FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2146642186> ?p ?o ?g. }

• W2146642186 endingPage "598.e1" @default.
• W2146642186 startingPage "588" @default.
• W2146642186 abstract "The stem cell leukemia (Scl)/Tal1 gene is essential for normal blood and endothelial development, and is expressed in hematopoietic stem cells (HSCs), progenitors, erythroid, megakaryocytic, and mast cells. The Scl +19 enhancer is active in HSCs and progenitor cells, megakaryocytes, and mast cells, but not mature erythroid cells. Here we demonstrate that in vivo deletion of the Scl +19 enhancer (SclΔ19/Δ19) results in viable mice with normal Scl expression in mature hematopoietic lineages. By contrast, Scl expression is reduced in the stem/progenitor compartment and flow cytometry analysis revealed that the HSC and megakaryocyte-erythroid progenitor populations are enlarged in SclΔ19/Δ19 mice. The increase in HSC numbers contributed to enhanced expansion in bone marrow transplantation assays, but did not affect multilineage repopulation or stress responses. These results affirm that the Scl +19 enhancer plays a key role in the development of hematopoietic stem/progenitor cells, but is not necessary for mature hematopoietic lineages. Moreover, active histone marks across the Scl locus were significantly reduced in SclΔ19/Δ19 fetal liver cells without major changes in steady-state messenger RNA levels, suggesting post-transcriptional compensation for loss of a regulatory element, a result that might be widely relevant given the frequent observation of mild phenotypes after deletion of regulatory elements. The stem cell leukemia (Scl)/Tal1 gene is essential for normal blood and endothelial development, and is expressed in hematopoietic stem cells (HSCs), progenitors, erythroid, megakaryocytic, and mast cells. The Scl +19 enhancer is active in HSCs and progenitor cells, megakaryocytes, and mast cells, but not mature erythroid cells. Here we demonstrate that in vivo deletion of the Scl +19 enhancer (SclΔ19/Δ19) results in viable mice with normal Scl expression in mature hematopoietic lineages. By contrast, Scl expression is reduced in the stem/progenitor compartment and flow cytometry analysis revealed that the HSC and megakaryocyte-erythroid progenitor populations are enlarged in SclΔ19/Δ19 mice. The increase in HSC numbers contributed to enhanced expansion in bone marrow transplantation assays, but did not affect multilineage repopulation or stress responses. These results affirm that the Scl +19 enhancer plays a key role in the development of hematopoietic stem/progenitor cells, but is not necessary for mature hematopoietic lineages. Moreover, active histone marks across the Scl locus were significantly reduced in SclΔ19/Δ19 fetal liver cells without major changes in steady-state messenger RNA levels, suggesting post-transcriptional compensation for loss of a regulatory element, a result that might be widely relevant given the frequent observation of mild phenotypes after deletion of regulatory elements. The stem cell leukemia (Scl) gene, also known as Tal1, encodes a basic helix-loop-helix transcription factor that functions as a critical regulator of both hematopoietic and endothelial development [1Bloor A.J. Sanchez M.J. Green A.R. Gottgens B. The role of the stem cell leukemia (SCL) gene in hematopoietic and endothelial lineage specification.J Hematother Stem Cell Res. 2002; 11: 195-206Crossref PubMed Scopus (23) Google Scholar]. SCL was first identified by virtue of its ectopic expression as a target of t(1;14) chromosomal translocations in T-cell acute lymphoblastic leukemia [2Begley C.G. Aplan P.D. Davey M.P. et al.Chromosomal translocation in a human leukemic stem-cell line disrupts the T-cell antigen receptor delta-chain diversity region and results in a previously unreported fusion transcript.Proc Natl Acad Sci U S A. 1989; 86: 2031-2035Crossref PubMed Scopus (229) Google Scholar]. Overexpression of SCL is now recognized as one of the most common molecular abnormalities found in human T-cell acute lymphoblastic leukemia [3Begley C.G. Green A.R. The SCL gene: from case report to critical hematopoietic regulator.Blood. 1999; 93: 2760-2770Crossref PubMed Google Scholar]. Scl is an essential regulator of the hematopoietic hierarchy at several levels. Within the hematopoietic lineage, Scl is expressed in hematopoietic stem cells (HSCs), progenitor cells, and in erythroid, megakaryocytic, and mast cells [4Elefanty A.G. Begley C.G. Metcalf D. Barnett L. Kontgen F. Robb L. Characterization of hematopoietic progenitor cells that express the transcription factor SCL, using a lacZ “knock-in” strategy.Proc Natl Acad Sci U S A. 1998; 95: 11897-11902Crossref PubMed Scopus (72) Google Scholar, 5Elefanty A.G. Begley C.G. Hartley L. Papaevangeliou B. Robb L. SCL expression in the mouse embryo detected with a targeted lacZ reporter gene demonstrates its localization to hematopoietic, vascular, and neural tissues.Blood. 1999; 94: 3754-3763Crossref PubMed Google Scholar, 6Robb L. Elwood N.J. Elefanty A.G. et al.The scl gene product is required for the generation of all hematopoietic lineages in the adult mouse.EMBO J. 1996; 15: 4123-4129Crossref PubMed Scopus (285) Google Scholar]. Scl null ES cells fail to differentiate in vitro and do not contribute in vivo to hematopoiesis in chimeric mice [6Robb L. Elwood N.J. Elefanty A.G. et al.The scl gene product is required for the generation of all hematopoietic lineages in the adult mouse.EMBO J. 1996; 15: 4123-4129Crossref PubMed Scopus (285) Google Scholar, 7Porcher C. Swat W. Rockwell K. Fujiwara Y. Alt F.W. Orkin S.H. The T cell leukemia oncoprotein SCL/tal-1 is essential for development of all hematopoietic lineages.Cell. 1996; 86: 47-57Abstract Full Text Full Text PDF PubMed Scopus (611) Google Scholar]. In addition, knockout of the Scl gene is embryonic lethal at E9.5, due to complete absence of hematopoiesis and major vascular defects [7Porcher C. Swat W. Rockwell K. Fujiwara Y. Alt F.W. Orkin S.H. The T cell leukemia oncoprotein SCL/tal-1 is essential for development of all hematopoietic lineages.Cell. 1996; 86: 47-57Abstract Full Text Full Text PDF PubMed Scopus (611) Google Scholar, 8Robb L. Lyons I. Li R. et al.Absence of yolk sac hematopoiesis from mice with a targeted disruption of the scl gene.Proc Natl Acad Sci U S A. 1995; 92: 7075-7079Crossref PubMed Scopus (483) Google Scholar, 9Shivdasani R.A. Mayer E.L. Orkin S.H. Absence of blood formation in mice lacking the T-cell leukaemia oncoprotein tal-1/SCL.Nature. 1995; 373: 432-434Crossref PubMed Scopus (778) Google Scholar]. More recently, the use of a conditional knockout has demonstrated that Scl is essential for the genesis, but not the maintenance, of HSCs [10Hall M.A. Curtis D.J. Metcalf D. et al.The critical regulator of embryonic hematopoiesis, SCL, is vital in the adult for megakaryopoiesis, erythropoiesis, and lineage choice in CFU-S12.Proc Natl Acad Sci U S A. 2003; 100: 992-997Crossref PubMed Scopus (178) Google Scholar, 11Mikkola H.K. Klintman J. Yang H. et al.Haematopoietic stem cells retain long-term repopulating activity and multipotency in the absence of stem-cell leukaemia SCL/tal-1 gene.Nature. 2003; 421: 547-551Crossref PubMed Scopus (312) Google Scholar]. Mice in which Scl was deleted in adulthood exhibited mild defects in erythropoiesis and megakaryopoiesis [11Mikkola H.K. Klintman J. Yang H. et al.Haematopoietic stem cells retain long-term repopulating activity and multipotency in the absence of stem-cell leukaemia SCL/tal-1 gene.Nature. 2003; 421: 547-551Crossref PubMed Scopus (312) Google Scholar] and increased Lin−cKit+Sca+ stem-cell enriched population [12Curtis D.J. Hall M.A. Van Stekelenburg L.J. Robb L. Jane S.M. Begley C.G. SCL is required for normal function of short-term repopulating hematopoietic stem cells.Blood. 2004; 103: 3342-3348Crossref PubMed Scopus (67) Google Scholar]. Short-term HSC (ST-HSC) function seems to be defective in Scl deleted cells because these cells fail to generate colony-forming unit (CFU)-S12 colonies in the spleen [10Hall M.A. Curtis D.J. Metcalf D. et al.The critical regulator of embryonic hematopoiesis, SCL, is vital in the adult for megakaryopoiesis, erythropoiesis, and lineage choice in CFU-S12.Proc Natl Acad Sci U S A. 2003; 100: 992-997Crossref PubMed Scopus (178) Google Scholar] and show reduced short-term repopulating ability [12Curtis D.J. Hall M.A. Van Stekelenburg L.J. Robb L. Jane S.M. Begley C.G. SCL is required for normal function of short-term repopulating hematopoietic stem cells.Blood. 2004; 103: 3342-3348Crossref PubMed Scopus (67) Google Scholar]. Interestingly, long-term HSC (LT-HSC) function was not compromised [11Mikkola H.K. Klintman J. Yang H. et al.Haematopoietic stem cells retain long-term repopulating activity and multipotency in the absence of stem-cell leukaemia SCL/tal-1 gene.Nature. 2003; 421: 547-551Crossref PubMed Scopus (312) Google Scholar] or mildly compromised [12Curtis D.J. Hall M.A. Van Stekelenburg L.J. Robb L. Jane S.M. Begley C.G. SCL is required for normal function of short-term repopulating hematopoietic stem cells.Blood. 2004; 103: 3342-3348Crossref PubMed Scopus (67) Google Scholar] when the Scl deletion occurred post-transplantation. However, if the deletion occurred before transplantation, then a reduction in repopulating ability of the deleted cells was observed, which was not due to homing defects [12Curtis D.J. Hall M.A. Van Stekelenburg L.J. Robb L. Jane S.M. Begley C.G. SCL is required for normal function of short-term repopulating hematopoietic stem cells.Blood. 2004; 103: 3342-3348Crossref PubMed Scopus (67) Google Scholar]. This defect in repopulating ability was already observed in heterozygous Scl deleted cells, indicating that haploinsufficiency is enough to affect the repopulation capacity of these cells [12Curtis D.J. Hall M.A. Van Stekelenburg L.J. Robb L. Jane S.M. Begley C.G. SCL is required for normal function of short-term repopulating hematopoietic stem cells.Blood. 2004; 103: 3342-3348Crossref PubMed Scopus (67) Google Scholar]. Reduction of Scl expression using short hairpin RNA lentivirus in both human and mouse stem-cell enriched populations also affects the short and long-term repopulating ability of these cells [13Brunet de la Grange P. Armstrong F. Duval V. et al.Low SCL/TAL1 expression reveals its major role in adult hematopoietic myeloid progenitors and stem cells.Blood. 2006; 108: 2998-3004Crossref PubMed Scopus (49) Google Scholar]. A systematic survey of the promoters and chromatin structure of the murine Scl gene has identified several regulatory elements, functionally validated in reporter assays [14Delabesse E. Ogilvy S. Chapman M.A. Piltz S.G. Gottgens B. Green A.R. Transcriptional regulation of the SCL locus: identification of an enhancer that targets the primitive erythroid lineage in vivo.Mol Cell Biol. 2005; 25: 5215-5225Crossref PubMed Scopus (52) Google Scholar, 15Gottgens B. Barton L.M. Gilbert J.G. et al.Analysis of vertebrate SCL loci identifies conserved enhancers.Nat Biotechnol. 2000; 18: 181-186Crossref PubMed Scopus (155) Google Scholar, 16Gottgens B. Broccardo C. Sanchez M.J. et al.The scl +18/19 stem cell enhancer is not required for hematopoiesis: identification of a 5' bifunctional hematopoietic-endothelial enhancer bound by Fli-1 and Elf-1.Mol Cell Biol. 2004; 24: 1870-1883Crossref PubMed Scopus (70) Google Scholar, 17Sanchez M. Gottgens B. Sinclair A.M. et al.An SCL 3' enhancer targets developing endothelium together with embryonic and adult haematopoietic progenitors.Development. 1999; 126: 3891-3904PubMed Google Scholar, 18Sinclair A.M. Gottgens B. Barton L.M. et al.Distinct 5' SCL enhancers direct transcription to developing brain, spinal cord, and endothelium: neural expression is mediated by GATA factor binding sites.Dev Biol. 1999; 209: 128-142Crossref PubMed Scopus (91) Google Scholar]. Further analysis of reporter constructs in transgenic mice identified a panel of spatially distinct enhancers, each of which directs Scl expression to a subdomain of the normal Scl expression pattern [14Delabesse E. Ogilvy S. Chapman M.A. Piltz S.G. Gottgens B. Green A.R. Transcriptional regulation of the SCL locus: identification of an enhancer that targets the primitive erythroid lineage in vivo.Mol Cell Biol. 2005; 25: 5215-5225Crossref PubMed Scopus (52) Google Scholar, 16Gottgens B. Broccardo C. Sanchez M.J. et al.The scl +18/19 stem cell enhancer is not required for hematopoiesis: identification of a 5' bifunctional hematopoietic-endothelial enhancer bound by Fli-1 and Elf-1.Mol Cell Biol. 2004; 24: 1870-1883Crossref PubMed Scopus (70) Google Scholar, 17Sanchez M. Gottgens B. Sinclair A.M. et al.An SCL 3' enhancer targets developing endothelium together with embryonic and adult haematopoietic progenitors.Development. 1999; 126: 3891-3904PubMed Google Scholar, 18Sinclair A.M. Gottgens B. Barton L.M. et al.Distinct 5' SCL enhancers direct transcription to developing brain, spinal cord, and endothelium: neural expression is mediated by GATA factor binding sites.Dev Biol. 1999; 209: 128-142Crossref PubMed Scopus (91) Google Scholar]. In particular, the Scl +19 enhancer, also known as the Scl +18/19 enhancer from its location 19 kb downstream of the Scl promoter, was shown to drive expression of Scl in long-term repopulating HSCs and hematopoietic progenitors, but not in mature cells [17Sanchez M. Gottgens B. Sinclair A.M. et al.An SCL 3' enhancer targets developing endothelium together with embryonic and adult haematopoietic progenitors.Development. 1999; 126: 3891-3904PubMed Google Scholar, 19Sanchez M.J. Bockamp E.O. Miller J. Gambardella L. Green A.R. Selective rescue of early haematopoietic progenitors in Scl(-/-) mice by expressing Scl under the control of a stem cell enhancer.Development. 2001; 128: 4815-4827Crossref PubMed Google Scholar]. Furthermore, expression of the Scl complementary DNA under the control of the Scl +19 enhancer rescued the formation of early hematopoietic progenitors and yolk sac angiogenesis in Scl−/− embryos, but failed to rescue erythropoiesis and embryos still died at E9.5 [19Sanchez M.J. Bockamp E.O. Miller J. Gambardella L. Green A.R. Selective rescue of early haematopoietic progenitors in Scl(-/-) mice by expressing Scl under the control of a stem cell enhancer.Development. 2001; 128: 4815-4827Crossref PubMed Google Scholar]. These results indicate that the Scl +19 enhancer plays an important role in progenitors but is not sufficient to support erythroid maturation. Transgenic mouse reporter assays are a useful tool to identify new regulatory elements; however, such approaches are unable to define nonredundant/essential roles of these elements in the context of the entire gene locus. In the case of the Scl gene, three hematopoietic enhancers have been described that, in combination, are responsible for the hematopoietic expression pattern of Scl [14Delabesse E. Ogilvy S. Chapman M.A. Piltz S.G. Gottgens B. Green A.R. Transcriptional regulation of the SCL locus: identification of an enhancer that targets the primitive erythroid lineage in vivo.Mol Cell Biol. 2005; 25: 5215-5225Crossref PubMed Scopus (52) Google Scholar, 16Gottgens B. Broccardo C. Sanchez M.J. et al.The scl +18/19 stem cell enhancer is not required for hematopoiesis: identification of a 5' bifunctional hematopoietic-endothelial enhancer bound by Fli-1 and Elf-1.Mol Cell Biol. 2004; 24: 1870-1883Crossref PubMed Scopus (70) Google Scholar, 17Sanchez M. Gottgens B. Sinclair A.M. et al.An SCL 3' enhancer targets developing endothelium together with embryonic and adult haematopoietic progenitors.Development. 1999; 126: 3891-3904PubMed Google Scholar, 18Sinclair A.M. Gottgens B. Barton L.M. et al.Distinct 5' SCL enhancers direct transcription to developing brain, spinal cord, and endothelium: neural expression is mediated by GATA factor binding sites.Dev Biol. 1999; 209: 128-142Crossref PubMed Scopus (91) Google Scholar]. These enhancers have evolved from common ancestral enhancers [20Gottgens B. Ferreira R. Sanchez M.J. et al.cis-Regulatory remodeling of the SCL locus during vertebrate evolution.Mol Cell Biol. 2010; 30: 5741-5751Crossref PubMed Scopus (14) Google Scholar] and may have maintained a certain degree of redundancy. To clarify the function of the Scl +19 enhancer within the context of the endogenous locus, we describe here the generation and analysis of mice lacking both copies of the Scl +19 enhancer (SclΔ19/Δ19). SclΔ19/Δ19 mice were viable but their HSC and megakaryocyte-erythroid progenitor compartments were expanded. Analysis of Scl expression as well as chromatin modification status in wild-type (WT) and mutant cells suggested that post-transcriptional compensatory mechanisms contribute to the mild phenotype in addition to redundant regulatory elements within the locus. Mice with a +18/19 targeted stem cell enhancer (SclΔ19/Δ19) were generated as described [16Gottgens B. Broccardo C. Sanchez M.J. et al.The scl +18/19 stem cell enhancer is not required for hematopoiesis: identification of a 5' bifunctional hematopoietic-endothelial enhancer bound by Fli-1 and Elf-1.Mol Cell Biol. 2004; 24: 1870-1883Crossref PubMed Scopus (70) Google Scholar]. Mice and tissues were routinely genotyped by polymerase chain reaction (PCR) using the following primers: WT allele, 5′-CACCTGTCCTGGGGCTAAATT-3′ and 5′-GTTTTTGACTCCCAGATGTTGAA-3′; +18/19 enhancer region deletion allele (Δ19), 5′-CTTCTATCCATCTACAGG-3′ and 5′-CACTGAATCATGCTCGTGTGG-3′. Animals were maintained in the Cambridge Central Biomedical Services in accordance with institutional guidelines. A sample (50 μL) of freshly isolated peripheral blood from the tail vein was collected and blood parameters were measured using an ABC Vet fully automated analyzer (ABX Hematologie, Montpellier, France). For hematopoietic precursor isolation, mature bone marrow (BM) cells were depleted with a lineage depletion column (Miltenyi Biotec, GmBH, Bergisch Gladbach, Germany). For identification of common myeloid progenitors, granulocyte-macrophage progenitors, and megakaryocytic erythroid progenitors, cells were incubated with allophycocyanin anti-c-Kit (2B8; Pharmingen), phycoerythrin anti-FcγRII/III (2.4G2; Pharmingen BD Biosciences, Oxford, UK), and fluorescein isothiocyanate (FITC) anti-CD34 (RAM34; Pharmingen). Common lymphoid progenitors cells among Lin− cells were enumerated after staining with allophycocyanin c-Kit, Pacific Blue Sca-1 (E13-161.7; Pharmingen), and biotin-conjugated interleukin-7 (B12-1; Pharmingen), followed by PerCP-Cy5.5 streptavidin. To further define HSC progenitors, cells were subsequently stained with FITC anti-CD34 antibodies. Stained cells were analyzed using a MoFlo cell sorter (Dako, Carpinteria, CA, USA). For identification of mast cells, a peritoneal wash was performed with 10 mL sterile phosphate-buffered saline. Collected cells were stained with anti–c-Kit (allophycocyanin) and anti–Sca-1 (Pacific Blue). Enriched HSC (Lin− c-Kit+ Sca-1+) cells were sorted directly into 96% ethanol, washed extensively, and stained with propidium iodide and anti-Ki-67 (FITC) as a marker for cell cycle analysis. Whole BM erythropoietic cells were stained with CD71 (FITC) and Ter119 (phycoerythrin) antibodies. For RNA isolation from tissues, a single-cell suspension was prepared using a tissue homogenizer. Cells were resuspended in TRI reagent (Sigma, St Louis, MO, USA) and RNA isolated as described by the manufacturer. First-strand complementary DNA synthesis was performed using the cDBA Synthesis Kit (Bioline, Taunton, MA, USA). Quantitative PCR was carried out using Stratagene Brilliant SYBR Green qPCR Master Mix (Agilent Technologies, Stockport, UK). Standard curves were obtained using serial dilutions of control sample. Data were normalized to β-actin. Scl messenger RNA (mRNA) primers: Scl Exon 5 F- catgttcaccaacaacaaccg Scl Exon 6 R ggtgtgaggaccatcagaaatctc; Scl primary transcript primers: Scl Exon 1 F –tatgcctgtgtgcctgtgtccttt; Scl Intron 2 R –caacactggctcccgaatacatca; β-actin primers: β-actin F –tcctggcctcactgtcca; β-actin R –gtccgcctagaagcacttgc. To identify progenitor colonies, single-cell suspensions of 5 × 104 BM or 2 × 105 spleen cells were plated in duplicate in semisolid medium (MethoCult 3434; StemCell Technologies, Vancouver, BC, Canada). Colonies were counted and identified after 7 to 10 days in culture. To detect CFU-megakaryocyte, cells were plated in duplicate in collagen-based medium (MegaCult-C; StemCell Technologies). After 6 to 8 days in culture, slides were dehydrated, fixed, and stained with acetylthiocholiniodide (Sigma). Cultures were performed according to the manufacturer's protocol. Anemia was induced with phenylhydrazine (Sigma) injected intraperitoneally (60 mg/kg body weight) at day 1 and day 2. At day 4, mice were analyzed. Young adult recipient mice Ly5.1 (C57/black) underwent whole body γ-irradiation with 12 Gy to ablate their BM. This was followed immediately by tail vein injection of 1 × 106 (Ly5.2) cells in a ratio of 1:1 recipient to donor WT or SclΔ19/Δ19 whole BM cells. Animals were bled 4 and 12 weeks after BM transplantation. All animal procedures were carried out under British Home Office procedural and ethical guidelines. A single-cell suspension from fetal liver isolated from E14.5 embryos was cross linked with 0.4% formaldehyde and nuclear extracts were prepared. Nuclear extracts were sonicated to shear the DNA and precleared with rabbit IgG (Sigma) and Protein G agarose beads (Roche, Roche Applied Science, Burgess Hill, UK). Specific antibodies for H3K9me3, H3K9me2, H3K4me3, and H3K9Ac (Upstate Biotechnology, Inc., Lake Placid, NY, USA) were added at 2.5 μg per 1 × 107 lysed cells and incubated overnight at 4°C. Immunoprecipitated DNA material was released by reverse cross linking and enriched DNA fragments were purified and used for amplification by qPCR. The primers used for the regional analysis are as described [14Delabesse E. Ogilvy S. Chapman M.A. Piltz S.G. Gottgens B. Green A.R. Transcriptional regulation of the SCL locus: identification of an enhancer that targets the primitive erythroid lineage in vivo.Mol Cell Biol. 2005; 25: 5215-5225Crossref PubMed Scopus (52) Google Scholar]. The means of each dataset were analyzed using Student's t test with a two-tailed distribution and assuming equal sample variance. We have previously reported that chimeric mice created from SclΔ19/Δ19 ES cells, where a 2.5-kb fragment containing the Scl +18 and Scl +19 elements was deleted, show contribution of the deleted cells in all hematopoietic lineages [16Gottgens B. Broccardo C. Sanchez M.J. et al.The scl +18/19 stem cell enhancer is not required for hematopoiesis: identification of a 5' bifunctional hematopoietic-endothelial enhancer bound by Fli-1 and Elf-1.Mol Cell Biol. 2004; 24: 1870-1883Crossref PubMed Scopus (70) Google Scholar]. However, in these studies, there was still WT cell-derived hematopoiesis that might have masked quantitative effects of the deletion. Therefore, to study the effects of the deletion on hematopoiesis from embryo to adult, we generated SclΔ19/Δ19 homozygous knockout mice by crossing SclΔ19/WT heterozygous mice (Fig. 1A).Figure 1SclΔ19/Δ19 mice are viable and have normal mature hematopoietic lineages. (A) Left panel shows schematic representation of the Scl alleles used in this study: SclWT/WT and SclΔ19/Δ19 locus with the deletion of a 2.4-kb region containing both the +18 (light green bar) and +19 enhancers (dark green bar). Black triangle represents loxP site remaining in the genome after Cre recombination. Scl exons are depicted in red and the Map17 exons in blue. Right panel shows PCR genotyping analysis of WT (SclWT/WT), homozygous (SclΔ19/Δ19), and heterozygous (SclΔ19/WT) knockout alleles. In the first lane is 1-kb DNA marker. (B) Analysis of total cellularity from the BM and spleen in SclWT/WT and SclΔ19/Δ19 adult mice. (C) Percentage of granulocytes (Gr1+Mac1+), megakaryocytes (CD41+), and erythrocytes (Ter119+) cells in BM and T cells (CD4+, CD8+) and B cells (B220+) in spleen of SclWT/WT and SclΔ19/Δ19 mice. (D) Scl expression in mature blood lineages of the BM and spleen in SclΔ19/Δ19 mice. Data are presented as relative expression to SclWT/WT. Erythroid cells were sorted using Ter119 antibody, megakaryocytes using CD41, macrophages using Mac-1 and T cells from spleen using CD4. (E) Mast cells are normal in SclΔ19/Δ19 mice. Left panel shows peritoneal cells stained with Toludine blue and Metachromatic staining of mast cells. Right panel shows quantitative analysis of mast cells (cKit+ Sca1+) from peritoneal wash in SclWT/WT and SclΔ19/Δ19 mice.View Large Image Figure ViewerDownload Hi-res image Download (PPT) SclΔ19/Δ19 and WT mice were born at Mendelian ratios from heterozygous crosses, demonstrating that the deletion of the enhancer does not result in embryonic lethality. Hematological parameters in the peripheral blood of WT and SclΔ19/Δ19 mice were comparable at both 6 to 12 weeks and 78 to 86 weeks of age (Table 1). Adult BM and spleen cellularity of SclΔ19/Δ19 and WT mice were also comparable (Fig. 1B). Surface marker (Ter119, Mac-1 and Gr-1, CD41, B220, CD4, and CD8) analysis in adult BM and spleen did not reveal any significant differences between WT and SclΔ19/Δ19 mice (Fig. 1C). More detailed analysis of the erythroid lineage using the CD71 and Ter119 markers failed to reveal any abnormalities in erythropoiesis in adult BM and spleen (Supplementary Figure E1A; online only, available at www.exphem.org). In addition, phenylhydrazine treatment of SclΔ19/Δ19 mice induced a normal stress erythropoiesis reaction (Supplementary Figure E1B; online only, available at www.exphem.org).Table 1Hematological parameters of SclΔ19/Δ19 and WT miceAge (wks)GenotypeNRBC (103/μL)Hgb (g/dL)Hct (%)Plt (103/μL)WBC (103/μL)Lympho (%)Mono (%)Gran (%)6–12WT269.5 ± 1.317.2 ± 0.753.5 ± 4.01107 ± 2347.7 ± 2.078.7 ± 5.34.2 ± 0.517.1 ± 5.1Δ19269.6 ± 1.216.8 ± 0.853.1 ± 3.3965 ± 2097.4 ± 2.278.7 ± 5.74.3 ± 1.117 ± 4.978–86WT1210.1 ± 1.514.2 ± 2.446.0 ± 9.11551 ± 25411.3 ± 7.264 ± 13.46.8 ± 2.429.2 ± 11.5Δ191310.6 ± 1.314.5 ± 2.148.3 ± 8.21527 ± 35313.7 ± 5.964.3 ± 12.16.8 ± 1.829 ± 10.7Gran = granulocytes; Hct = hematocrit; Hgb = hemoglobin; Lympho = lymphocytes; mono = monocytes; Plt = platelets; RBC = red blood cells; WBC = white blood cells.Peripheral blood parameters were measured from age- and sex-matched young (6–12 weeks) and old (78–86 weeks) mice. Open table in a new tab Gran = granulocytes; Hct = hematocrit; Hgb = hemoglobin; Lympho = lymphocytes; mono = monocytes; Plt = platelets; RBC = red blood cells; WBC = white blood cells. Peripheral blood parameters were measured from age- and sex-matched young (6–12 weeks) and old (78–86 weeks) mice. Real-time semi-quantitative PCR performed with primers specific for the Scl gene [16Gottgens B. Broccardo C. Sanchez M.J. et al.The scl +18/19 stem cell enhancer is not required for hematopoiesis: identification of a 5' bifunctional hematopoietic-endothelial enhancer bound by Fli-1 and Elf-1.Mol Cell Biol. 2004; 24: 1870-1883Crossref PubMed Scopus (70) Google Scholar] showed that expression levels of Scl in erythroid (Ter119+), myeloid (Mac-1+), megakaryocytic (CD41+), and T-cell (CD4+) lineages were similar for WT and SclΔ19/Δ19 mice (Fig. 1D). It has recently been shown that Scl plays a role in mast cells [21Salmon J.M. Slater N.J. Hall M.A. et al.Aberrant mast-cell differentiation in mice lacking the stem-cell leukemia gene.Blood. 2007; 110: 3573-3581Crossref PubMed Scopus (25) Google Scholar]. However, SclΔ19/Δ19 peritoneal and connective tissue mast cells were morphologically, phenotypically, and quantitatively normal (Fig. 1E and Supplementary Figure E1C; online only, available at www.exphem.org). To determine whether deletion of the Scl +19 enhancer affects embryonic/fetal hematopoiesis, we quantified the number of progenitors in the fetal liver using methylcellulose-based colony assay. No difference was detected in burst-forming unit erythroid, CFU–granulocyte-macrophage (GM), CFU- multipotential progenitor cells, and CFU in culture from WT and SclΔ19/Δ19 fetuses (Fig. 1F). The expression level of Scl was unaltered in yolk sac at E9.5, aortagonad-mesonephros at E11.5, and fetal liver at E11.5 and E14 (Fig. 1G). These results indicate that deletion of the Scl +19 enhancer results in viable mice with a normal distribution and levels of Scl expression in embryonic and adult tissues and no effect on BM cellularity or fetal progenitor numbers. As the Scl +19 enhancer has been shown to be mainly active in progenitor cells [17Sanchez M. Gottgens B. Sinclair A.M. et al.An SCL 3' enhancer targets developing endothelium together with embryonic and adult haematopoietic progenitors.Development. 1999; 126: 3891-3904PubMed Google Scholar], we next performed a more detailed analysis of hematopoietic progenitors. The data obtained are shown in Figure 2 as a percentage of the specific progenitor population in lineage-depleted BM. The most significant increase in cell number (1.5-fold; p < 0.005) was found in the lineage-negative Sca1+ cKit+ (LSK) population (Fig. 2A). A similar phenotype was observed upon Scl deletion in adult mice [12Curtis D.J. Hall M.A. Van Stekelenburg L.J. Robb L. Jane S.M. Begley C.G. SCL is required for normal function of short-term repopulating hematopoietic stem cells.Blood. 2004; 103: 3342-3348Crossref PubMed Scopus (67) Google Scholar]. Further analysis of the LSK population using the CD34 marker revealed a significant increase in the LSK CD34+ population, whereas no difference was observed in the LSK CD34− population (Fig. 2B). The LSK CD34+ population is enriched for ST-HSCs, while the LSK CD34− population is enriched for the more immature LT-HSCs [22Yang L. Bryder D. Adolf" @default.
• W2146642186 created "2016-06-24" @default.
• W2146642186 creator A5001638255 @default.
• W2146642186 creator A5015462732 @default.
• W2146642186 creator A5017318024 @default.
• W2146642186 creator A5021065465 @default.
• W2146642186 creator A5047637115 @default.
• W2146642186 creator A5047640675 @default.
• W2146642186 creator A5048986007 @default.
• W2146642186 creator A5049203688 @default.
• W2146642186 creator A5057609030 @default.
• W2146642186 date "2012-07-01" @default.
• W2146642186 modified "2023-09-25" @default.
• W2146642186 title "Deletion of the Scl +19 enhancer increases the blood stem cell compartment without affecting the formation of mature blood lineages" @default.
• W2146642186 cites W1562891803 @default.
• W2146642186 cites W1572715178 @default.
• W2146642186 cites W1904595997 @default.
• W2146642186 cites W1912623443 @default.
• W2146642186 cites W1979764137 @default.
• W2146642186 cites W1999047431 @default.
• W2146642186 cites W2001127255 @default.
• W2146642186 cites W2008025461 @default.
• W2146642186 cites W2010348699 @default.
• W2146642186 cites W2015746396 @default.
• W2146642186 cites W2019944065 @default.
• W2146642186 cites W2023229889 @default.
• W2146642186 cites W2027914338 @default.
• W2146642186 cites W2031750072 @default.
• W2146642186 cites W2044502335 @default.
• W2146642186 cites W2046864742 @default.
• W2146642186 cites W2051740914 @default.
• W2146642186 cites W2061656021 @default.
• W2146642186 cites W2084095051 @default.
• W2146642186 cites W2085208735 @default.
• W2146642186 cites W2100583834 @default.
• W2146642186 cites W2104313307 @default.
• W2146642186 cites W2108244937 @default.
• W2146642186 cites W2111117771 @default.
• W2146642186 cites W2113619941 @default.
• W2146642186 cites W2124862621 @default.
• W2146642186 cites W2125064460 @default.
• W2146642186 cites W2125827936 @default.
• W2146642186 cites W2129509542 @default.
• W2146642186 cites W2133085165 @default.
• W2146642186 cites W2153492159 @default.
• W2146642186 cites W2162544653 @default.
• W2146642186 cites W2165397654 @default.
• W2146642186 cites W2170120590 @default.
• W2146642186 cites W2174809684 @default.
• W2146642186 cites W4255609769 @default.
• W2146642186 cites W73733194 @default.
• W2146642186 doi "https://doi.org/10.1016/j.exphem.2012.02.006" @default.
• W2146642186 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/3387379" @default.
• W2146642186 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/22401818" @default.
• W2146642186 hasPublicationYear "2012" @default.
• W2146642186 type Work @default.
• W2146642186 sameAs 2146642186 @default.
• W2146642186 citedByCount "7" @default.
• W2146642186 countsByYear W21466421862013 @default.
• W2146642186 countsByYear W21466421862015 @default.
• W2146642186 countsByYear W21466421862017 @default.
• W2146642186 countsByYear W21466421862020 @default.
• W2146642186 countsByYear W21466421862023 @default.
• W2146642186 crossrefType "journal-article" @default.
• W2146642186 hasAuthorship W2146642186A5001638255 @default.
• W2146642186 hasAuthorship W2146642186A5015462732 @default.
• W2146642186 hasAuthorship W2146642186A5017318024 @default.
• W2146642186 hasAuthorship W2146642186A5021065465 @default.
• W2146642186 hasAuthorship W2146642186A5047637115 @default.
• W2146642186 hasAuthorship W2146642186A5047640675 @default.
• W2146642186 hasAuthorship W2146642186A5048986007 @default.
• W2146642186 hasAuthorship W2146642186A5049203688 @default.
• W2146642186 hasAuthorship W2146642186A5057609030 @default.
• W2146642186 hasBestOaLocation W21466421861 @default.
• W2146642186 hasConcept C104317684 @default.
• W2146642186 hasConcept C111936080 @default.
• W2146642186 hasConcept C1491633281 @default.
• W2146642186 hasConcept C195244886 @default.
• W2146642186 hasConcept C203014093 @default.
• W2146642186 hasConcept C203635412 @default.
• W2146642186 hasConcept C2779979121 @default.
• W2146642186 hasConcept C28328180 @default.
• W2146642186 hasConcept C54355233 @default.
• W2146642186 hasConcept C86339819 @default.
• W2146642186 hasConcept C86803240 @default.
• W2146642186 hasConcept C95444343 @default.
• W2146642186 hasConcept C95457728 @default.
• W2146642186 hasConceptScore W2146642186C104317684 @default.
• W2146642186 hasConceptScore W2146642186C111936080 @default.
• W2146642186 hasConceptScore W2146642186C1491633281 @default.
• W2146642186 hasConceptScore W2146642186C195244886 @default.
• W2146642186 hasConceptScore W2146642186C203014093 @default.
• W2146642186 hasConceptScore W2146642186C203635412 @default.
• W2146642186 hasConceptScore W2146642186C2779979121 @default.
• W2146642186 hasConceptScore W2146642186C28328180 @default.
• W2146642186 hasConceptScore W2146642186C54355233 @default.
• W2146642186 hasConceptScore W2146642186C86339819 @default.
• W2146642186 hasConceptScore W2146642186C86803240 @default.

• next