FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2149022561> ?p ?o ?g. }

• W2149022561 endingPage "46225" @default.
• W2149022561 startingPage "46216" @default.
• W2149022561 abstract "The epimerization step that converts isopenicillin N into penicillin N during cephalosporin biosynthesis has remained uncharacterized despite its industrial relevance. A transcriptional analysis of a 9-kb region located downstream of thepcbC gene revealed the presence of two transcripts that correspond to the genes named cefD1 and cefD2 encoding proteins with high similarity to long chain acyl-CoA synthetases and acyl-CoA racemases from Mus musculus,Homo sapiens, and Rattus norvegicus. Both genes are expressed in opposite orientations from a bidirectional promoter region. Targeted inactivation of cefD1 andcefD2 was achieved by the two-marker gene replacement procedure. Disrupted strains lacked isopenicillin N epimerase activity, were blocked in cephalosporin C production, and accumulated isopenicillin N. Complementation in trans of the disrupted nonproducer mutant with both genes restored epimerase activity and cephalosporin biosynthesis. However, when cefD1 orcefD2 were introduced separately into the double-disrupted mutant, no epimerase activity was detected, indicating that the concerted action of both proteins encoded by cefD1 andcefD2 is required for epimerization of isopenicillin N into penicillin N. This epimerization system occurs in eukaryotic cells and is entirely different from the known epimerization systems involved in the biosynthesis of bacterial β-lactam antibiotics. The epimerization step that converts isopenicillin N into penicillin N during cephalosporin biosynthesis has remained uncharacterized despite its industrial relevance. A transcriptional analysis of a 9-kb region located downstream of thepcbC gene revealed the presence of two transcripts that correspond to the genes named cefD1 and cefD2 encoding proteins with high similarity to long chain acyl-CoA synthetases and acyl-CoA racemases from Mus musculus,Homo sapiens, and Rattus norvegicus. Both genes are expressed in opposite orientations from a bidirectional promoter region. Targeted inactivation of cefD1 andcefD2 was achieved by the two-marker gene replacement procedure. Disrupted strains lacked isopenicillin N epimerase activity, were blocked in cephalosporin C production, and accumulated isopenicillin N. Complementation in trans of the disrupted nonproducer mutant with both genes restored epimerase activity and cephalosporin biosynthesis. However, when cefD1 orcefD2 were introduced separately into the double-disrupted mutant, no epimerase activity was detected, indicating that the concerted action of both proteins encoded by cefD1 andcefD2 is required for epimerization of isopenicillin N into penicillin N. This epimerization system occurs in eukaryotic cells and is entirely different from the known epimerization systems involved in the biosynthesis of bacterial β-lactam antibiotics. The molecular genetics of cephalosporin biosynthesis is an excellent model for secondary metabolism, since considerable information on the enzymology (reviewed in Refs. 1Demain A.L. Demain A.L. Solomon N.A. Antibiotics Containing the β-Lactam Structure. Springer-Verlag New York Inc., New York1983: 189-228Google Scholar and 2Martı́n J.F. Liras P. Adv. Biochem. Eng. Biotechnol. 1989; 39: 153-187PubMed Google Scholar), molecular genetics, and gene expression mechanisms (3Aharanowitz Y. Cohen G. Martı́n J.F. Annu. Rev. Microbiol. 1992; 46: 461-495Crossref PubMed Scopus (199) Google Scholar, 4Martı́n J.F. Gutiérrez S. Demain A.L. Anke T. Fungal Biotechnology. Chapman and Hall, Weinheim, Germany1997: 91-127Google Scholar, 5Martı́n J.F. J. Bacteriol. 2000; 182: 2355-2362Crossref PubMed Scopus (74) Google Scholar) has accumulated in the last few years. The biosynthesis of cephalosporins by Acremonium chrysogenum and cephamycins by Amycolatopsis(Nocardia) lactamdurans and Streptomyces clavuligerus (reviewed in Refs. 6Liras P. Antonie Leeuwenhoek. 1999; 75: 109-124Crossref PubMed Scopus (57) Google Scholar and 7Martı́n J.F. Appl. Microbiol. Biotechnol. 1998; 50: 1-15Crossref PubMed Scopus (98) Google Scholar) begins with the formation of the tripeptide δ-(l-α-aminoadipyl)-l-cysteinyl-d-valine (ACV) 1The abbreviations used for: ACV, δ-(l-α-aminoadipyl)-l-cysteinyl-d-valine; IPN, isopenicillin N; DAC, deacetylcephalosporin C; HPLC, high pressure liquid chromatograph; GITC, 2,3,4,6-tetra-O-acetyl-β-d-glucopyranosyl isotiocyanate. 1The abbreviations used for: ACV, δ-(l-α-aminoadipyl)-l-cysteinyl-d-valine; IPN, isopenicillin N; DAC, deacetylcephalosporin C; HPLC, high pressure liquid chromatograph; GITC, 2,3,4,6-tetra-O-acetyl-β-d-glucopyranosyl isotiocyanate. by the ACV synthetase (8Martı́n J.F. J. Antibiot. (Tokyo). 2000; 53: 1008-1021Crossref PubMed Scopus (52) Google Scholar), followed by cyclicization of ACV to isopenicillin N (IPN). IPN is later converted into penicillin N by an epimerase activity that has remained uncharacterized so far in A. chrysogenum. After the epimerization step, penicillin N is transformed by a deacetoxycephalosporin C synthase (expandase) into deacetoxycephalosporin C, and finally, deacetoxycephalosporin C is converted into deacetylcephalosporin C (DAC) and cephalosporin C by DAC synthase (hydroxylase) and DAC acetyltransferase, respectively (Fig.1). The genes pcbAB (9Gutiérrez S. Dı́ez B. Álvarez E. Martı́n J.F. J. Bacteriol. 1991; 173: 2354-2365Crossref PubMed Scopus (134) Google Scholar) and pcbC (10Samson S.M. Belagaje R. Blankenship D.T. Chapman J.L. Perry D. Skatrud P.L. van Frank R.M. Abraham E.P. Baldwin J.E. Queener S.W. Ingolia T.D. Nature. 1985; 318: 191-194Crossref PubMed Scopus (167) Google Scholar) encoding ACV synthetase and IPN synthase are linked together in chromosome VII in the so-called “early cephalosporin gene cluster” (11Gutiérrez S. Fierro F. Casqueiro J. Martı́n J.F. Antonie Leeuwenhoek. 1999; 75: 81-94Crossref PubMed Scopus (55) Google Scholar). The genescefEF, encoding the bifunctional expandase-hydroxylase (12Samson S.M. Chapman J.L. Belagaje R. Queener S.W. Ingolia T.D. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 5705-5709Crossref PubMed Scopus (36) Google Scholar), and cefG, encoding the DAC acetyltransferase (13Gutiérrez S. Velasco J. Fernández F.J. Martı́n J.F. J. Bacteriol. 1992; 174: 3056-3064Crossref PubMed Scopus (67) Google Scholar, 14Velasco J. Gutiérrez S. Campoy S. Martı́n J.F. Biochem. J. 1999; 337: 379-385Crossref PubMed Google Scholar), are linked together in the so-called “late cephalosporin cluster” in chromosome I (11Gutiérrez S. Fierro F. Casqueiro J. Martı́n J.F. Antonie Leeuwenhoek. 1999; 75: 81-94Crossref PubMed Scopus (55) Google Scholar). The isopenicillin N epimerization step still remains unclear. Demain and co-workers (15Konomi T. Herchen S. Baldwin J.E. Yoshida M. Hunt N. Demain A.L. Biochem. J. 1979; 184: 427-430Crossref PubMed Scopus (78) Google Scholar, 16Sawada Y. Baldwin J.E. Singh P.D. Solomon N.A. Demain A.L. Antimicrob. Agents Chemother. 1980; 27: 380-387Google Scholar) reported that isopenicillin N was converted into penicillin N by extracts of A. chrysogenum, although the epimerizing enzyme was extremely labile (17Baldwin J.E. Keeping J.W. Singh P.D. Vallejo C.A. Biochem. J. 1981; 194: 649-651Crossref PubMed Scopus (22) Google Scholar, 18Jayatilake G.S. Huddleston J.A. Abraham E.P. Biochem. J. 1981; 194: 645-647Crossref PubMed Scopus (35) Google Scholar), preventing purification of the protein. However, the isopenicillin N epimerase has been purified from S. clavuligerus (19Jensen S.E. Westlake D.W.S. Wolfe S. Can. J. Microbiol. 1983; 29: 1526-1531Crossref PubMed Scopus (33) Google Scholar, 20Usui S. Yu C.A. Biochim. Biophys. Acta. 1989; 999: 78-85Crossref PubMed Scopus (33) Google Scholar) and A. lactamdurans (21Láiz L. Liras P. Castro J.M. Martı́n J.F. J. Gen. Microbiol. 1990; 136: 663-671Crossref Scopus (27) Google Scholar), and the cefD gene encoding this protein was cloned from both microorganisms (22Kovacevick S. Tobin M.B. Miller J.R. J. Bacteriol. 1990; 172: 3952-3958Crossref PubMed Google Scholar, 23Coque J.J.R. Liras P. Martı́n J.F. Mol. Gen. Genet. 1993; 236: 453-458Crossref PubMed Scopus (41) Google Scholar). Repeated attempts to clone the homologous cefD gene of A. chrysogenum using as probe the bacterial cefD gene or oligonucleotides based on bacterial epimerase conserved amino acid regions with the A. chrysogenum preferred codon usage were unsuccessful. 2S. Gutiérrez and J. F. Martı́n, unpublished results. 2S. Gutiérrez and J. F. Martı́n, unpublished results. These results suggested that the fungal IPN epimerization system was different from the bacterial one. In this article, we describe that two genes contain genetic information required for the epimerization step converting isopenicillin N into penicillin N in A. chrysogenum. The corresponding gene products act in a two-protein system described for the first time in antibiotic biosynthesis. The two genes (named cefD1 andcefD2) are completely different from the cefD gene of A. lactamdurans and S. clavuligerus. A. chrysogenum C10 (ATCC 48278), a strain producing high levels of cephalosporin C, was used for the genetic studies. Escherichia coli ESS2231, a β-lactam supersensitive strain, was used for routine cephalosporin bioassays. Escherichia coli DH5α andE. coli WK6 were used for plasmid purification (double-stranded or single-stranded DNA, respectively). All A. chrysogenum strains were first grown in seed medium (24Shen Y.Q. Wolfe S. Demain A.L. Bio/Technology. 1986; 4: 61-64Google Scholar) for 48 h. Ten ml of seed culture was used to inoculate 100 ml of defined production medium (MDFA) (24Shen Y.Q. Wolfe S. Demain A.L. Bio/Technology. 1986; 4: 61-64Google Scholar) in 500-ml triple-baffled flasks. The cultures were incubated at 25 °C in a rotary shaker at 250 rpm. The levels of cephalosporin antibiotics were determined by bioassay using E. coli ESS2231 as the test strain in plates with penicillinase from Bacillus cereus UL1 as described previously (13Gutiérrez S. Velasco J. Fernández F.J. Martı́n J.F. J. Bacteriol. 1992; 174: 3056-3064Crossref PubMed Scopus (67) Google Scholar). Several constructions named pCD4.5, pCD1, pCD2, and pCD1+2 were obtained from plasmid pJL43 (9Gutiérrez S. Dı́ez B. Álvarez E. Martı́n J.F. J. Bacteriol. 1991; 173: 2354-2365Crossref PubMed Scopus (134) Google Scholar). pD4.5 was obtained from pJL43 by inserting a 6.8-kb SalI fragment bearing the cefD1, cefD2, and bidirectional promoter region (see Fig. 5). SalI andBglII restriction sites were introduced by in vitro mutagenesis in the cefD1 and cefD2 genes, respectively. Finally, the hygromycin resistance (hph) cassette, subcloned from pAN7-1 (25Punt P.J. Dingemanse M.A. Kuyvenhoven A. Soede R.D. Pouwles P.H. van den Hondel C.C.A.A. Gene (Amst.). 1990; 93: 101-109Crossref PubMed Scopus (235) Google Scholar), was inserted in the BglII site to inactivate the cefD2 gene. PCD1+2 was obtained by inserting a 5.8-kbBamHI-EcoRV fragment bearing the cefD1 and cefD2 genes into the BamHI-EcoRI site of pC43 (26Gutiérrez S. Marcos A.T. Casqueiro J. Kosalková K. Fernández F.J. Velasco J. Martı́n J.F. Microbiology. 1999; 145: 317-324Crossref PubMed Scopus (41) Google Scholar). pCD1 bearing the cefD1 gene was constructed by partial digestion of pCD1+2 with SacI and religation. pCD2 contains a 3.5-kb BamHI-SalI fragment bearing the cefD2 gene inserted into theBamHI-EcoRI site of pC43. Transformation of A. chrysogenum protoplasts was performed as described previously (27Gutiérrez S. Dı́ez B. Alvarez E. Barredo J.L. Martı́n J.F. Mol. Gen. Genet. 1991; 225: 56-64Crossref PubMed Scopus (54) Google Scholar). DNA fragments were subcloned into pBluescript SK+, and a nested set of fragments was generated with the Erase-a-base procedure (Promega) by digestion with exonuclease III (28Henikoff S. Gene (Amst.). 1984; 28: 351-359Crossref PubMed Scopus (2831) Google Scholar). The fragments were sequenced by the dideoxynucleotide chain termination method (29Sanger F. Nicken S. Coulson A.R. Proc. Natl. Acad. Sci. U. S. A. 1977; 74: 5463-5467Crossref PubMed Scopus (52497) Google Scholar). To elucidate the presence of putative introns in the DNA sequence of thecefD2 gene, the DNA region containing the expected intron splicing sites was amplified by RT-PCR (Invitrogen) using RNA ofA. chrysogenum 48-h cultures as template with the primers 4A (TATCCGGCAAGCTTGGTCGTAGAG) and 4B (CTTGCGTGAGGGGCGGATGC). The amplified region was sequenced to confirm the presence of the intron. The nucleotide sequence is deposited in the GenBank™/EBI Data Bank under the accession number AJ507632. In vitro mutagenesis was performed with the QuikChange site-directed mutagenesis kit (Stratagene) by following the manufacturer's instructions. Oligonucleotides A1 (5′-CCGCTGCCTACCGTCGACGCCAAGC-3′) and A2 (5′-GCTTGGCGTCGACGGTAGGCAGCGG-3′) were used in the formation of aSalI site in the cefD1 gene. Similarly, a BglII site in the cefD2 gene was obtained with the oligonucleotides B1 (5′-GGCGCCATAGATCTGCCAAGAGCATGC-3′) and B2 (5′-GCATGCTCTTGGCAGATCTATGGCGCC-3′). Genomic DNA of A. chrysogenum was isolated as described previously (27Gutiérrez S. Dı́ez B. Alvarez E. Barredo J.L. Martı́n J.F. Mol. Gen. Genet. 1991; 225: 56-64Crossref PubMed Scopus (54) Google Scholar). Three μg of genomic DNA fromA. chrysogenum C10 or its transformants were digested withEcoRI and the fragments were resolved in a 0.7% agarose gel. The gel was blotted onto Hybond-N membranes (Amersham Biosciences) and hybridized with different probes (see “Results”) labeled with [32P]dCTP (30Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). Total A. chrysogenum RNA was isolated with the RNeasy Kit (Qiagen). Total RNA was resolved by agarose-formaldehyde gel electrophoresis and blotted onto Hybond-N membranes (Amersham Biosciences) as described by Sambrook et al. (30Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). Hybridization probes were labeled with [α-32P]dCTP by nick translation and purified by filtration through Wizard minicolumns (Promega). Hybridizations were carried out as described by Sambrooket al. (30Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). The intensity of the hybridization bands was determined by using a phosphor imager scanner (Instant Imager; Packard). Cephalosporin C analysis was performed in a Beckman System Gold HPLC equipped with a μBondapack C18 column as described previously (31Gutiérrez S. Velasco J. Marcos A.T. Fernández F.J. Fierro F. Dı́ez B. Barredo J.L. Martı́n J.F. Appl. Microbiol. Biotechnol. 1997; 48: 606-614Crossref PubMed Scopus (63) Google Scholar, 32Kosalková K. Marcos A.T. Martı́n J.F. J. Ind. Microbiol. Biotechnol. 2001; 27: 252-258Crossref PubMed Scopus (16) Google Scholar). HPLC identification of isopenicillin N and penicillin N was performed as described by Neuss et al. (33Neuss N. Berry D.M. Kupka J. Demain A.L. Queener S.W. Duckworth D.C. Huckstep L.L. J. Antibiot. 1982; 35: 580-584Crossref PubMed Scopus (19) Google Scholar). Isopenicillin N and penicillin N (500 μg/ml) were derivatized with 2,3,4,6-tetra-O-acetyl-β-d-glucopyranosyl isotiocyanate (GITC) (2 mg/ml in acetonitrile) for 2 h at pH 8.5 (adjusted with sodium bicarbonate). The HPLC separation was performed in a Beckman System Gold HPLC equipped with a μBondpack C18 column with a mobile phase of methanol/acetonitrile/acetic acid/water (36:7:2:55) with a flow of 1.2 ml/min. The IPN epimerase assay was performed as described by Lübbe et al. (34Lübbe C. Wolfe S. Demain A.L. Appl. Microbiol. Biotechnol. 1986; 23: 367-368Google Scholar). IPN epimerase activity was determined by measuring the in vitro conversion of isopenicillin into penicillin N. The results were quantified by a coupled reaction by determining the conversion of IPN into cephalosporin C (CPC). Cell-free extracts were prepared from A. chrysogenum cultures grown for 72 h. The enzymatic activity was expressed in units/mg of protein. One unit is the activity forming 1 ng of CPC/min in the coupled assay. The specific activity is given as units/mg of protein. Total protein concentration in the cell extract was measured by the Bradford assay. Since the genes encoding all other proteins involved in CPC biosynthesis are clustered in two separate loci, we hypothesized that the gene encoding the protein(s) involved in the conversion of isopenicillin N into penicillin N might be located in one of the two cephalosporin gene clusters. Recently, we have reported that a gene,cefT, located in the early cephalosporin cluster downstream from pcbAB, encoding a multidrug efflux pump protein causes a significant increase of cephalosporin C production (35Ullán R.V. Liu G. Casqueiro J. Gutiérrez S. Bañuelos O. Martı́n J.F. Mol. Gen. Genet. 2002; 267: 673-683Crossref PubMed Scopus (68) Google Scholar). To search for genes located on the other side of the early cluster downstream from the pcbC gene, a transcript map of this region was made using RNA extracted from mycelia of A. chrysogenum grown for 48 h in MDFA medium, since at this time the expression of other CPC biosynthetic genes is known to be high in this cephalosporin-overproducing strain (36Velasco J. Gutiérrez S. Fernández F.J. Marcos A.T. Arenós C. Martı́n J.F. J. Bacteriol. 1994; 176: 985-991Crossref PubMed Scopus (39) Google Scholar). Five probes, P1, P2, P3, P4, and P5 (Fig. 2 A), covering 9 kb downstream of the pcbC gene were used. Results showed (Fig. 2 B) the presence of three transcript signals. Probe P1 gave rise to a 1.15-kb hybridization band, coinciding with the known size of the transcript of the pcbC gene (26Gutiérrez S. Marcos A.T. Casqueiro J. Kosalková K. Fernández F.J. Velasco J. Martı́n J.F. Microbiology. 1999; 145: 317-324Crossref PubMed Scopus (41) Google Scholar). Probes P2 and P3 highlighted a hybridizing RNA of 1.2 kb, and probes P4 and P5 gave a hybridizing transcript of 2.0 kb (Fig. 2 B), indicating the presence in this region of two open reading frames named ORF1 and ORF2. A 5.8-kb BamHI-EcoRV fragment containing ORF1 and ORF2 was cloned in the pBluescript KS+ and sequenced on both strands. Sequence analysis revealed the presence of two open reading frames. ORF1 has 2193 nucleotides, and it is interrupted by the presence of five introns. This gene was also cloned from a previously constructed cDNA library (37Velasco J. Gutiérrez S. Casqueiro J. Fierro F. Campoy S. Martı́n J.F. Appl. Microbiol. Biotechnol. 2001; 57: 300-356Google Scholar), and the sequence confirmed the presence of the five introns. ORF1 encoded a protein of 642 amino acids with a deduced molecular mass of 71 kDa. The encoded protein showed similarity to long chain acyl-CoA synthetases (Fig. 3), particularly those from Homo sapiens (26.3% identical amino acids), Rattus norvegicus (25.5% identity), and Mus musculus (25.5% identity) (38Uchiyama A. Aoyama T. Kamijo K. Uchida Y. Kondo N. Orii T. Hashimoto T. J. Biol. Chem. 1996; 271: 30360-30365Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar). The ORF1-encoded protein has all the characteristic motifs of the acyl-CoA ligases involved in the activation (usually through an adenylation step) of the carboxyl group of fatty acids or amino acids (39Turgay K. Krause M. Marahiel M.A. Mol. Microbiol. 1992; 6: 529-546Crossref PubMed Scopus (172) Google Scholar). ORF2 consists of 1146 nucleotides, and it is interrupted by the presence of one intron. RT-PCR studies using RNA from 48-h cultures ofA. chrysogenum C10 confirmed the presence of the intron. A DNA band of the expected size (92 bp), assuming the splicing of the intron, was obtained by RT-PCR. The nucleotide sequence of the amplified DNA band showed that the intron had been removed at the splicing sites corresponding to nucleotides 64–157 numbered from the ATG translation initiation codon. ORF2 encoded a protein of 383 amino acids with a deduced molecular mass of 41.4 kDa. The encoded protein showed (Fig. 4) similarity to α-methyl-acyl-CoA racemases, particularly those from H. sapiens (42.1% identical amino acid) M. musculus(39.4% identity) and R. norvegicus (39.3%) (40Reichel C. Brugger R. Bang H. Geisslinger G. Brune K. Mol. Phamacol. 1997; 51: 76-582Google Scholar, 41Schmitz W. Helander H.M. Hiltunen J.K. Conzelmann E. Biochem. J. 1997; 326: 883-889Crossref PubMed Scopus (26) Google Scholar). To study the role of the proteins encoded by ORF1 and ORF2 in cephalosporin C biosynthesis, targeted inactivation of both genes was performed with the double marker technique (42Mansour S.L. Thomas K.R. Capecchi M.R. Nature. 1988; 336: 348-352Crossref PubMed Scopus (1318) Google Scholar) developed for targeted inactivation in A. chrysogenum (43Liu G. Casqueiro J. Bañuelos O. Cardoza R.E. Gutiérrez S. Martı́n J.F. J. Bacteriol. 2001; 183: 1765-1772Crossref PubMed Scopus (32) Google Scholar). To perform targeted inactivation of these genes, plasmid pD4.5 was constructed (Fig. 5 A); this plasmid carries an incomplete ORF2 (obtained by insertion of the hygromycin resistance cassette) and ORF1 inactivated by a frameshift mutation introduced in vitro. Plasmid pD4.5 contains also the bleomycin resistance marker (Fig. 5). Plasmid pD4.5 was transformed into A. chrysogenum C10, and transformants were selected by the resistance to hygromycin B. The transformants were screened for those clones showing a hygRphleS phenotype, indicating that double recombination had occurred. Thirty-three transformants of the 250 clones tested showed the hygR phleS phenotype. All of these 33 transformants were tested for cephalosporin production by the agar plug method. Nine transformants showed a drastic reduction in the cephalosporin production, and seven additional transformants showed no cephalosporin production at all as compared with A. chrysogenum C10, suggesting that targeted inactivation had occurred in the mutants. To confirm that targeted inactivation took place at the right position, the seven nonproducing transformants and two others with drastic reduction in cephalosporin production were analyzed by Southern blot.A. chrysogenum C10 and one transformant (Fig. 5 B,lane 8) with no reduction in cephalosporin production were used as controls. The DNA of all strains was digested with SalI and hybridized with a probe internal to the bidirectional promoter region located between ORF1 and ORF2 (Fig.5 A). Results showed that the A. chrysogenum C10 (Fig. 5 B, lane 11) hybridized with a genomic DNA band of 6.8 kb; however, in transformants with no cephalosporin production (Fig. 5 B, lanes 3–7, 9, and 10), the 6.8-kb hybridization band was converted into a band of 3.8 kb, as expected, by a canonical double recombination (Fig. 5 A). In transformants with a drastic reduction in cephalosporin production (Fig.5 B, lanes 1 and 2) the 6.8 kb is converted into a 5.0-kb hybridization signal, suggesting that a noncanonical recombination process had occurred at the ORF1-ORF2 locus. By contrast, in the transformant with no reduction in cephalosporin production (Fig. 5 B, lane 8), two hybridization bands of 3.8 and 6.8 kb were present, suggesting an ectopical integration of the pD4.5 plasmid. To study in more detail the effect of targeted inactivation of the ORF1 and ORF2, three transformants named TD167, TD189, and TD234 (lanes 3, 5, and 10 in Fig. 5 B) were selected. To study whether proteins encoded by ORF1 and ORF2 were involved in the conversion of isopenicillin N into penicillin N, the epimerase activity was measured in cell extracts of three disrupted transformants (TD167, TD189, and TD234) and the parental strain A. chrysogenum C10. Results showed that the epimerase activity was absent in the ORF1-ORF2-disrupted strains, both at 72 and 96 h, whereas theA. chrysogenum C10 strained a high level of IPN epimerase activity (92 units/mg of protein) at 72 h. These results clearly indicated that the proteins encoded by the ORF1 and ORF2 are involved in the epimerization step in cephalosporin C biosynthesis. Thus, the corresponding genes have been namedcefD1 and cefD2 according to standard β-lactam gene nomenclature, since the designation cefD is used to describe the bacterial epimerase gene (44Martı́n J.F. Ingolia T.D. Queener S.W. Leong S.A. Berka R. Molecular Industrial Mycology. Marcel Dekker, New York1990: 149-195Google Scholar). If cefD1 and cefD2 encode the IPN epimerase, the TD167, TD189, and TD234 mutants should accumulate isopenicillin N. Results showed (Fig.6 A) that no cephalosporins were detected by bioassay in any of the disrupted strains, whereas in the same culture conditions high cephalosporin production was observed in either A. chrysogenum C10 or in the nondisrupted transformant. Analysis by HPLC of the culture broth supernatant (Fig.6 B) showed that the disrupted strains formed no traces of cephalosporin C, whereas in A. chrysogenum C10 cephalosporin C is produced. The culture filtrates from the three disrupted strains, TD167, TD189, and TD234, and the parental A. chrysogenum C10 were treated with GITC (see “Experimental Procedures”), and the derivatized compounds were resolved by HPLC. Results showed that inA. chrysogenum C10 culture broth the peaks corresponding to both isopenicillin N and penicillin N were present (Fig.7). However, in the three disrupted strains, the peak corresponding to penicillin N is absent, and at the same time there is an accumulation of isopenicillin N, confirming the previous evidence indicating that disrupted strains are blocked in isopenicillin N epimerase. To elucidate whether both the acyl-CoA synthetase and the acyl-racemase encoded by cefD1 and cefD2 or just one of them were involved in the conversion of isopenicillin N into penicillin N, a series of complemented strains lacking one or both of these genes was created. For this purpose, plasmids pCD1, pCD2, and pCD1+2 bearing thecefD1, cefD2, or both genes, respectively, were constructed (Fig. 8). These three plasmids were transformed separately in the TD189 deletion mutant, and transformants were selected by resistance to phleomycin. Five transformants (TCD1) obtained with the pCD1 plasmids were selected, and their genomic DNA digested with SacI was hybridized with a 1-kb fragment of thecefD1-cefD2 bidirectional promoter region (Fig.5) as probe. Results showed (Fig. 8 A) that all five transformants gave hybridization with a DNA band of 4.5 kb in addition to the endogenous 6.6-kb hybridization band (corresponding to the disrupted gene in the host TD189 strain), indicating that the insert of the plasmid pCD1 was intact. Similarly, five transformants (TCD2) obtained with the pCD2 plasmid were selected, and their DNA was digested with a mixture ofSpeI and ClaI and hybridized with the same probe (1 kb of the promoter region) as above. Results showed (Fig.8 B) a hybridization band of 5 kb in several transformants, indicating that the insert of plasmid pCD2 is intact. The large 24-kb hybridization band corresponded to the endogenous hybridizing band in the cefD1-cefD2 disrupted clone (TD189;lane 5), whereas the wild type A. chrysogenum gave a 20-kb hybridization band. Finally, the DNA of three transformants (TCD1+2) obtained with the pCD1+2 plasmid was digested with a mixture of SpeI and ClaI and hybridized with the same 1-kb probe as above. Results showed (Fig. 8 C) that the probe hybridized with a band of 7.3 kb, indicating that the insert of the plasmid pCD1+2 was integrated in an intact form. The 24-kb hybridization band corresponded to the endogenous hybridizing band in thecefD1-cefD2-disrupted clone (TD189). To study which of the two ORFs were responsible for the epimerization step, the IPN epimerase activity was measured in three representative transformants TCD1, TCD2, and TCD1+2. Results showed (TableI) that only in A. chrysogenumTCD1+2 transformants (where cefD1 andcefD2 are present) was the epimerase activity restored. In transformants TCD1 and TCD2, where just one of the genes was functional, no epimerase activity was detected. These results indicate that both cefD1 and cefD2 proteins are indeed involved in the epimerization of isopenicillin N into penicillin N.Table IIsopenicillin N epimerase activity in transformants TCD1+2, TCD1, and TCD2 derived from TD189 by complementation with cefD1+2, cefD1 and cefD2 genes, respectivelyStrainGenotypeEpimerase activityunits/mg of proteinA. chrysogenum C10Wild type92A. chrysogenum TD189cefD1−,cefD2::hph0A. chrysogenum TCD1+2-115Wild type105A. chrysogenumTCD1-8cefD2::hph0A. chrysogenumTCD2-49cefD1−0The strains were grown in MDFA medium and mycelia were collected at 72 h. Three different clones from each strain were assayed with identical results. Open table in a new tab The strains were grown in MDFA medium and mycelia were collected at 72 h. Three different clones from each strain were assayed with identical results. Cephalosporin C fermentations with three of the TCD1, TCD2, and TCD1+2 transformants were performed. Results showed (Fig.9 A) that in transformants TCD1+2, the cephalosporin production was restored to levels similar to those of A. chrysogenum C10. In TCD1transformants (Fig. 9 B), a very small amount of cephalosporins production was detected (∼1% of cephalosporin produced in A. chrysogenum C10), whereas in TCD2transformants (Fig. 9 B), no cephalosporin was produced at all. HPLC analysis (Fig. 9 C) confirmed that TCD1+2 transformants produced authentic cephalosporin C as in A. chrysogenum C10. d-Amino acids are very frequent components of nonribosomal peptides (45Kleinkauf H. von Döhren H. Eur. J. Biochem. 1996; 236: 335-351Crossref PubMed Scopus (283) Google Scholar, 46Martı́n J.F. Gutiérrez S. Aparicio J.F. Lederberg J. Encyclopedia of Microbiology. Academic Press, Inc., San Diego, CA2000: 213-237Google Scholar) and their derivatives (e.g.β-lactams). Very little is known about the mechanism of amino acid epimerization that give rise to the d-configuration. In many cases, epimerization is performed by an epimerization domain integrated into the large modular peptide synthetases (8Martı́n J.F. J. Antibiot. (Tokyo). 2000; 53: 1008-1021Crossref PubMed Scopus (52) Google Scholar, 47Stachelhaus T. Marahiel M.A. FEMS Microbiol. Lett. 1995; 125: 3-14Crossref PubMed Google Scholar), whereas in other cases, the d-amino acids are formed by separate epimerases (e.g. the d-alanine component of cyclosporin and HC toxin) (48Cheng Y.-Q. Walton J.D. J. Biol. Chem. 2000; 275: 4906-4911Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar). In this work, we report that the epimerization step converting isopenicillin N into penicillin N in A. chrysogenum is catalyzed by a two-protein system never described before in the biosynthesis of antibiotics or other secondary metabolites. These proteins are encoded by two genes expressed in opposite orientation from a bidirectional promoter region: cefD1, which shows high similarity to long chain acyl-CoA synthetases (39Turgay K. Krause M. Marahiel M.A. Mol. Microbiol. 1992; 6: 529-546Crossref PubMed Scopus (172) Google Scholar), andcefD2, showing high similarity to acyl-CoA racemases (49Schmitz W. Fingerhut R. Conzelmann E. Eur. J. Biochem. 1994; 222: 313-323Crossref PubMed Scopus (113) Google Scholar, 50Schmitz W. Albers C. Fingerhut R. Conzelmann E. Eur. J. Biochem. 1995; 231: 815-822Crossref PubMed Scopus (121) Google Scholar). A mechanism of action of the A. chrysogenum two-component IPN epimerase system can be proposed on the basis of homology of the CefD1 and CefD2 proteins with known eucaryotic epimerases. Such epimerization systems that require previous activation of the substrate as CoA-derivatives have been reported to be involved in the racemization of phytanic acid and in the inversion of ibuprofen in humans. Phytanic acid occurs naturally as a mixture of the (3R)- and the (3S)-diastereoisomers and is converted after α-oxidation into pristanic acid (51Ackman R.G. Hansen R.P. Lipids. 1967; 2: 357-362Crossref PubMed Scopus (59) Google Scholar, 52Fingerhut R. Schmitz W. Conzelmann E. J. Inherited Metab. Dis. 1993; 16: 591-594Crossref PubMed Scopus (12) Google Scholar). The oxidases and dehydrogenases responsible for further β-oxidation of phytanic acid act only on (2S)-2-methylacyl-CoAs (53van Veldhoven P.P. Croes K. Asselberghs S. Herdewijn P. Mannaerts G.P. FEBS Lett. 1996; 388: 80-84Crossref PubMed Scopus (64) Google Scholar, 54Schmitz W. Conzelmann E. Eur. J. Biochem. 1997; 244: 434-440Crossref PubMed Scopus (33) Google Scholar), and a racemization step is required for complete degradation. In summary, α-methyl-branched fatty acids are racemized as CoA thioesters by a specific α-methylacyl-CoA racemase similar to the protein encoded bycefD2 (49Schmitz W. Fingerhut R. Conzelmann E. Eur. J. Biochem. 1994; 222: 313-323Crossref PubMed Scopus (113) Google Scholar, 50Schmitz W. Albers C. Fingerhut R. Conzelmann E. Eur. J. Biochem. 1995; 231: 815-822Crossref PubMed Scopus (121) Google Scholar). Another example is the epimerization of the 2-arylpropionic acids (e.g. ibuprofen), an important group of nonsteroidal anti-inflammatory drugs. A unique feature regarding 2-arylpropionic acid metabolism is the stereoselective conversion of theR-enantiomer to its S-diastereomer but not vice versa (55Caldwell J. Hutt A.J. Fournel-Gigleux S. Biochem. Pharmcacol. 1988; 37: 105-114Crossref PubMed Scopus (380) Google Scholar). The pathway for this metabolic event begins with the activation of the 2-arylpropionic acids as an acyl-CoA by an acyl-CoA synthetase (that resembles the protein encoded by cefD1) that is later racemized by a 2-arylpropionyl-CoA epimerase, and finally theS-diastereoisomer is released by a thioesterase (56Knihinicki R.D. Day R.O. Williams K.M. Biochem. Pharmacol. 1991; 42: 1905-1911Crossref PubMed Scopus (65) Google Scholar, 57Shieh W.R. Chen C.S. J. Biol. Chem. 1993; 268: 3487-3493Abstract Full Text PDF PubMed Google Scholar). The 2-arylpropionyl-CoA epimerase has been purified from rat liver (57Shieh W.R. Chen C.S. J. Biol. Chem. 1993; 268: 3487-3493Abstract Full Text PDF PubMed Google Scholar), showing that it is similar to α-methylacyl-CoA racemases (54Schmitz W. Conzelmann E. Eur. J. Biochem. 1997; 244: 434-440Crossref PubMed Scopus (33) Google Scholar). As shown in this work, the protein encoded by the cefD2 has high similarity to α-methylacyl-racemases and 2-arylpropionyl-CoA epimerases, suggesting that after activation of isopenicillin N to isopenicillinyl-CoA by an isopenicillin-adenylate-mediated mechanism, epimerization to penicillinyl-CoA occurs by a similar mechanism (Fig.10). Our results show that the product of both genes cefD1 andcefD2 are necessary for full epimerase activity and for cephalosporin biosynthesis, which supports the proposed activation and epimerization model. Finally, the required hydrolysis of the CoA thioesters has been reported to occur in a nonstereoselective manner by different thioesterases (56Knihinicki R.D. Day R.O. Williams K.M. Biochem. Pharmacol. 1991; 42: 1905-1911Crossref PubMed Scopus (65) Google Scholar). The Streptomyces clavuligerus and Amycolatopsis lactamdurans isopenicillin N epimerases appear to work by an entirely different mechanism, since they are single proteins with a molecular weight of 59,000 (for the A. lactamdurans) or 63,000 (for the S. clavuligerus enzyme) that catalyze a pyridoxal phosphate-dependent removal of the amino group at C-2 of the α-aminoadipyl chain, followed by reintroduction in the d-configuration (19Jensen S.E. Westlake D.W.S. Wolfe S. Can. J. Microbiol. 1983; 29: 1526-1531Crossref PubMed Scopus (33) Google Scholar, 21Láiz L. Liras P. Castro J.M. Martı́n J.F. J. Gen. Microbiol. 1990; 136: 663-671Crossref Scopus (27) Google Scholar). We thank R. Bovenberg (Dutch State Mines, Delft, The Netherlands) and C. Schofield (Oxford University) for providing pure isopenicillin N and penicillin N." @default.
• W2149022561 created "2016-06-24" @default.
• W2149022561 creator A5010430488 @default.
• W2149022561 creator A5018899140 @default.
• W2149022561 creator A5019891152 @default.
• W2149022561 creator A5071784570 @default.
• W2149022561 creator A5075278919 @default.
• W2149022561 creator A5077467718 @default.
• W2149022561 date "2002-11-01" @default.
• W2149022561 modified "2023-10-10" @default.
• W2149022561 title "A Novel Epimerization System in Fungal Secondary Metabolism Involved in the Conversion of Isopenicillin N into Penicillin N inAcremonium chrysogenum" @default.
• W2149022561 cites W1496079625 @default.
• W2149022561 cites W1530099175 @default.
• W2149022561 cites W1542459601 @default.
• W2149022561 cites W1548021268 @default.
• W2149022561 cites W1553363451 @default.
• W2149022561 cites W1598390929 @default.
• W2149022561 cites W1784930141 @default.
• W2149022561 cites W188830416 @default.
• W2149022561 cites W1967251807 @default.
• W2149022561 cites W1969680543 @default.
• W2149022561 cites W1977715530 @default.
• W2149022561 cites W1977819162 @default.
• W2149022561 cites W1980377105 @default.
• W2149022561 cites W1983237714 @default.
• W2149022561 cites W1995188759 @default.
• W2149022561 cites W1998884175 @default.
• W2149022561 cites W2001475348 @default.
• W2149022561 cites W2002962831 @default.
• W2149022561 cites W2007113313 @default.
• W2149022561 cites W2012251449 @default.
• W2149022561 cites W2016729644 @default.
• W2149022561 cites W2019367914 @default.
• W2149022561 cites W2023672806 @default.
• W2149022561 cites W2026645368 @default.
• W2149022561 cites W2027312376 @default.
• W2149022561 cites W2032462421 @default.
• W2149022561 cites W2038706268 @default.
• W2149022561 cites W2043894510 @default.
• W2149022561 cites W2048582833 @default.
• W2149022561 cites W2060768796 @default.
• W2149022561 cites W2067452030 @default.
• W2149022561 cites W2079013632 @default.
• W2149022561 cites W2082587144 @default.
• W2149022561 cites W2117637698 @default.
• W2149022561 cites W2123571978 @default.
• W2149022561 cites W2129779495 @default.
• W2149022561 cites W2131037722 @default.
• W2149022561 cites W2136655145 @default.
• W2149022561 cites W2138270253 @default.
• W2149022561 cites W2157622366 @default.
• W2149022561 cites W2163244465 @default.
• W2149022561 cites W2198597385 @default.
• W2149022561 cites W2202000718 @default.
• W2149022561 cites W2238044898 @default.
• W2149022561 cites W42369723 @default.
• W2149022561 cites W4242920587 @default.
• W2149022561 cites W4243267307 @default.
• W2149022561 doi "https://doi.org/10.1074/jbc.m207482200" @default.
• W2149022561 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12228250" @default.
• W2149022561 hasPublicationYear "2002" @default.
• W2149022561 type Work @default.
• W2149022561 sameAs 2149022561 @default.
• W2149022561 citedByCount "72" @default.
• W2149022561 countsByYear W21490225612012 @default.
• W2149022561 countsByYear W21490225612013 @default.
• W2149022561 countsByYear W21490225612014 @default.
• W2149022561 countsByYear W21490225612015 @default.
• W2149022561 countsByYear W21490225612016 @default.
• W2149022561 countsByYear W21490225612017 @default.
• W2149022561 countsByYear W21490225612018 @default.
• W2149022561 countsByYear W21490225612019 @default.
• W2149022561 countsByYear W21490225612020 @default.
• W2149022561 countsByYear W21490225612021 @default.
• W2149022561 countsByYear W21490225612022 @default.
• W2149022561 countsByYear W21490225612023 @default.
• W2149022561 crossrefType "journal-article" @default.
• W2149022561 hasAuthorship W2149022561A5010430488 @default.
• W2149022561 hasAuthorship W2149022561A5018899140 @default.
• W2149022561 hasAuthorship W2149022561A5019891152 @default.
• W2149022561 hasAuthorship W2149022561A5071784570 @default.
• W2149022561 hasAuthorship W2149022561A5075278919 @default.
• W2149022561 hasAuthorship W2149022561A5077467718 @default.
• W2149022561 hasBestOaLocation W21490225611 @default.
• W2149022561 hasConcept C174802600 @default.
• W2149022561 hasConcept C178790620 @default.
• W2149022561 hasConcept C181199279 @default.
• W2149022561 hasConcept C185592680 @default.
• W2149022561 hasConcept C203130289 @default.
• W2149022561 hasConcept C2777157883 @default.
• W2149022561 hasConcept C2777270571 @default.
• W2149022561 hasConcept C501593827 @default.
• W2149022561 hasConcept C553450214 @default.
• W2149022561 hasConcept C55493867 @default.
• W2149022561 hasConcept C62231903 @default.
• W2149022561 hasConcept C71240020 @default.
• W2149022561 hasConceptScore W2149022561C174802600 @default.
• W2149022561 hasConceptScore W2149022561C178790620 @default.

• next