2144979082 countsByYear W21449790822012 @default.
• W2144979082 countsByYear W21449790822013 @default.
• W2144979082 countsByYear W21449790822014 @default.
• W2144979082 countsByYear W21449790822015 @default.
• W2144979082 countsByYear W21449790822016 @default.
• W2144979082 countsByYear W21449790822017 @default.
• W2144979082 countsByYear W21449790822018 @default.
• W2144979082 countsByYear W21449790822019 @default.
• W2144979082 countsByYear W21449790822020 @default.
• W2144979082 countsByYear W21449790822021 @default.
• W2144979082 countsByYear W21449790822022 @default.
• W2144979082 countsByYear W21449790822023 @default.
• W2144979082 crossrefType "journal-article" @default.
• W2144979082 hasAuthorship W2144979082A5019287445 @default.
• W2144979082 hasAuthorship W2144979082A5090253321 @default.
• W2144979082 hasBestOaLocation W21449790821 @default.
• W2144979082 hasConcept C104317684 @default.
• W2144979082 hasConcept C105580179 @default.
• W2144979082 hasConcept C121332964 @default.
• W2144979082 hasConcept C134306372 @default.
• W2144979082 hasConcept C14103023 @default.
• W2144979082 hasConcept C159047783 @default.
• W2144979082 hasConcept C176990463 @default.
• W2144979082 hasConcept C185592680 @default.
• W2144979082 hasConcept C3013748606 @default.
• W2144979082 hasConcept C33923547 @default.

• next