FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2148760047> ?p ?o ?g. }

• W2148760047 endingPage "5476" @default.
• W2148760047 startingPage "5466" @default.
• W2148760047 abstract "Protein kinase C (PKC) has been widely implicated in positive and negative control of cell proliferation. We have recently shown that treatment of non-small cell lung cancer (NSCLC) cells with phorbol 12-myristate 13-acetate (PMA) during G1 phase inhibits the progression into S phase, an effect mediated by PKCδ-induced up-regulation of the cell cycle inhibitor p21Cip1. However, PMA treatment in asynchronously growing NSCLC cells leads to accumulation of cells in G2/M. Studies in post-G1 phases revealed that PMA induced an irreversible G2/M cell cycle arrest in NSCLC cells and conferred morphological and biochemical features of senescence, including elevated SA-β-Gal activity and reduced telomerase activity. Remarkably, this effect was phase-specific, as it occurred only when PKC was activated in S, but not in G1, phase. Mechanistic analysis revealed a crucial role for the classical PKCα isozyme as mediator of the G2/M arrest and senescence, as well as for inducing p21Cip1 an obligatory event for conferring the senescence phenotype. In addition to the unappreciated role of PKC isozymes, and specifically PKCα, in senescence, our data introduce the paradigm that discrete PKCs trigger distinctive responses when activated in different phases of the cell cycle via a common mechanism that involves p21Cip1 up-regulation. Protein kinase C (PKC) has been widely implicated in positive and negative control of cell proliferation. We have recently shown that treatment of non-small cell lung cancer (NSCLC) cells with phorbol 12-myristate 13-acetate (PMA) during G1 phase inhibits the progression into S phase, an effect mediated by PKCδ-induced up-regulation of the cell cycle inhibitor p21Cip1. However, PMA treatment in asynchronously growing NSCLC cells leads to accumulation of cells in G2/M. Studies in post-G1 phases revealed that PMA induced an irreversible G2/M cell cycle arrest in NSCLC cells and conferred morphological and biochemical features of senescence, including elevated SA-β-Gal activity and reduced telomerase activity. Remarkably, this effect was phase-specific, as it occurred only when PKC was activated in S, but not in G1, phase. Mechanistic analysis revealed a crucial role for the classical PKCα isozyme as mediator of the G2/M arrest and senescence, as well as for inducing p21Cip1 an obligatory event for conferring the senescence phenotype. In addition to the unappreciated role of PKC isozymes, and specifically PKCα, in senescence, our data introduce the paradigm that discrete PKCs trigger distinctive responses when activated in different phases of the cell cycle via a common mechanism that involves p21Cip1 up-regulation. Activation of protein kinase C (PKC) 4The abbreviations used are:PKCprotein kinase CDAPI4′,6-diamidino-2-phenylindoleNSCLCnon-small cell lung cancerPBSphosphate-buffered salinePMAphorbol 12-myristate 13-acetateHUhydroxyureaMOImultiplicity of infectionSA-β-Galsenescence-associated β-galactosidase.4The abbreviations used are:PKCprotein kinase CDAPI4′,6-diamidino-2-phenylindoleNSCLCnon-small cell lung cancerPBSphosphate-buffered salinePMAphorbol 12-myristate 13-acetateHUhydroxyureaMOImultiplicity of infectionSA-β-Galsenescence-associated β-galactosidase. with phorbol esters and related natural compounds causes an array of effects on differentiation, mitogenesis, survival, apoptosis, and transformation. The diverse effects of phorbol esters both in normal and cancerous cells is due to the existence of numerous intracellular effectors, of which PKC isozymes have been the most widely characterized. The PKC family comprises 3 subfamilies that include 10 structurally related phospholipid-dependent serine/threonine kinases (1Griner E.M. Kazanietz M.G. Nat. Rev. Cancer. 2007; 7: 281-294Crossref PubMed Scopus (759) Google Scholar, 2Newton A.C. Chem. Rev. 2001; 101: 2353-2364Crossref PubMed Scopus (821) Google Scholar). Members of the classical cPKC (α, βI, βII, and γ) and the novel nPKC (δ, ϵ, η, and θ) subfamilies are activated by phorbol esters and their cellular analogue, the second messenger diacylglycerol, which leads to redistribution (translocation) of the enzymes from cytosol to intracellular membrane compartments, where they phosphorylate specific substrates. The marked heterogeneity in the signaling events and cell type-specific responses triggered by phorbol esters could be explained by the distinctive pattern of expression and intracellular localization of PKC isozymes and their substrates, which ultimately results in selective pathway activation. protein kinase C 4′,6-diamidino-2-phenylindole non-small cell lung cancer phosphate-buffered saline phorbol 12-myristate 13-acetate hydroxyurea multiplicity of infection senescence-associated β-galactosidase. protein kinase C 4′,6-diamidino-2-phenylindole non-small cell lung cancer phosphate-buffered saline phorbol 12-myristate 13-acetate hydroxyurea multiplicity of infection senescence-associated β-galactosidase. One of the paradigms that best exemplifies the functional versatility of PKC isozymes is the regulation of the cell cycle machinery. It became evident in the last years that PKCs can impact on the cell cycle both in positive and negative manners with a strict degree of cell type and isozyme specificity. PKC isozymes have been shown to regulate the progression of cells from G1 to S phase as well as with the transition from G2 to M phase (3Fishman D.D. Segal S. Livneh E. Int. J. Oncol. 1998; 12: 181-186PubMed Google Scholar) via transcriptional, translational, and post-translational mechanisms. PKCs control the activity of cyclin-Cdk complexes in G1 by modulating the expression of cyclins and Cdk inhibitors (4Black J.D. Front Biosci. 2000; 5: D406-D423Crossref PubMed Google Scholar, 5Gavrielides M.V. Frijhoff A.F. Conti C.J. Kazanietz M.G. Curr. Drug Targets. 2004; 5: 431-443Crossref PubMed Scopus (47) Google Scholar). For example, early studies in vascular endothelial cells showed dual growth stimulatory or inhibitory roles for PKCs depending on which phase in the cell cycle PKC becomes activated. In HUVEC cells phorbol esters potentiate growth factor mitogenic activity when added in early G1 phase, but they inhibit DNA synthesis when added in late G1 phase (6Zhou W. Takuwa N. Kumada M. Takuwa Y. J. Biol. Chem. 1993; 268: 23041-23048Abstract Full Text PDF PubMed Google Scholar). In NIH 3T3 cells, PKCα and PKCϵ enhance cell cycle progression and proliferation by stimulating cyclin D1 transcription (7Soh J.W. Weinstein I.B. J. Biol. Chem. 2003; 278: 34709-34716Abstract Full Text Full Text PDF PubMed Scopus (162) Google Scholar). On the other hand, PKCη inhibits cdk2 activity in human keratinocytes, and overexpression of either PKCη or PKCδ, but not PKCα, leads to G1 arrest and differentiation (8Ohba M. Ishino K. Kashiwagi M. Kawabe S. Chida K. Huh N.H. Kuroki T. Mol. Cell. Biol. 1998; 18: 5199-5207Crossref PubMed Google Scholar, 9Kashiwagi M. Ohba M. Watanabe H. Ishino K. Kasahara K. Sanai Y. Taya Y. Kuroki T. Oncogene. 2000; 19: 6334-6341Crossref PubMed Scopus (60) Google Scholar). In several cell types, the PKC activator phorbol 12-myristate 13-acetate (PMA) up-regulates Cdk inhibitors p21Cip1 and/or p27 (10Akashi M. Osawa Y. Koeffler H.P. Hachiya M. Biochem. J. 1999; 337: 607-616Crossref PubMed Scopus (75) Google Scholar, 11Zeng Y.X. el-Deiry W.S. Oncogene. 1996; 12: 1557-1564PubMed Google Scholar). These contrasting effects ultimately impact on the status of Rb phosphorylation, the expression of E2F-regulated genes, and the biological outcome. Several studies have also established key roles for PKC isozymes in G2. For example, PKCβII activation was required for entry into mitosis in HL60 promyelocytic leukemia cells (12Thompson L.J. Fields A.P. J. Biol. Chem. 1996; 271: 15045-15053Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar), whereas PMA was shown to induce G2 arrest by suppression of cdc2 kinase activity in vascular endothelial cells (13Kosaka C. Sasaguri T. Ishida A. Ogata J. Am. J. Physiol. 1996; 270: C170-C178Crossref PubMed Google Scholar). Based on this complexity, it is not surprising that both PKC activators (such as bryostatins or phorbol esters) and PKC inhibitors (such as the PKCβ inhibitor enzastaurin) are in clinical trials for a number of neoplasias (14Mackay H.J. Twelves C.J. Nat. Rev. Cancer. 2007; 7: 554-562Crossref PubMed Scopus (315) Google Scholar, 15Strair R.K. Schaar D. Goodell L. Aisner J. Chin K.V. Eid J. Senzon R. Cui X.X. Han Z.T. Knox B. Rabson A.B. Chang R. Conney A. Clin. Cancer Res. 2002; 8: 2512-2518PubMed Google Scholar, 16Han Z.T. Tong Y.K. He L.M. Zhang Y. Sun J.Z. Wang T.Y. Zhang H. Cui Y.L. Newmark H.L. Conney A.H. Chang R.L. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 5362-5365Crossref PubMed Scopus (53) Google Scholar, 17Barry O.P. Kazanietz M.G. Curr. Pharm. Des. 2001; 7: 1725-1744Crossref PubMed Scopus (64) Google Scholar). Because of the contrasting effects of PKC isozymes on cell cycle regulation, a thorough understanding of these mechanisms is essential for the rational design of PKC modulators with anti-cancer activity. Lung cancer is one of the most common forms of cancers worldwide and the major cause of cancer-related mortality. Non-small cell lung carcinoma (NSCLC), the most frequent type of lung cancer, is treated in early stages mainly with surgery and radiotherapy, whereas advanced stages receive combination chemotherapy or radiation therapy (18Schiller J.H. Oncology. 2001; 61: 3-13Crossref PubMed Scopus (147) Google Scholar). Unfortunately, the marked resistance to the various therapies accounts for the high lethality (19Fong K.M. Sekido Y. Gazdar A.F. Minna J.D. Thorax. 2003; 58: 892-900Crossref PubMed Scopus (113) Google Scholar). Studies in the last years have proposed PKC isozymes, such as PKCα, as targets for NSCLC therapy. However, a PKCα-specific antisense oligonucleotide (ISIS 3521/LY900003) showed slight or no benefit in NSCLC patients, either alone or in combination with other chemotherapeutic agents (20Paz-Ares L. Douillard J.Y. Koralewski P. Manegold C. Smit E.F. Reyes J.M. Chang G.C. John W.J. Peterson P.M. Obasaju C.K. Lahn M. Gandara D.R. J. Clin. Oncol. 2006; 24: 1428-1434Crossref PubMed Scopus (114) Google Scholar). This is not unexpected since PKCα, like other PKCs, has been shown to be either growth inhibitory or pro-apoptotic in various cancer cell models (21Wen-Sheng W. Cancer Lett. 2006; 239: 27-35Crossref PubMed Scopus (63) Google Scholar, 22Russo M. Palumbo R. Mupo A. Tosto M. Iacomino G. Scognamiglio A. Tedesco I. Galano G. Russo G.L. Oncogene. 2003; 22: 3330-3342Crossref PubMed Scopus (66) Google Scholar, 23Garcia-Bermejo M.L. Leskow F.C. Fujii T. Wang Q. Blumberg P.M. Ohba M. Kuroki T. Han K.C. Lee J. Marquez V.E. Kazanietz M.G. J. Biol. Chem. 2002; 277: 645-655Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar). One may speculate that activators of growth inhibitory PKCs rather than PKC inhibitors could have therapeutic benefits for lung cancer, as demonstrated for other types of cancers. It is evident that a deeper knowledge of the roles of individual PKC isozymes in lung cancer would be needed to rationalize the use of PKC as a therapeutic target. Our recent studies have established that treatment of NSCLC cells with phorbol ester in early G1 impairs the progression through S phase, and we have identified PKCδ as the PKC responsible for this effect. PKCδ-induced G1 arrest is mediated through the transcriptional up-regulation of the cell cycle inhibitor p21Cip1 (24Nakagawa M. Oliva J.L. Kothapalli D. Fournier A. Assoian R.K. Kazanietz M.G. J. Biol. Chem. 2005; 280: 33926-33934Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar). However, as shown in the present article, the paradox seems to be more complex, because in asynchronously growing NSCLC cells phorbol esters lead to the accumulation of cells in G2/M, thus suggesting multiple points of regulation in the cell cycle by PKCs. A more detailed analysis revealed that activation of PKC in late G1-early S leads to a delay in the progression through S phase and irreversible arrest of cells in G2/M, followed by the appearance of a senescence phenotype. Both G2/M arrest and senescence depend on the up-regulation of p21Cip1, but strikingly these effects are mediated by PKCα rather than PKCδ. Exploiting this irreversible induced growth arrest of lung cancer cells in response to PKCα activation may have significant therapeutic implications. Materials—Cell culture media was purchased from Invitrogen (Carlsbad, CA). PMA was obtained from LC Laboratories (Woburn, MA). The pan-PKC inhibitor GF109203X (bisindolylmaleimide I) was from BIOMOL Research Laboratories Inc. (Plymouth Meeting, PA). Gö6976 and rottlerin were purchased from Alexis (San Diego, CA). Propidium iodide, DAPI, and hydroxyurea were from Sigma-Aldrich. Cell Culture—H358 and H441 lung bronchoalveolar adenocarcinoma cells were obtained from ATCC (Manassas, VA). H322 lung bronchoalveolar carcinoma cells were kindly provided by Dr. Steven Albelda (University of Pennsylvania School of Medicine). Cells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum, penicillin (100 units/ml), streptomycin (100 μg/ml), and l-glutamine (2 mm) at 37 °C in a humidified 5% CO2 atmosphere. For synchronization at the G1/S boundary, cells were cultured in normal medium for 24 h, serum-starved for 24 h, and then treated with 1 mm hydroxyurea (HU) in complete medium. For synchronization in G0, cells were serum-starved for 48 h, and released from G0 by the addition of serum. Cell Proliferation and Cell Cycle Analysis—Cells (2 × 105) were seeded in 60-mm dishes in triplicate and synchronized at the G1/S boundary with HU as described above. Upon release by extensive washing, cells were treated with PMA or vehicle for different times. After extensive washing to remove the PMA, complete growth medium was added. Cells were trypsinized at different intervals and counted with a hemocytometer. Proliferation was assayed by [3H]thymidine incorporation. Briefly, 24, 48, or 72 h after PMA treatment cells were pulse-labeled with 3 μCi/ml of [methyl-3H]thymidine (Amersham Biosciences) for 3 h, followed by trichloroacetic acid precipitation and scintillation counting. For determination of cell cycle profile, cells were stained with propidium iodide (0.1 mg/ml) and analyzed by flow cytometry, as previously described (24Nakagawa M. Oliva J.L. Kothapalli D. Fournier A. Assoian R.K. Kazanietz M.G. J. Biol. Chem. 2005; 280: 33926-33934Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar). Adenoviral Infections—Cells were infected with replication-deficient adenoviruses (AdV) for either PKCα or LacZ as a control (23Garcia-Bermejo M.L. Leskow F.C. Fujii T. Wang Q. Blumberg P.M. Ohba M. Kuroki T. Han K.C. Lee J. Marquez V.E. Kazanietz M.G. J. Biol. Chem. 2002; 277: 645-655Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar, 25Fujii T. Garcia-Bermejo M.L. Bernabo J.L. Caamano J. Ohba M. Kuroki T. Li L. Yuspa S.H. Kazanietz M.G. J. Biol. Chem. 2000; 275: 7574-7582Abstract Full Text Full Text PDF PubMed Scopus (195) Google Scholar) 4 h (MOI, 100 pfu/cell) in serum-free RPMI 1640 medium. After removal of the AdV by extensive washing, cells were incubated in complete medium for 20 h. Expression of PKCα was readily detected 24 h after infection and remained stable for several days (data not shown). Amplification of AdVs was carried out in HEK293 cells. Titers of viral stocks were normally higher than 1 × 109 pfu/cell. Western Blot Analysis—Cells were lysed in a buffer containing 50 mm Tris-HCl, pH 6.8, 10% glycerol, 2% SDS, and 5% β-mercaptoethanol. Cell extracts (20 μg of protein/lane) were subject to SDS-PAGE and transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MD). After blocking with 5% milk in 0.1% Tween 20/PBS, membranes were incubated with the primary antibody. The following first antibodies were used: anti-PKCα and anti-cyclin D1 (Upstate Biotechnology Inc., Lake Placid, NY); anti-cyclin A1, anti-cyclin B1, anti-cyclin E, anti-E2F-1, anti-p27, anti PKCϵ and anti-PCNA (Santa Cruz Biotechnology Inc., Santa Cruz, CA); anti-p21Cip1, anti-ATF-2 and anti-PKCδ (Cell Signaling Technology, Beverly, MA); anti-Rb (BD Transduction Laboratories); anti-actin and anti-vinculin (Sigma). Either anti-mouse or anti-rabbit horseradish peroxidase (1:3000, Bio-Rad) were used as secondary antibodies. Bands were visualized by enhanced chemoluminescence. RT-PCR—Cells were lysed with TRIzol, and total RNA was extracted according to the manufacturer's protocol (Invitrogen). Total RNA (5 μg) from each sample was reverse-transcribed using SuperScript™ II reverse transcriptase (Invitrogen). cDNA (2 μl) was subject to 20 PCR amplification cycles using the following primers: p21Cip1 forward 5′-GCGATGGAACTTCGACTTTGT and p21Cip1 reverse 5′-GGGCTTCCTCTTGGAGAAGAT; GADPH forward 5′-TGAAGGTCGGAGTCAACGGATTT and GADPH reverse 5′-GATGGGATTTCCATTGATGACAAGC. RNA Interference (RNAi)—21-bp dsRNAs were purchased from Dharmacon Research, Inc. (Dallas, TX) or Ambion (Austin, TX) and transfected into H358 cells using Oligofectamine (Invitrogen) following the protocol provided by the manufacturer. The following targeting sequences were used: PKCα (1: AATCCTTGTCCAAGGAGGCTG; 2: GAACAACAAGGAATGACTT), p21Cip1 (1: AACATACTGGCCTGGACTGTT; 2: ATCGTCCAGCGACCTTCCT), and a control unrelated sequence (Silencer® negative control 7 siRNAi, Ambion). Plasmid Transfections and Promoter Analyses—H358 cells in 12-well plates (5 × 104 cells/well) were transiently transfected with 0.5 μg of a p21Cip1 Firefly luciferase reporter vector (26Facchinetti M.M. De Siervi A. Toskos D. Senderowicz A.M. Cancer Res. 2004; 64: 3629-3637Crossref PubMed Scopus (50) Google Scholar) using Fugene 6 (Roche Applied Science, Indianapolis, IN). A Renilla luciferase expression vector (50 ng, pRL-TK, Promega, Madison, WI) was co-transfected for normalization of transfection efficiency. After transfection, cells were grown overnight in complete medium, synchronized at the G1/S boundary, and lysed. Cells extracts were subject to luciferase determination using the Dual-Luciferase Reporter Assay System (Promega). Results were expressed as the ratio between Firefly and Renilla luciferase. Immunofluorescence—Cells were plated on coverslides placed on 35-mm dishes. After synchronization, cells were stimulated with either PMA or vehicle, and at the indicated times washed twice with PBS, fixed for 10 min with methanol, washed three times for 5 min with PBS, and permeabilized for 15 min with 0.25% Triton X-100 in PBS, followed by a 10-min incubation in 100 mm glycine in PBS. After blocking for 30 min with 3% fetal bovine serum in PBS, a mouse anti-p21Cip1 monoclonal antibody (1:250) was added (1 h), followed by washing with 0.1% Tween-20 in PBS, and incubation with a CY3-conjugated anti-mouse antibody (1:1000; Jackson Immunoresearch Laboratories, Inc.) was added. After additional washings, DNA was stained using DAPI (0.1 μg/ml, 10 min). Coverslides were washed three times with PBS, mounted with Vectashield, and visualized with a Nikon Eclipse TE2000 inverted microscope equipped with a q-imaging Exi digital cooled camera (1360 × 1036 pixels, Burnaby, Canada). Recordings were done using Northern Eclipse 6.0 software (Empix Imaging Inc., Cheektowaga, NY). A 40× planar objective (Nikon) was used for all recordings. Subcellular Fractionation—Cells were washed, collected in ice-cold PBS, and then pelleted and fractionated into cytosolic and nuclear fractions, as described elsewhere (27Zhou B.P. Liao Y. Xia W. Spohn B. Lee M.H. Hung M.C. Nat. Cell Biol. 2001; 3: 245-252Crossref PubMed Scopus (892) Google Scholar). Separation of cytosolic and particulate fractions was performed by ultracentrifugation, as described previously (28Caloca M.J. Fernandez N. Lewin N.E. Ching D. Modali R. Blumberg P.M. Kazanietz M.G. J. Biol. Chem. 1997; 272: 26488-26496Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar). Determination of Senescence-associated β-Galactosidase Activity—Senescence-associated β-Galactosidase (SA-β-Gal) staining was carried out as described by Dimri et al. (29Dimri G.P. Lee X. Basile G. Acosta M. Scott G. Roskelley C. Medrano E.E. Linskens M. Rubelj I. Pereira-Smith O. Peacocke M. Campisi J. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 9363-9367Crossref PubMed Scopus (5545) Google Scholar). Briefly, 1 × 105 cells were seeded in 60-mm plates. After synchronization, cells were stimulated with either PMA or vehicle, and 3 days later fixed with 2% formamide/0.2% glutaraldehyde in PBS (10 min, room temperature) and incubated overnight at 37 °C with a solution containing 1 mg/ml 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside (X-Gal), 5 mm potassium ferrocyanide, 5 mm potassium ferricyanide, 150 mm NaCl, and 2 mm MgCl2 in 40 mm citric acid/sodium phosphate buffer, pH 6.0. 24 h later the percentage of SA-β-Gal-positive (blue) cells in each sample was determined after scoring 300 cells using a bright-field microscope. Analysis of Telomerase Activity—Non-isotopic telomerase activity was determined by the telomeric repeat amplification protocol (TRAP) using the TRAPEZE® telomerase detection kit (Chemicon International, Temecula, CA) according to the manufacturer's instructions. Statistical Analysis—Data are presented as mean ± S.D. and were analyzed using a Student's t test. A p value of <0.05 was considered statistically significant. PMA Causes Irreversible G2/M Arrest in NSCLC Cells—PKC activation with phorbol esters causes a profound inhibition of cell proliferation in lung cancer cells, and our previous work has identified a PKCδ-dependent inhibitory mechanism that limits cell progression from G1 into S phase (24Nakagawa M. Oliva J.L. Kothapalli D. Fournier A. Assoian R.K. Kazanietz M.G. J. Biol. Chem. 2005; 280: 33926-33934Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar). However, when asynchronously growing H358 NSCLC cells were treated for 30 min with the PKC activator PMA (100 nm), a significant accumulation of cells in G2/M was observed, as determined by flow cytometry analysis (Fig. 1A, left panel). At 48 and 72 h the population of G2/M cells in response to PMA treatment doubled relative to vehicle-treated cells. A significant accumulation of cells in G2/M in response to PMA was also observed in H441 and H322 cells (Fig. 1A, right panel). PKC activation by PMA induces apoptosis in several cellular models (1Griner E.M. Kazanietz M.G. Nat. Rev. Cancer. 2007; 7: 281-294Crossref PubMed Scopus (759) Google Scholar, 5Gavrielides M.V. Frijhoff A.F. Conti C.J. Kazanietz M.G. Curr. Drug Targets. 2004; 5: 431-443Crossref PubMed Scopus (47) Google Scholar, 23Garcia-Bermejo M.L. Leskow F.C. Fujii T. Wang Q. Blumberg P.M. Ohba M. Kuroki T. Han K.C. Lee J. Marquez V.E. Kazanietz M.G. J. Biol. Chem. 2002; 277: 645-655Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar), but no evidence of apoptosis in response to PMA was observed in H358, H441, or H322 cells either by flow cytometry (absence of a sub-G0/G1 cell population) or by microscopy (absence of fragmented nuclei after DAPI staining, data not shown). To begin dissecting the mechanisms that lead to the accumulation of H358 cells in G2/M, we decided to synchronize cells with hydroxyurea (HU) and analyze the effects of PMA on S → G2 progression. Approximately 70% of H358 cells were synchronized in late G1 after HU treatment. Upon removal of HU by extensive washing, cells began progressing into S phase at ∼2 h, and into G2 phase at ∼6 h. HU treatment did not seem to cause significant replicative stress, as judged by the ability of cells to complete the cell cycle (supplemental Fig. S1) and reach confluence, the absence of apoptosis, as well as the possibility of subculturing cells for several passages after HU treatment (data not shown). To analyze the effect of phorbol ester treatment on S → G2 progression, H358 cells were treated with PMA (100 nm, 30 min) or vehicle 2 h after HU release, and cell cycle distribution was determined at different times. Fig. 1B shows that PMA caused a significant delay in S → G2 transition. Indeed, while it takes 8 h to reach the maximum % of control cells in G2, this effect is achieved at 11 h in PMA-treated cells. The effect was dependent on the PMA concentration (Fig. 1C, upper panel), as well as the length of incubation, with maximum response at 30 min (Fig. 1C, center panel). The S → G2 delay was observed only when PMA was added in late G1-early S phase (t = 2-5 h) but not when the phorbol ester was added in late S phase (t = 6 h) (Fig. 1C, lower panel). Notably, despite the short duration of the incubation with PMA, the majority of the cells still remained in G2/M 72 h after treatment (Fig. 1B, right panel). Therefore, the delay in S → G2 transition was accompanied by an irreversible arrest that prevented cells to complete the cycle and progress into G1. Indeed, treatment of cells synchronized in the G1/S phase boundary (t = 2 h after HU release) with 100 nm PMA (30 min) abolished proliferation, as determined by cell counting (Fig. 1D, left panel). In agreement with this data, PMA treatment of HU-synchronized cells resulted in a marked inhibition of DNA synthesis, as judged by analysis of [3H]thymidine incorporation (Fig. 1D, right panel). Irreversible arrest by PMA was also observed in asynchronous cultures of H358 cells, as determined both by cell counting and [3H]thymidine incorporation (Fig. 1E). Thus, PMA treatment of H358 cells in S phase leads to irreversible accumulation of cells in G2, arguing for multiple points of regulation of the cell cycle by PKC activation. PMA Induces Senescence in H358 Cells in a Cell Cycle Phase-specific Manner—Morphological analysis of H358, H441, and H322 cells 72 h after PMA treatment, either in asynchronous or HU-synchronized cultures, showed that a significant number of cells became large and flat, and exhibited enlarged nuclei. These features, together with irreversible growth, are hallmarks of senescence (30Campisi J. Cell. 2005; 120: 513-522Abstract Full Text Full Text PDF PubMed Scopus (1763) Google Scholar). Remarkably, cells remain attached for at least 10 days post-PMA treatment. At that time the phenotypic changes were more pronounced (Fig. 2A), with cells even larger, multinucleated, and with a characteristic vacuolization. We then determined the effect of PMA on telomerase activity, using a telomeric repeat amplification protocol (TRAP). PMA treatment in S phase caused a significant reduction of telomerase activity in H358 cells (Fig. 2B). To further establish the presence of a senescence phenotype, we measured the expression of SA-β-Gal, a well-established marker of senescence (29Dimri G.P. Lee X. Basile G. Acosta M. Scott G. Roskelley C. Medrano E.E. Linskens M. Rubelj I. Pereira-Smith O. Peacocke M. Campisi J. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 9363-9367Crossref PubMed Scopus (5545) Google Scholar). Notably, >50% of H358 cells in asynchronous cultures became SA-β-Gal positive after PMA treatment, compared with <10% in response to vehicle. Similarly, a significant fraction of H441 and H322 become SA-β-Gal positive (Fig. 2C). The proportion of SA-β-Gal positive H358 cells was even higher (>75%) when PMA treatment was carried out in HU-synchronized cells. However, when PMA was added to H358 cells synchronized in early G1 phase, there was only a slight increase in the number of β-Gal positive cells. Therefore, the PMA effect is phase specific, as senescence does not occur when PKC activation was triggered in early G1. Altogether, these data strongly suggest that the irreversible G2/M arrest induced by PMA during S phase leads to senescence. The senescence phenotype was also observed in H460 lung cancer cells, as well as in HT-29 and HCT-116 colon cancer cells. 5M. C. Caino, J. L. Oliva, and M. G. Kazanietz, data not shown. p21Cip1 Is Required for PMA-induced G2/M Arrest and Senescence Induction—Analysis of relevant cell cycle markers in NSCLC cells upon HU release revealed a marked elevation in the levels of the Cdk inhibitor p21Cip1 in response to PMA, which was sustained even 72 h after treatment (Fig. 3, A and B). p21Cip1 up-regulation is a characteristic feature of senescent cells (31Noda A. Ning Y. Venable S.F. Pereira-Smith O.M. Smith J.R. Exp. Cell Res. 1994; 211: 90-98Crossref PubMed Scopus (1305) Google Scholar). Additional studies in H358 cells revealed no significant changes in p27 levels. PMA treatment led to a marked reduction in Rb phosphorylation and in the levels of the transcription factor E2F-1. A sustained reduction in the levels of cyclin E, cyclin A, and cyclin B, as well as induction of cyclin D1, were also observed (Fig. 3B). While the levels of p21Cip1 protein did not change significantly across S phase in H358 cells after HU release (Fig. 3C, upper panel, -PMA), a progressive p21Cip1 up-regulation was observed in response to PMA (Fig. 3C, upper panel, +PMA). Similar results were observed at the mRNA level, as determined by RT-PCR (Fig. 3C, lower panel). In addition, PMA treatment of HU-synchronized cells promoted a significant activation of a p21Cip1 luciferase reporter (Fig. 3D). As newly synthesized p21Cip1 protein translocates to the nucleus to exert its inhibitory activity on cyclin-Cdk complexes (32Sherr C.J. Roberts J.M. Genes Dev. 1995; 9: 1149-1163Crossref PubMed Scopus (3201) Google Scholar), we carried out a subcellular fractionation analysis. ATF-2 and vinculin were used as controls for the nuclear and cytosolic fractions, respectively. A marked elevation of nuclear p21Cip1 in response to PMA was observed (Fig. 3E). Elevated p21Cip1 levels were also detected in the cytosolic fraction, which probably reflects protein recently synthesized. Likewise, immunofluorescence staining" @default.
• W2148760047 created "2016-06-24" @default.
• W2148760047 creator A5029548499 @default.
• W2148760047 creator A5054111083 @default.
• W2148760047 creator A5068973959 @default.
• W2148760047 creator A5077192270 @default.
• W2148760047 date "2008-02-01" @default.
• W2148760047 modified "2023-10-17" @default.
• W2148760047 title "S-Phase-specific Activation of PKCα Induces Senescence in Non-small Cell Lung Cancer Cells" @default.
• W2148760047 cites W1509669696 @default.
• W2148760047 cites W1528985769 @default.
• W2148760047 cites W1577702300 @default.
• W2148760047 cites W1641731911 @default.
• W2148760047 cites W1752089945 @default.
• W2148760047 cites W1964347602 @default.
• W2148760047 cites W1965895804 @default.
• W2148760047 cites W1966431115 @default.
• W2148760047 cites W1975702359 @default.
• W2148760047 cites W1977629626 @default.
• W2148760047 cites W1980814667 @default.
• W2148760047 cites W1983673827 @default.
• W2148760047 cites W1987496015 @default.
• W2148760047 cites W1989039704 @default.
• W2148760047 cites W1993797415 @default.
• W2148760047 cites W2001733842 @default.
• W2148760047 cites W2007772649 @default.
• W2148760047 cites W2014608875 @default.
• W2148760047 cites W2015066175 @default.
• W2148760047 cites W2024209230 @default.
• W2148760047 cites W2028207680 @default.
• W2148760047 cites W2031034039 @default.
• W2148760047 cites W2033238666 @default.
• W2148760047 cites W2035920778 @default.
• W2148760047 cites W2043390076 @default.
• W2148760047 cites W2053191673 @default.
• W2148760047 cites W2054531119 @default.
• W2148760047 cites W2062077798 @default.
• W2148760047 cites W2078790300 @default.
• W2148760047 cites W2082607775 @default.
• W2148760047 cites W2084910239 @default.
• W2148760047 cites W2087127386 @default.
• W2148760047 cites W2087268121 @default.
• W2148760047 cites W2098034735 @default.
• W2148760047 cites W2104908670 @default.
• W2148760047 cites W2111133130 @default.
• W2148760047 cites W2114234134 @default.
• W2148760047 cites W2114369707 @default.
• W2148760047 cites W2115210097 @default.
• W2148760047 cites W2115544008 @default.
• W2148760047 cites W2117029515 @default.
• W2148760047 cites W2121140284 @default.
• W2148760047 cites W2132337295 @default.
• W2148760047 cites W2136306650 @default.
• W2148760047 cites W2146605477 @default.
• W2148760047 cites W2154849611 @default.
• W2148760047 cites W2163585955 @default.
• W2148760047 cites W2462015223 @default.
• W2148760047 doi "https://doi.org/10.1074/jbc.m707576200" @default.
• W2148760047 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/18162471" @default.
• W2148760047 hasPublicationYear "2008" @default.
• W2148760047 type Work @default.
• W2148760047 sameAs 2148760047 @default.
• W2148760047 citedByCount "51" @default.
• W2148760047 countsByYear W21487600472012 @default.
• W2148760047 countsByYear W21487600472013 @default.
• W2148760047 countsByYear W21487600472014 @default.
• W2148760047 countsByYear W21487600472015 @default.
• W2148760047 countsByYear W21487600472016 @default.
• W2148760047 countsByYear W21487600472017 @default.
• W2148760047 countsByYear W21487600472018 @default.
• W2148760047 countsByYear W21487600472019 @default.
• W2148760047 countsByYear W21487600472020 @default.
• W2148760047 countsByYear W21487600472021 @default.
• W2148760047 countsByYear W21487600472022 @default.
• W2148760047 countsByYear W21487600472023 @default.
• W2148760047 crossrefType "journal-article" @default.
• W2148760047 hasAuthorship W2148760047A5029548499 @default.
• W2148760047 hasAuthorship W2148760047A5054111083 @default.
• W2148760047 hasAuthorship W2148760047A5068973959 @default.
• W2148760047 hasAuthorship W2148760047A5077192270 @default.
• W2148760047 hasBestOaLocation W21487600471 @default.
• W2148760047 hasConcept C126322002 @default.
• W2148760047 hasConcept C1491633281 @default.
• W2148760047 hasConcept C185592680 @default.
• W2148760047 hasConcept C195794163 @default.
• W2148760047 hasConcept C2776256026 @default.
• W2148760047 hasConcept C2777714996 @default.
• W2148760047 hasConcept C502942594 @default.
• W2148760047 hasConcept C522857546 @default.
• W2148760047 hasConcept C55493867 @default.
• W2148760047 hasConcept C62478195 @default.
• W2148760047 hasConcept C71924100 @default.
• W2148760047 hasConcept C86803240 @default.
• W2148760047 hasConcept C95444343 @default.
• W2148760047 hasConceptScore W2148760047C126322002 @default.
• W2148760047 hasConceptScore W2148760047C1491633281 @default.
• W2148760047 hasConceptScore W2148760047C185592680 @default.
• W2148760047 hasConceptScore W2148760047C195794163 @default.

• next