FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2147776166> ?p ?o ?g. }

• W2147776166 endingPage "37170" @default.
• W2147776166 startingPage "37165" @default.
• W2147776166 abstract "We present the crystal structure of the pheromone receptor protein PrgZ from Enterococcus faecalis in complex with the heptapeptide cCF10 (LVTLVFV), which is used in signaling between conjugative recipient and donor cells. Comparison of PrgZ with homologous oligopeptide-binding proteins (AppA and OppA) explains the high specificity of PrgZ for hydrophobic heptapeptides versus the promiscuity of peptide binding in the homologous proteins. We present the crystal structure of the pheromone receptor protein PrgZ from Enterococcus faecalis in complex with the heptapeptide cCF10 (LVTLVFV), which is used in signaling between conjugative recipient and donor cells. Comparison of PrgZ with homologous oligopeptide-binding proteins (AppA and OppA) explains the high specificity of PrgZ for hydrophobic heptapeptides versus the promiscuity of peptide binding in the homologous proteins. Enterococcus faecalis is a Gram-positive bacterium that inhabits the gastrointestinal tract of mammals (1Jett B.D. Huycke M.M. Gilmore M.S. Virulence of enterococci.Clin. Microbiol. Rev. 1994; 7: 462-478Crossref PubMed Scopus (614) Google Scholar). In the past decades, E. faecalis infections in humans have increased, especially in nosocomial environments (2Hunt C.P. The emergence of enterococci as a cause of nosocomial infection.Br. J. Biomed. Sci. 1998; 55: 149-156PubMed Google Scholar, 3Courvalin P. Vancomycin resistance in Gram-positive cocci.Clin. Infect. Dis. 2006; 42: S25-S34Crossref PubMed Scopus (674) Google Scholar). One of the main reasons for this increase is an abundance of efficient conjugative resistance transfer systems induced by peptide sex pheromones, which allow E. faecalis to quickly become multiresistant to antimicrobial agents. The enterococcal sex pheromone systems represent a variation on quorum sensing, which allows an entire microbial population to carry out coordinated responses in a density-dependent fashion (4Miller M.B. Bassler B.L. Quorum sensing in bacteria.Annu. Rev. Microbiol. 2001; 55: 165-199Crossref PubMed Scopus (3351) Google Scholar). In E. faecalis, oligopeptides secreted by plasmid-free recipient cells allow plasmid donors to express conjugation functions only in the presence of recipients. One of the peptides in E. faecalis is the heptapeptide cCF10 (LVTLVFV), which originates from processing of the chromosomal gene product of ccfA (5Antiporta M.H. Dunny G.M. ccfA, the genetic determinant for the cCF10 peptide pheromone in Enterococcus faecalis OG1RF.J. Bacteriol. 2002; 184: 1155-1162Crossref PubMed Scopus (60) Google Scholar). This peptide, together with the 70-kb plasmid pCF10, which confers antibiotic resistance and carries genes for conjugation proteins, contributes to the virulence of the bacteria (6Dunny G.M. The peptide pheromone-inducible conjugation system of Enterococcus faecalis plasmid pCF10: cell-cell signaling, gene transfer, complexity, and evolution.Philos. Trans. R. Soc. Lond. B Biol. Sci. 2007; 362: 1185-1193Crossref PubMed Scopus (98) Google Scholar). pCF10 conjugation is activated using cCF10 as the signal. The inhibitor peptide iCF10 (AITLIFI), encoded by the icf10 gene on pCF10, prevents self-induction of the conjugation system by endogenous cCF10. Both cCF10 and iCF10 are secreted in the process of their production, and thus, both are re-imported into the cell (6Dunny G.M. The peptide pheromone-inducible conjugation system of Enterococcus faecalis plasmid pCF10: cell-cell signaling, gene transfer, complexity, and evolution.Philos. Trans. R. Soc. Lond. B Biol. Sci. 2007; 362: 1185-1193Crossref PubMed Scopus (98) Google Scholar). The initial receptor for cCF10 is PrgZ, a lipid-anchored extracellular peptide-binding protein. PrgZ delivers cCF10 to the oligopeptide permease (Opp), which subsequently transports it inside the cell (7Leonard B.A. Podbielski A. Hedberg P.J. Dunny G.M. Enterococcus faecalis pheromone-binding protein PrgZ recruits a chromosomal oligopeptide permease system to import sex pheromone cCF10 for induction of conjugation.Proc. Natl. Acad. Sci. U.S.A. 1996; 93: 260-264Crossref PubMed Scopus (155) Google Scholar), where cCF10 binds to PrgX, a DNA repressor protein (8Bae T. Clerc-Bardin S. Dunny G.M. Analysis of expression of prgX, a key negative regulator of the transfer of the Enterococcus faecalis pheromone-inducible plasmid pCF10.J. Mol. Biol. 2000; 297: 861-875Crossref PubMed Scopus (42) Google Scholar, 9Shi K. Brown C.K. Gu Z.Y. Kozlowicz B.K. Dunny G.M. Ohlendorf D.H. Earhart C.A. Structure of peptide sex pheromone receptor PrgX and PrgX/pheromone complexes and regulation of conjugation in Enterococcus faecalis.Proc. Natl. Acad. Sci. U.S.A. 2005; 102: 18596-18601Crossref PubMed Scopus (105) Google Scholar). Inside a pCF10-harboring cell, PrgX normally has a tetrameric quaternary structure with iCF10 bound. In the tetrameric state, PrgX binds to pCF10 and represses transcription of the conjugation genes. Upon an increase in the cytoplasmic concentration of cCF10, the inhibitor peptide is displaced, and the tetrameric structure of PrgX is disrupted, leading to loss of its repressor activity (9Shi K. Brown C.K. Gu Z.Y. Kozlowicz B.K. Dunny G.M. Ohlendorf D.H. Earhart C.A. Structure of peptide sex pheromone receptor PrgX and PrgX/pheromone complexes and regulation of conjugation in Enterococcus faecalis.Proc. Natl. Acad. Sci. U.S.A. 2005; 102: 18596-18601Crossref PubMed Scopus (105) Google Scholar). This initiates the transcription of the prgQ conjugation operon (10Johnson C.M. Manias D.A. Haemig H.A. Shokeen S. Weaver K.E. Henkin T.M. Dunny G.M. Direct evidence for control of the pheromone-inducible prgQ operon of Enterococcus faecalis plasmid pCF10 by a countertranscript-driven attenuation mechanism.J. Bacteriol. 2010; 192: 1634-1642Crossref PubMed Scopus (31) Google Scholar). PrgZ is the sole extracellular receptor for cCF10 at typical concentrations of the pheromone in vivo of 10 pm (6Dunny G.M. The peptide pheromone-inducible conjugation system of Enterococcus faecalis plasmid pCF10: cell-cell signaling, gene transfer, complexity, and evolution.Philos. Trans. R. Soc. Lond. B Biol. Sci. 2007; 362: 1185-1193Crossref PubMed Scopus (98) Google Scholar, 11Mori M. Sakagami Y. Narita M. Isogai A. Fujino M. Kitada C. Craig R.A. Clewell D.B. Suzuki A. Isolation and structure of the bacterial sex pheromone, cAD1, that induces plasmid transfer in Streptococcus faecalis.FEBS Lett. 1984; 178: 97-100Crossref PubMed Scopus (64) Google Scholar). The oligopeptide-binding protein A (OppA) of E. faecalis can also bind cCF10 and initiate pheromone import at higher (non-physiological) concentrations (12Fixen K.R. Chandler J.R. Le T. Kozlowicz B.K. Manias D.A. Dunny G.M. Analysis of the amino acid sequence specificity determinants of the enterococcal cCF10 sex pheromone in interactions with the pheromone-sensing machinery.J. Bacteriol. 2007; 189: 1399-1406Crossref PubMed Scopus (17) Google Scholar). It is clear that iCF10 and cCF10 compete for the same binding site in PrgX, but it has not been shown to date whether iCF10 also competes with cCF10 for binding to PrgZ. Furthermore, it is unknown what discriminates PrgZ from OppA in terms of structure determinants that allow the pheromone receptor to bind cCF10 with high affinity, whereas OppA, based on studies of its homologs in Salmonella typhimurium, Escherichia coli, and Lactococcus lactis, is highly promiscuous and binds a wide variety of peptides with moderate affinity (13Tame J.R. Dodson E.J. Murshudov G. Higgins C.F. Wilkinson A.J. The crystal structures of the oligopeptide-binding protein OppA complexed with tripeptide and tetrapeptide ligands.Structure. 1995; 3: 1395-1406Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar, 14Berntsson R.P. Doeven M.K. Fusetti F. Duurkens R.H. Sengupta D. Marrink S.J. Thunnissen A.M. Poolman B. Slotboom D.J. The structural basis for peptide selection by the transport receptor OppA.EMBO J. 2009; 28: 1332-1340Crossref PubMed Scopus (67) Google Scholar, 15Klepsch M.M. Kovermann M. Löw C. Balbach J. Permentier H.P. Fusetti F. de Gier J.W. Slotboom D.J. Berntsson R.P Escherichia coli peptide-binding protein OppA has a preference for positively charged peptides.J. Mol. Biol. 2011; 414: 75-85Crossref PubMed Scopus (42) Google Scholar). To gain detailed insight in how PrgZ binds its ligands, we present here the structure of PrgZ complexed with cCF10, as well as ligand-binding studies. The prgZ gene was obtained by PCR using the template vector pINY6033 (8Bae T. Clerc-Bardin S. Dunny G.M. Analysis of expression of prgX, a key negative regulator of the transfer of the Enterococcus faecalis pheromone-inducible plasmid pCF10.J. Mol. Biol. 2000; 297: 861-875Crossref PubMed Scopus (42) Google Scholar) and the complementary primers (forward, ATGGTGAGAATTTATATTTTCAAGGTATGACAAAAGATTCACAAGATGCA; and reverse, TGGGAGGGTGGGATTTTCACCATATACCCTCCATTACTTCTCTATTCTC) to yield prgZ*, i.e. prgZ without the nucleotide sequence coding for the signal sequence. The product was subsequently ligated into the pREnLIC vector (16Geertsma E.R. Poolman B. High-throughput cloning and expression in recalcitrant bacteria.Nat. Methods. 2007; 4: 705-707Crossref PubMed Scopus (85) Google Scholar); the resulting plasmid (pREnLIC-PrgZ*) was transformed into E. coli MC1061. The prgZ* gene was then transferred from pREnLIC to pNZnLIC via SfiI digestion and mixing of pREnLIC-PrgZ* and pERL according to the LIC-vBEX (ligation-independent cloning-vector backbone exchange) procedure (16Geertsma E.R. Poolman B. High-throughput cloning and expression in recalcitrant bacteria.Nat. Methods. 2007; 4: 705-707Crossref PubMed Scopus (85) Google Scholar). The plasmid was transformed into L. lactis NZ9000. L. lactis NZ9000 cells expressing PrgZ* were cultivated semi-anaerobically in M17 broth, 1% (w/v) glucose, and 5 μg/ml chloramphenicol at 30 °C to A600 = 0.6, at which they were induced by the addition of a 0.2% (v/v) culture supernatant of the nisin A-producing strain NZ9700 (17de Ruyter P.G. Kuipers O.P. de Vos W.M. Controlled gene expression systems for Lactococcus lactis with the food-grade inducer nisin.Appl. Environ. Microbiol. 1996; 62: 3662-3667Crossref PubMed Google Scholar). The cells were harvested 2 h after the start of induction, resuspended to A600 = 200 in buffer A (50 mm potassium Pi (pH 8.0) and 200 mm NaCl) supplemented with 10% glycerol, flash-frozen in liquid nitrogen, and stored at −80 °C. Frozen cells were thawed at room temperature and diluted to A600 = 80 with buffer A. Subsequently, 100 μg/ml deoxyribonuclease type I, 10 mm MgSO4, and 0.1 mm phenylmethanesulfonyl fluoride were added. The cells were broken by two consecutive passes in a cell disruptor (Constant Systems Ltd.) at 39,000 p.s.i. and 5 °C. Unbroken cells and cell debris were removed by ultracentrifugation at 267,000 × g for 75 min at 4 °C. The supernatant was collected (resulting in 20 ml of lysate/liter of culture), and 1.0 ml of Ni2+-Sepharose resin (Amersham Biosciences) was added per 20 ml of lysate. The mixture was incubated for 1 h at 4 °C in buffer A supplemented with 15 mm imidazole plus 10% (v/v) glycerol. Subsequently, the resin was poured into a disposable column (Bio-Rad) and washed with buffer A containing 50 mm imidazole (20 column volumes). The protein was eluted with 20 mm Na-MES (pH 6.0), 300 mm NaCl, and 500 mm imidazole (pH 6.0; 2 column volumes). PrgZ* was further purified on a Superdex 200 10/300 GL size exclusion column (Amersham Biosciences) in 20 mm Na-MES (pH 6.0) and 150 mm NaCl. Fractions containing PrgZ* were pooled and concentrated in spin concentrators with a 30-kDa cutoff (Vivaspin with polyethersulfone membrane, Sartorius) to 32 mg/ml protein. For differential scanning calorimetry (DSC) 3The abbreviation used is: DSCdifferential scanning calorimetry. experiments, the Superdex 200 10/300 column was run in 20 mm Na-HEPES (pH 7.5) and 150 mm NaCl. differential scanning calorimetry. To co-crystallize PrgZ* with cCF10 (LVTLVFV), 0.5 mg of solid cCF10 was added to 200 μl of 32 mg/ml PrgZ* with 0.01% n-dodecyl-β-d-maltoside added. After overnight incubation at 4 °C, this solution was used as a basis to grow crystals using the hanging drop vapor diffusion method. Crystallization conditions that yielded the open conformation consisted of 2 μl of protein (32 mg/ml PrgZ) and 1 μl of reservoir solution (0.01 m zinc sulfate, 0.1 m MES (pH 6.5), and 25% (w/v) PEG 550 monomethyl ether). Crystals were soaked in cryoprotectant (0.01 m zinc sulfate, 0.1 m Na-MES (pH 6.5), 30% (w/v) PEG 550, and 10% glycerol) for 30 s and subsequently flash-cooled in liquid nitrogen. Data were collected to 2.0 Å (wavelength of 0.874 Å) on beamline ID23-2 at the European Synchrotron Radiation Facility (Grenoble, France). Data processing and reduction were carried out using XDS (18Kabsch W. Automatic processing of rotation diffraction data from crystals of initially unknown symmetry and cell constants.J. Appl. Crystallogr. 1993; 26: 795-800Crossref Scopus (3229) Google Scholar). The structure was solved using the MR protocol of Auto-Rickshaw, the European Molecular Biology Laboratory Hamburg automated crystal structure determination platform (19Panjikar S. Parthasarathy V. Lamzin V.S. Weiss M.S. Tucker P.A. Auto-Rickshaw: an automated crystal structure determination platform as an efficient tool for the validation of an x-ray diffraction experiment.Acta Crystallogr. D Biol. Crystallogr. 2005; 61: 449-457Crossref PubMed Scopus (370) Google Scholar), which performs molecular replacement using BALBES (20Long F. Vagin A.A. Young P. Murshudov G.N. BALBES: a molecular replacement pipeline.Acta Crystallogr. D Biol. Crystallogr. 2008; 64: 125-132Crossref PubMed Scopus (633) Google Scholar), density modification using PIRATE (21Cowtan K. General quadratic functions in real and reciprocal space and their application to likelihood phasing.Acta Crystallogr. D Biol. Crystallogr. 2000; 56: 1612-1621Crossref PubMed Scopus (58) Google Scholar), and model building using ARP/wARP (22Langer G. Cohen S.X. Lamzin V.S. Perrakis A. Automated macromolecular model building for x-ray crystallography using ARP/wARP version 7.Nat. Protoc. 2008; 3: 1171-1179Crossref PubMed Scopus (1320) Google Scholar). The calculated electron density was of sufficient quality to let ARP/wARP build 95% of the residues of the final model, which Auto-Rickshaw returned. A few cycles of refinement using Refmac5 (23Murshudov G.N. Vagin A.A. Dodson E. Refinement of macromolecular structures by the maximum-likelihood method.Acta Crystallogr. D Biol. Crystallogr. 1997; 53: 240-255Crossref PubMed Scopus (13863) Google Scholar), interspersed with manual model building using Coot (24Emsley P. Cowtan K. Coot: model-building tools for molecular graphics.Acta Crystallogr. D Biol. Crystallogr. 2004; 60: 2126-2132Crossref PubMed Scopus (23311) Google Scholar), were necessary to complete the model. Water molecules were placed automatically in Fo − Fc Fourier difference maps at a 3σ cutoff level and validated to ensure correct coordination geometries using Coot. MolProbity (25Chen V.B. Arendall 3rd, W.B. Headd J.J. Keedy D.A. Immormino R.M. Kapral G.J. Murray L.W. Richardson J.S. Richardson D.C. MolProbity: all-atom structure validation for macromolecular crystallography.Acta Crystallogr. D Biol. Crystallogr. 2010; 66: 12-21Crossref PubMed Scopus (9858) Google Scholar) was used during the final refinement for model validation. Relevant statistics of the data collection and model refinement are given in Table 1.TABLE 1Data collection and refinement statisticsData collectionSpace groupP212121Cell dimensionsa, b, c (Å)68.6, 74.1, 112.6α, β, γ90°Wavelength (Å)0.872Resolution range35–2.0Rmeas0.11 (0.46)I/σ(I)11.8 (3.7)Completeness (%)100.0 (100.0)Redundancy4.9Refinement statisticsResolution range (Å)35–2.0No. of reflections43,632Rwork/Rfree0.155/0.192No. of atomsProtein4053Ligand69Water380Average B-factors (Å2)Protein22.1Ligand17.5Water33.0r.m.s.d.ar.m.s.d., root mean square deviation.Bond lengths (Å)0.010Bond angles1.12°a r.m.s.d., root mean square deviation. Open table in a new tab The stability of PrgZ*, with and without ligand, was measured by DSC on a VP-DSC system (MicroCal) at 25 °C and at 25 p.s.i. For measurements, PrgZ was diluted in 20 mm Na-HEPES (pH 7.5) and 150 mm NaCl to 4 μm. The samples (1 ml) were incubated in the absence or presence of 0.2 mg of lyophilized cCF10 or iCF10 at 4 °C for 14 h while rotating. After incubation, the samples were centrifuged for 10 min at 20,000 × g to remove any not dissolved peptide, and the supernatant was used for the analysis. Protein samples and buffers were degassed before injection into the cell to prevent air bubble formation. The temperature scans were performed between 25 and 80 °C at a scan rate of 60 °C/h. Data were analyzed using the MicroCal software (26Wiseman T. Williston S. Brandts J.F. Lin L.N. Rapid measurement of binding constants and heats of binding using a new titration calorimeter.Anal. Biochem. 1989; 179: 131-137Crossref PubMed Scopus (2435) Google Scholar). Binding pocket volumes were calculated with the program VOIDOO from the Uppsala Software Factory (27Kleywegt G.J. Jones T.A. Detection, delineation, measurement, and display of cavities in macromolecular structures.Acta Crystallogr. D Biol. Crystallogr. 1994; 50: 178-185Crossref PubMed Scopus (983) Google Scholar) using the probe-occupied volume for calculation. The program was run 10 times with the exact same parameters (probe radius of 1.4 Å, grid spacing of 0.5 Å, atomic fattening factor of 1.2 Å, and grid shrink factor of 0.9) but with randomly rotated copies of the molecule to average out random errors. PrgZ without a lipid anchor (termed PrgZ*) was produced in the cytoplasm of L. lactis. PrgZ* was co-crystallized together with cCF10, yielding crystals of the proteins in the closed liganded conformation in space group P212121 diffracting to 2.0 Å (Table 1). The structure was solved using molecular replacement in Auto-Rickshaw (19Panjikar S. Parthasarathy V. Lamzin V.S. Weiss M.S. Tucker P.A. Auto-Rickshaw: an automated crystal structure determination platform as an efficient tool for the validation of an x-ray diffraction experiment.Acta Crystallogr. D Biol. Crystallogr. 2005; 61: 449-457Crossref PubMed Scopus (370) Google Scholar) with the structures of OppA from S. typhimurium (Protein Data Bank code 1JET) and YliB from E. coli (code 1UQW) as search models. The final model comprises residues 58–564. The first 57 residues and the Ser-408–Asn-410 loop are (partially) disordered and not visible in the resulting electron density. Based on the connectivity of the β-strands, PrgZ* has the typical type II fold of substrate-binding proteins, with two α/β-domains that enclose the bound ligand (28Fukami-Kobayashi K. Tateno Y. Nishikawa K. Domain dislocation: a change of core structure in periplasmic binding proteins in their evolutionary history.J. Mol. Biol. 1999; 286: 279-290Crossref PubMed Scopus (164) Google Scholar). PrgZ has an extra domain, as has been previously described for OppA from S. typhimurium and L. lactis (14Berntsson R.P. Doeven M.K. Fusetti F. Duurkens R.H. Sengupta D. Marrink S.J. Thunnissen A.M. Poolman B. Slotboom D.J. The structural basis for peptide selection by the transport receptor OppA.EMBO J. 2009; 28: 1332-1340Crossref PubMed Scopus (67) Google Scholar, 29Tame J.R. Murshudov G.N. Dodson E.J. Neil T.K. Dodson G.G. Higgins C.F. Wilkinson A.J. The structural basis of sequence-independent peptide binding by OppA protein.Science. 1994; 264: 1578-1581Crossref PubMed Scopus (212) Google Scholar), and thus has a total of three domains (domains I–III). Substrate-binding proteins are structurally related even though their sequence identity is often below 20% (30Berntsson R.P. Smits S.H. Schmitt L. Slotboom D.J. Poolman B. A structural classification of substrate-binding proteins.FEBS Lett. 2010; 584: 2606-2617Crossref PubMed Scopus (386) Google Scholar). Compared with other peptide-binding proteins for which crystal structures are available, PrgZ is most similar in sequence to OppA from E. coli (25% identity). With its 60-kDa size and extra domain (domain II), it structurally belongs to Cluster C of the substrate-binding proteins (30Berntsson R.P. Smits S.H. Schmitt L. Slotboom D.J. Poolman B. A structural classification of substrate-binding proteins.FEBS Lett. 2010; 584: 2606-2617Crossref PubMed Scopus (386) Google Scholar). During refinement, electron density became apparent between the two domains and accounted for the bound peptide cCF10 (LVTLVFV). The peptide was buried inside PrgZ*, with no access to the bulk solvent. The electron density of the ligand was of excellent quality, allowing for straightforward model building of the heptapeptide. An extensive network of hydrogen bonds is present between the protein and the ligand, with 10 direct hydrogen bonds between cCF10 and PrgZ* and an additional eight via bridging water molecules within the binding cavity (Fig. 1A). The N terminus of cCF10 forms a salt bridge with Asp-472, whereas the C terminus is not fixed. The volume of the binding cavity of PrgZ* is 1600 Å3, which is smaller than that of AppA from Bacillus subtilis (2500 Å3) or OppA from L. lactis (4900 Å3) but larger than that of OppA from S. typhimurium (1000 Å3) (14Berntsson R.P. Doeven M.K. Fusetti F. Duurkens R.H. Sengupta D. Marrink S.J. Thunnissen A.M. Poolman B. Slotboom D.J. The structural basis for peptide selection by the transport receptor OppA.EMBO J. 2009; 28: 1332-1340Crossref PubMed Scopus (67) Google Scholar). The side chains of cCF10 are located in defined, mostly hydrophobic, side chain pockets, and with the exception of a hydrogen bond to the Thr-3 side chain, the side chains do not form specific interactions with the protein. Instead, hydrophobic and van der Waals bonds shape the interaction between the peptide side chains and the protein. The C terminus of cCF10 is located in a spacious area, with the binding cavity extending farther within the protein (Fig. 1B). cCF10 and iCF10 are poorly soluble in aqueous buffers. Solubility increases to 1 and 0.2 mm, respectively, when a minimum of 10% (v/v) Me2SO is present. Unfortunately, PrgZ was not stable in the presence of 10% Me2SO, which prohibited the use of intrinsic protein fluorescence titration or isothermal titration calorimetry to determine binding affinities. Instead, the binding of cCF10 and iCF10 to PrgZ* was characterized by DSC. PrgZ* was incubated for 16 h with 0.2 mg of solid cCF10 or iCF10 in the presence of 0.01% of the detergent n-dodecyl-β-d-maltoside, which was added to dissolve the peptides but lowered the melting temperature (Tm) of PrgZ from 42.5 ± 0.5 to 40.5 ± 0.5 °C (n = 3). Upon peptide binding, the Tm of PrgZ* increased from 40.5 °C (apoprotein) to 64 °C (cCF10-bound) or 61 °C (iCF10-bound) (Fig. 2). The variation in Tm in two independent experiments was <1 °C. The exact Tm of PrgZ* complexed to either peptide could not be determined because the protein began to aggregate within this temperature interval. The endotherms are relatively broad, which may be attributed to the tendency of PrgZ to aggregate in both the absence and presence of ligand (pheromone or inhibitor peptide). Moreover, neither PrgZ nor any other substrate-binding protein is a standard globular protein but instead has two similarly sized domains. It is likely that the two domains unfold at slightly different temperatures that are not resolved in the DSC scans, which leads to a broadening of the endotherms. Previous in vivo activity assays indicated that PrgZ selectively binds cCF10 and does not tolerate large deviations in its peptide sequence (12Fixen K.R. Chandler J.R. Le T. Kozlowicz B.K. Manias D.A. Dunny G.M. Analysis of the amino acid sequence specificity determinants of the enterococcal cCF10 sex pheromone in interactions with the pheromone-sensing machinery.J. Bacteriol. 2007; 189: 1399-1406Crossref PubMed Scopus (17) Google Scholar). However, the assay could not discriminate between peptide binding to PrgZ or to the DNA regulatory protein PrgX. The measured response of the in vivo assays was the induction of cell clumping in the culture, for which binding to both proteins is required. Based on the DSC experiments and consistent with the crystal structure, it is clear that PrgZ binds both cCF10 and iCF10, two related but different peptides. We conclude that iCF10 will thus act as a competitive inhibitor for cCF10 binding to PrgZ. The apparent Tm values, derived from the DSC measurements, indicate that PrgZ may have a slightly higher affinity for cCF10 than for iCF10. The affinities have to be high, as the typical extracellular concentration of cCF10 in vivo is only 10 pm (6Dunny G.M. The peptide pheromone-inducible conjugation system of Enterococcus faecalis plasmid pCF10: cell-cell signaling, gene transfer, complexity, and evolution.Philos. Trans. R. Soc. Lond. B Biol. Sci. 2007; 362: 1185-1193Crossref PubMed Scopus (98) Google Scholar, 11Mori M. Sakagami Y. Narita M. Isogai A. Fujino M. Kitada C. Craig R.A. Clewell D.B. Suzuki A. Isolation and structure of the bacterial sex pheromone, cAD1, that induces plasmid transfer in Streptococcus faecalis.FEBS Lett. 1984; 178: 97-100Crossref PubMed Scopus (64) Google Scholar). High-affinity pheromone binding is achieved because PrgZ forms an extensive network of hydrogen bonds with cCF10 (Fig. 1A), mainly to the backbone of the peptide. The peptide sequence selectivity of PrgZ must originate from the physical shape, charge, and polarity of the side chain pockets, which determine how well a side chain fits. Side chain pockets 2, 4, 6, and 7 form a confined space, which is lined mostly by hydrophobic residues. Side chain pockets 1, 3, and 5 have a larger volume, and pockets 3 and 5 are lined mostly by hydrophilic residues (Table 2). We note that the most hydrophilic residue of the pheromone, i.e. Thr, is found in pocket 3. Interestingly, the results of a previous genetic screen suggested the importance of this residue in a specific interaction with PrgZ (12Fixen K.R. Chandler J.R. Le T. Kozlowicz B.K. Manias D.A. Dunny G.M. Analysis of the amino acid sequence specificity determinants of the enterococcal cCF10 sex pheromone in interactions with the pheromone-sensing machinery.J. Bacteriol. 2007; 189: 1399-1406Crossref PubMed Scopus (17) Google Scholar). The properties of the side chain pockets suggest that not just a unique side chain is tolerated at any given position. However, for high-affinity binding of a given peptide, the physicochemical properties of the side chains (size and hydrophobicity) should match those of the PrgZ pockets. Further support for this notion comes from the observation that water molecules reside in all side chain pockets, and these could form bridging hydrogen bonds to bound peptides, as seen previously in OppA (14Berntsson R.P. Doeven M.K. Fusetti F. Duurkens R.H. Sengupta D. Marrink S.J. Thunnissen A.M. Poolman B. Slotboom D.J. The structural basis for peptide selection by the transport receptor OppA.EMBO J. 2009; 28: 1332-1340Crossref PubMed Scopus (67) Google Scholar, 15Klepsch M.M. Kovermann M. Löw C. Balbach J. Permentier H.P. Fusetti F. de Gier J.W. Slotboom D.J. Berntsson R.P Escherichia coli peptide-binding protein OppA has a preference for positively charged peptides.J. Mol. Biol. 2011; 414: 75-85Crossref PubMed Scopus (42) Google Scholar, 29Tame J.R. Murshudov G.N. Dodson E.J. Neil T.K. Dodson G.G. Higgins C.F. Wilkinson A.J. The structural basis of sequence-independent peptide binding by OppA protein.Science. 1994; 264: 1578-1581Crossref PubMed Scopus (212) Google Scholar). The more hydrophilic pockets harbor more defined water molecules inside compared with the more hydrophobic ones (Table 2). That the side chain pockets can harbor different residues is also evident from the fact that PrgZ binds both cCF10 and iCF10 (LVTLVFV and AITLIFI, respectively). Both pheromones are hydrophobic, and although related in sequence, they differ at positions 1, 2, 5, and 7. The largest difference is the N-terminal residue, which is changed from leucine to alanine in iCF10. Even though the hydrophobic side chain pockets form a confined space for the peptide side chains, there are no obvious specific interactions between the peptide pheromone and the protein. Although both iCF10 and cCF10 bind PrgZ and compete with one another for import into the donor cell, the striking differential effects of these two peptides when bound to PrgX (9Shi K. Brown C.K. Gu Z.Y. Kozlowicz B.K. Dunny G.M. Ohlendorf D.H. Earhart C.A. Structure of peptide sex pheromone receptor PrgX and PrgX/pheromone complexes and regulation of conjugation in Enterococcus faecalis.Proc. Natl. Acad. Sci. U.S.A. 2005; 102: 18596-18601Crossref PubMed Scopus (105) Google Scholar, 31Kozlowicz B.K. Shi K. Gu Z.Y. Ohlendorf D.H. Earhart C.A. Dunny G.M. Molecular basis for control of conjugation by bacterial pheromone and inhibitor peptides.Mol. Microbiol. 2006; 62: 958-969Crossref PubMed Scopus (67) Google Scholar) account for a major difference in their biological activities.TABLE 2Description of the side chain pockets, including the amino acids lining the pockets, the number of ordered water molecules per pocket, and the overall hydrophobicity of pockets in PrgZ, OppA, AppA, and DppASide chain pocketResidues lining the pocket (PrgZ)Ordered water molecules (PrgZ)HydrophobicityPrgZOppAAppADppA––Hydrophilic (1)Hydrophilic (1)––––Hydrophilic (2)Hydrophilic (2)––––Mixed (3)Mixed (3)–1Gln-81, Ile-84, Gln-4701MixedMixed (4)Hydrophilic (4)Mixed2Val-79, Met-454, Met-489, His-4913HydrophobicHydrophobic (5)Hydrophobic (5)Hydrophobic3Asn-318, Met-320, Gly-468, Gln-4703HydrophilicMixed (6)Mixed (6)–4Phe-453, Met-454, Leu-457, Ser-4671HydrophobicMixed (7)Mixed (7)–5Gly-67, Thr-68, Ser-418, Glu-4234HydrophilicHydrophilic (8)Mixed (8)–6Met-320, Leu-356, Phe-422, Glu-423, Ala-426, Phe-5312HydrophobicHydrophobic (9)Mixed (9)–7Ile-280, Pro-296, Ala-298, Phe-4223Hydrophobic––– Open table in a new tab OppA from L. lactis is the most promiscuous peptide-binding protein known to date. It binds peptides in the range of 4–35 residues and tolerates small, neutral, charged, and large bulky hydrophobic amino acids at any position in the peptide. There is a voluminous “nonspecific” binding cavity, and the peptides are bound via hydrogen bonds with up to 6 backbone residues. There is only one pocket in OppA from L. lactis that favors binding of a hydrophobic peptide side chain. This pocket mimics side chain pockets 2, 4, 6, and 7 of PrgZ; pocket 5 of OppA corresponds structurally to side chain pocket 2 of PrgZ (Table 2). The four hydrophobic pockets in PrgZ do not provide much extra space for larger side chains, and they will strongly favor the binding by PrgZ of hydrophobic peptides such as cCF10 and iCF10. Most side chain pockets of AppA from B. subtilis and the nonspecific binding cavity of OppA from L. lactis can more easily adapt to a much greater diversity of amino acids (13Tame J.R. Dodson E.J. Murshudov G. Higgins C.F. Wilkinson A.J. The crystal structures of the oligopeptide-binding protein OppA complexed with tripeptide and tetrapeptide ligands.Structure. 1995; 3: 1395-1406Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar, 14Berntsson R.P. Doeven M.K. Fusetti F. Duurkens R.H. Sengupta D. Marrink S.J. Thunnissen A.M. Poolman B. Slotboom D.J. The structural basis for peptide selection by the transport receptor OppA.EMBO J. 2009; 28: 1332-1340Crossref PubMed Scopus (67) Google Scholar, 32Berntsson R.P. Thunnissen A.M. Poolman B. Slotboom D.J. Importance of a hydrophobic pocket for peptide binding in lactococcal OppA.J. Bacteriol. 2011; 193: 4254-4256Crossref PubMed Scopus (22) Google Scholar, 33Levdikov V.M. Blagova E.V. Brannigan J.A. Wright L. Vagin A.A. Wilkinson A.J. The structure of the oligopeptide-binding protein AppA from Bacillus subtilis in complex with a nonapeptide.J. Mol. Biol. 2005; 345: 879-892Crossref PubMed Scopus (59) Google Scholar). These proteins also have far more hydrophilic side chain pockets than PrgZ (Table 2). Thus, the structural comparison of PrgZ with the homologous chemosensors explains the high selectivity of PrgZ for hydrophobic peptides (cCF10 and iCF10) compared with the promiscuous binding of peptides by the OppA and AppA proteins (14Berntsson R.P. Doeven M.K. Fusetti F. Duurkens R.H. Sengupta D. Marrink S.J. Thunnissen A.M. Poolman B. Slotboom D.J. The structural basis for peptide selection by the transport receptor OppA.EMBO J. 2009; 28: 1332-1340Crossref PubMed Scopus (67) Google Scholar, 29Tame J.R. Murshudov G.N. Dodson E.J. Neil T.K. Dodson G.G. Higgins C.F. Wilkinson A.J. The structural basis of sequence-independent peptide binding by OppA protein.Science. 1994; 264: 1578-1581Crossref PubMed Scopus (212) Google Scholar, 33Levdikov V.M. Blagova E.V. Brannigan J.A. Wright L. Vagin A.A. Wilkinson A.J. The structure of the oligopeptide-binding protein AppA from Bacillus subtilis in complex with a nonapeptide.J. Mol. Biol. 2005; 345: 879-892Crossref PubMed Scopus (59) Google Scholar). It is likely that in E. faecalis, PrgZ and OppA have diverged to obtain different functions to discriminate hydrophobic pheromones from nutritional peptides. Many peptide-binding proteins for which structures are available fixate their peptide termini with salt bridges. DppA and MppA from E. coli, OppA from S. typhimurium, and AppA from B. subtilis all form salt bridges to both the N and C termini of the bound peptides (29Tame J.R. Murshudov G.N. Dodson E.J. Neil T.K. Dodson G.G. Higgins C.F. Wilkinson A.J. The structural basis of sequence-independent peptide binding by OppA protein.Science. 1994; 264: 1578-1581Crossref PubMed Scopus (212) Google Scholar, 33Levdikov V.M. Blagova E.V. Brannigan J.A. Wright L. Vagin A.A. Wilkinson A.J. The structure of the oligopeptide-binding protein AppA from Bacillus subtilis in complex with a nonapeptide.J. Mol. Biol. 2005; 345: 879-892Crossref PubMed Scopus (59) Google Scholar, 34Nickitenko A.V. Trakhanov S. Quiocho F.A. 2 Å resolution structure of DppA, a periplasmic dipeptide transport/chemosensory receptor.Biochemistry. 1995; 34: 16585-16595Crossref PubMed Scopus (84) Google Scholar, 35Maqbool A. Levdikov V.M. Blagova E.V. Hervé M. Horler R.S. Wilkinson A.J. Thomas G.H. Compensating stereochemical changes allow murein tripeptide to be accommodated in a conventional peptide-binding protein.J. Biol. Chem. 2011; 286: 31512-31521Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar). OppA from L. lactis is an important exception. This protein leaves both peptide termini free, allowing binding of small (4–5 residues) and very large (up to 30 residues) peptides in the most optimal position (14Berntsson R.P. Doeven M.K. Fusetti F. Duurkens R.H. Sengupta D. Marrink S.J. Thunnissen A.M. Poolman B. Slotboom D.J. The structural basis for peptide selection by the transport receptor OppA.EMBO J. 2009; 28: 1332-1340Crossref PubMed Scopus (67) Google Scholar). PrgZ fixes the N terminus of cCF10, but not the C terminus. When inspecting the binding cavity of PrgZ, it is evident that there is space for an additional amino acid at the C-terminal end of the peptide. We hypothesize that an octapeptide could also bind to PrgZ. Finally, given the similarity of the overall structures of PrgZ, AppA, and OppA, it is most likely that PrgZ operates according to a similar Venus flytrap mechanism (30Berntsson R.P. Smits S.H. Schmitt L. Slotboom D.J. Poolman B. A structural classification of substrate-binding proteins.FEBS Lett. 2010; 584: 2606-2617Crossref PubMed Scopus (386) Google Scholar), providing a direct path for the entry of pheromone into the binding site. In conclusion, we propose that cytosolic accumulation of both cCF10 and iCF10 is PrgZ-dependent. PrgZ selects these peptides at the very low extracellular concentrations among high concentrations of nutritional peptides. iCF10, which inhibits expression of the conjugation system, acts as a competitive inhibitor of cCF10 at the level of both PrgZ and PrgX." @default.
• W2147776166 created "2016-06-24" @default.
• W2147776166 creator A5003735271 @default.
• W2147776166 creator A5016748423 @default.
• W2147776166 creator A5032813107 @default.
• W2147776166 creator A5041070000 @default.
• W2147776166 creator A5075802016 @default.
• W2147776166 date "2012-10-01" @default.
• W2147776166 modified "2023-10-12" @default.
• W2147776166 title "Structure and Mode of Peptide Binding of Pheromone Receptor PrgZ" @default.
• W2147776166 cites W1967754278 @default.
• W2147776166 cites W1969672293 @default.
• W2147776166 cites W1971330126 @default.
• W2147776166 cites W1984050501 @default.
• W2147776166 cites W2000840258 @default.
• W2147776166 cites W2009159314 @default.
• W2147776166 cites W2010111060 @default.
• W2147776166 cites W2017989935 @default.
• W2147776166 cites W2020357919 @default.
• W2147776166 cites W2032396652 @default.
• W2147776166 cites W2033294574 @default.
• W2147776166 cites W2037531733 @default.
• W2147776166 cites W2038840577 @default.
• W2147776166 cites W2066386335 @default.
• W2147776166 cites W2071659099 @default.
• W2147776166 cites W2083361262 @default.
• W2147776166 cites W2100791996 @default.
• W2147776166 cites W2103794058 @default.
• W2147776166 cites W2111502970 @default.
• W2147776166 cites W2118818078 @default.
• W2147776166 cites W2119508143 @default.
• W2147776166 cites W2126275001 @default.
• W2147776166 cites W2126383924 @default.
• W2147776166 cites W2126922170 @default.
• W2147776166 cites W2141906439 @default.
• W2147776166 cites W2144081223 @default.
• W2147776166 cites W2146450264 @default.
• W2147776166 cites W2146559520 @default.
• W2147776166 cites W2150910305 @default.
• W2147776166 cites W2154008825 @default.
• W2147776166 cites W2154714625 @default.
• W2147776166 cites W2157030400 @default.
• W2147776166 cites W2167144254 @default.
• W2147776166 cites W2169629955 @default.
• W2147776166 doi "https://doi.org/10.1074/jbc.m112.386334" @default.
• W2147776166 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/3481316" @default.
• W2147776166 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/22948145" @default.
• W2147776166 hasPublicationYear "2012" @default.
• W2147776166 type Work @default.
• W2147776166 sameAs 2147776166 @default.
• W2147776166 citedByCount "19" @default.
• W2147776166 countsByYear W21477761662013 @default.
• W2147776166 countsByYear W21477761662015 @default.
• W2147776166 countsByYear W21477761662016 @default.
• W2147776166 countsByYear W21477761662017 @default.
• W2147776166 countsByYear W21477761662019 @default.
• W2147776166 countsByYear W21477761662020 @default.
• W2147776166 countsByYear W21477761662021 @default.
• W2147776166 countsByYear W21477761662022 @default.
• W2147776166 countsByYear W21477761662023 @default.
• W2147776166 crossrefType "journal-article" @default.
• W2147776166 hasAuthorship W2147776166A5003735271 @default.
• W2147776166 hasAuthorship W2147776166A5016748423 @default.
• W2147776166 hasAuthorship W2147776166A5032813107 @default.
• W2147776166 hasAuthorship W2147776166A5041070000 @default.
• W2147776166 hasAuthorship W2147776166A5075802016 @default.
• W2147776166 hasBestOaLocation W21477761661 @default.
• W2147776166 hasConcept C12554922 @default.
• W2147776166 hasConcept C170493617 @default.
• W2147776166 hasConcept C185592680 @default.
• W2147776166 hasConcept C2777328355 @default.
• W2147776166 hasConcept C2779281246 @default.
• W2147776166 hasConcept C54355233 @default.
• W2147776166 hasConcept C55493867 @default.
• W2147776166 hasConcept C71240020 @default.
• W2147776166 hasConcept C86803240 @default.
• W2147776166 hasConcept C95444343 @default.
• W2147776166 hasConceptScore W2147776166C12554922 @default.
• W2147776166 hasConceptScore W2147776166C170493617 @default.
• W2147776166 hasConceptScore W2147776166C185592680 @default.
• W2147776166 hasConceptScore W2147776166C2777328355 @default.
• W2147776166 hasConceptScore W2147776166C2779281246 @default.
• W2147776166 hasConceptScore W2147776166C54355233 @default.
• W2147776166 hasConceptScore W2147776166C55493867 @default.
• W2147776166 hasConceptScore W2147776166C71240020 @default.
• W2147776166 hasConceptScore W2147776166C86803240 @default.
• W2147776166 hasConceptScore W2147776166C95444343 @default.
• W2147776166 hasIssue "44" @default.
• W2147776166 hasLocation W21477761661 @default.
• W2147776166 hasLocation W21477761662 @default.
• W2147776166 hasLocation W21477761663 @default.
• W2147776166 hasLocation W21477761664 @default.
• W2147776166 hasLocation W21477761665 @default.
• W2147776166 hasOpenAccess W2147776166 @default.
• W2147776166 hasPrimaryLocation W21477761661 @default.
• W2147776166 hasRelatedWork W1848316160 @default.
• W2147776166 hasRelatedWork W1964467932 @default.
• W2147776166 hasRelatedWork W1968286492 @default.

• next