FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2149107220> ?p ?o ?g. }

• W2149107220 endingPage "1666" @default.
• W2149107220 startingPage "1658" @default.
• W2149107220 abstract "Due to the success of DNA microarrays and the growing numbers of available protein expression clones, protein microarrays have become more and more popular for the high throughput screening of protein interactions. However, the widespread applicability of protein microarrays is currently hampered by the large effort associated with their production. Apart from the requirement for a protein expression library, expression and purification of the proteins themselves and the lacking stability of many proteins remain the bottleneck. Here we present an approach that allows the generation of high density protein microarrays from unbound DNA template molecules on the chip. It is based on the multiple spotting technique and comprises the deposition of a DNA template in a first spotting step and the transfer of a cell-free transcription and translation mixture on top of the same spot in a second spotting step. Using wild-type green fluorescent protein as a model protein, we demonstrated the time and template dependence of this coupled transcription and translation and showed that enough protein was produced to yield signals that were comparable to 300 μg/ml spotted protein. Plasmids as well as unpurified PCR products can be used as templates, and as little as 35 fg of PCR product (∼22,500 molecules) were sufficient for the detectable expression of full-length wild-type green fluorescent protein in subnanoliter volumes. We showed that both aminopropyltrimethoxysilane and nickel chelate surfaces can be used for capture of the newly synthesized proteins. Surprisingly we observed that nickel chelate-coated slides were binding the newly synthesized proteins in an unspecific manner. Finally we adapted the system to the high throughput expression of libraries by designing a single primer pair for the introduction of the required T7 promoter and demonstrated the in situ expression using 384 randomly chosen clones. Due to the success of DNA microarrays and the growing numbers of available protein expression clones, protein microarrays have become more and more popular for the high throughput screening of protein interactions. However, the widespread applicability of protein microarrays is currently hampered by the large effort associated with their production. Apart from the requirement for a protein expression library, expression and purification of the proteins themselves and the lacking stability of many proteins remain the bottleneck. Here we present an approach that allows the generation of high density protein microarrays from unbound DNA template molecules on the chip. It is based on the multiple spotting technique and comprises the deposition of a DNA template in a first spotting step and the transfer of a cell-free transcription and translation mixture on top of the same spot in a second spotting step. Using wild-type green fluorescent protein as a model protein, we demonstrated the time and template dependence of this coupled transcription and translation and showed that enough protein was produced to yield signals that were comparable to 300 μg/ml spotted protein. Plasmids as well as unpurified PCR products can be used as templates, and as little as 35 fg of PCR product (∼22,500 molecules) were sufficient for the detectable expression of full-length wild-type green fluorescent protein in subnanoliter volumes. We showed that both aminopropyltrimethoxysilane and nickel chelate surfaces can be used for capture of the newly synthesized proteins. Surprisingly we observed that nickel chelate-coated slides were binding the newly synthesized proteins in an unspecific manner. Finally we adapted the system to the high throughput expression of libraries by designing a single primer pair for the introduction of the required T7 promoter and demonstrated the in situ expression using 384 randomly chosen clones. The understanding of complex cellular networks necessitates tools that are amenable to the analysis of different parameters in a highly parallel manner (1Hoheisel J.D. Microarray technology: beyond transcript profiling and genotype analysis.Nat. Rev. Genet. 2006; 7: 200-210Crossref PubMed Scopus (425) Google Scholar). Although in the last years DNA microarrays were the technology of choice to monitor the abundance of several thousands of mRNA transcripts at a time, such studies provide us with little information on the proteins that are encoded by these transcripts (2Griffin T.J. Gygi S.P. Ideker T. Rist B. Eng J. Hood L. Aebersold R. Complementary profiling of gene expression at the transcriptome and proteome levels in Saccharomyces cerevisiae.Mol. Cell. Proteomics. 2002; 1: 323-333Abstract Full Text Full Text PDF PubMed Scopus (565) Google Scholar, 3Hack C.J. Integrated transcriptome and proteome data: the challenges ahead.Brief. Funct. Genomics Proteomics. 2004; 3: 212-219Crossref PubMed Scopus (124) Google Scholar). However, because proteins rather than DNA carry out cellular functions, there is large interest to analyze proteins and their entirety, the proteome, in a manner comparable to DNA microarrays. One technology that is envisaged to meet the demands of high throughput protein interaction and modification screening is protein microarray technology (4Bertone P. Snyder M. Advances in functional protein microarray technology.FEBS. J. 2005; 272: 5400-5411Crossref PubMed Scopus (144) Google Scholar, 5Merkel J.S. Michaud G.A. Salcius M. Schweitzer B. Predki P.F. Functional protein microarrays: just how functional are they?.Curr. Opin. Biotechnol. 2005; 16: 447-452Crossref PubMed Scopus (56) Google Scholar, 6Stoll D. Templin M.F. Bachmann J. Joos T.O. Protein microarrays: applications and future challenges.Curr. Opin. Drug Discov. Dev. 2005; 8: 239-252PubMed Google Scholar, 7Lueking A. Cahill D.J. Mullner S. Protein biochips: a new and versatile platform technology for molecular medicine.Drug Discov. Today. 2005; 10: 789-794Crossref PubMed Scopus (82) Google Scholar, 8Angenendt P. Progress in protein and antibody microarray technology.Drug Discov. Today. 2005; 10: 503-511Crossref PubMed Scopus (274) Google Scholar). Protein microarrays have been applied in different areas of application, such as the analysis of protein-protein interactions (9Boutell J.M. Hart D.J. Godber B.L. Kozlowski R.Z. Blackburn J.M. Functional protein microarrays for parallel characterisation of p53 mutants.Proteomics. 2004; 4: 1950-1958Crossref PubMed Scopus (73) Google Scholar, 10Zhu H. Bilgin M. Bangham R. Hall D. Casamayor A. Bertone P. Lan N. Jansen R. Bidlingmaier S. Houfek T. Mitchell T. Miller P. Dean R.A. Gerstein M. Snyder M. Global analysis of protein activities using proteome chips.Science. 2001; 293: 2101-2105Crossref PubMed Scopus (1942) Google Scholar, 11Schweitzer B. Predki P. Snyder M. Microarrays to characterize protein interactions on a whole-proteome scale.Proteomics. 2003; 3: 2190-2199Crossref PubMed Scopus (138) Google Scholar), the identification of substrates for protein kinases (12Feilner T. Hultschig C. Lee J. Meyer S. Immink R.G. Koenig A. Possling A. Seitz H. Beveridge A. Scheel D. Cahill D.J. Lehrach H. Kreutzberger J. Kersten B. High throughput identification of potential Arabidopsis mitogen-activated protein kinases substrates.Mol. Cell. Proteomics. 2005; 4: 1558-1568Abstract Full Text Full Text PDF PubMed Scopus (210) Google Scholar, 13Zhu H. Klemic J.F. Chang S. Bertone P. Casamayor A. Klemic K.G. Smith D. Gerstein M. Reed M.A. Snyder M. Analysis of yeast protein kinases using protein chips.Nat. Genet. 2000; 26: 283-289Crossref PubMed Scopus (730) Google Scholar, 14Ptacek J. Devgan G. Michaud G. Zhu H. Zhu X. Fasolo J. Guo H. Jona G. Breitkreutz A. Sopko R. McCartney R.R. Schmidt M.C. Rachidi N. Lee S.J. Mah A.S. Meng L. Stark M.J. Stern D.F. De Virgilio C. Tyers M. Andrews B. Gerstein M. Schweitzer B. Predki P.F. Snyder M. Global analysis of protein phosphorylation in yeast.Nature. 2005; 438: 679-684Crossref PubMed Scopus (822) Google Scholar), or the elucidation of potential diagnostic markers in bacterial or autoimmune diseases (15Horn S. Lueking A. Murphy D. Staudt A. Gutjahr C. Schulte K. Konig A. Landsberger M. Lehrach H. Felix S.B. Cahill D.J. Profiling humoral autoimmune repertoire of dilated cardiomyopathy (DCM) patients and development of a disease-associated protein chip.Proteomics. 2006; 6: 605-613Crossref PubMed Scopus (73) Google Scholar, 16Steller S. Angenendt P. Cahill D.J. Heuberger S. Lehrach H. Kreutzberger J. Bacterial protein microarrays for identification of new potential diagnostic markers for Neisseria meningitidis infections.Proteomics. 2005; 5: 2048-2055Crossref PubMed Scopus (53) Google Scholar, 17Feng Y. Ke X. Ma R. Chen Y. Hu G. Liu F. Parallel detection of autoantibodies with microarrays in rheumatoid diseases.Clin. Chem. 2004; 50: 416-422Crossref PubMed Scopus (66) Google Scholar, 18Robinson W.H. DiGennaro C. Hueber W. Haab B.B. Kamachi M. Dean E.J. Fournel S. Fong D. Genovese M.C. de Vegvar H.E. Skriner K. Hirschberg D.L. Morris R.I. Muller S. Pruijn G.J. van Venrooij W.J. Smolen J.S. Brown P.O. Steinman L. Utz P.J. Autoantigen microarrays for multiplex characterization of autoantibody responses.Nat. Med. 2002; 8: 295-301Crossref PubMed Scopus (643) Google Scholar). All of them share the basic principle of production. It involves the generation of expression clones and the subsequent expression and purification of proteins off the chip followed by spotting them onto the microarray surface. Currently this process represents a major bottleneck in the production of protein microarrays because both the generation of the expression clones and the purification of the proteins are time- and cost-intensive even in low throughput applications (19Glokler J. Angenendt P. Protein and antibody microarray technology.J. Chromatogr. B Anal. Technol. Biomed. Life Sci. 2003; 797: 229-240Crossref PubMed Scopus (139) Google Scholar, 20Labaer J. Ramachandran N. Protein microarrays as tools for functional proteomics.Curr. Opin. Chem. Biol. 2005; 9: 14-19Crossref PubMed Scopus (240) Google Scholar). To circumvent this bottleneck, different approaches have been developed for the generation of protein microarrays. Madoz-Gurpide et al. prepared cell lysate from adenocarcinoma cell lines and fractionated the protein extract first by anion exchange and then by reverse phase liquid chromatography (21Madoz-Gurpide J. Wang H. Misek D.E. Brichory F. Hanash S.M. Protein based microarrays: a tool for probing the proteome of cancer cells and tissues.Proteomics. 2001; 1: 1279-1287Crossref PubMed Scopus (134) Google Scholar). The obtained fractions were then spotted and probed with antibodies against different proteins. Although this approach is truly advantageous with regard to proper post-translational modifications of the proteins, only mixtures of protein are displayed in which less abundant proteins may not be detectable. He and Taussig (22He M. Taussig M.J. Single step generation of protein arrays from DNA by cell-free expression and in situ immobilisation (PISA method).Nucleic Acids Res. 2001; 29: 73Crossref PubMed Scopus (192) Google Scholar, 23He M. Taussig M.J. DiscernArray technology: a cell-free method for the generation of protein arrays from PCR DNA.J. Immunol. Methods. 2003; 274: 265-270Crossref PubMed Scopus (44) Google Scholar) introduced the idea of creating protein arrays by cell-free transcription and translation of PCR products and the subsequent purification on nickel chelate-coated surfaces. However, their approach, termed “protein in situ array” (PISA), is limited by the large volume of 25 μl used for the expression and by the capture process that is not performed on microarrays but on nickel chelate-coated microtiter plates or magnetic agarose beads. A miniaturization of cell-free transcription and translation as an intermediate step toward the expression on the chip was reported by Angenendt et al. (24Angenendt P. Nyarsik L. Szaflarski W. Glökler J. Nierhaus K.H. Lehrach H. Cahill D.J. Lueking A. Cell-free protein expression and functional assay in nanowell chip format.Anal. Chem. 2004; 76: 1844-1849Crossref PubMed Scopus (90) Google Scholar), who performed an expression and subsequent functional assay in 100-nl volumes. Steffen et al. (25Steffen J. von Nickisch-Rosenegk M. Bier F.F. In vitro transcription of a whole gene on a surface-coupled template.Lab Chip. 2005; 5: 665-668Crossref PubMed Scopus (9) Google Scholar) finally performed transcription on a chip using a gene encoding enhanced green fluorescent protein. After overlaying the chip with a transcription mixture, they were able to detect the resulting mRNA in the mixture by RT-PCR. Currently the only methodology for the production of protein microarray by expression of the proteins on the chip is the nucleic acid programmable protein array (NAPPA) 1The abbreviations used are: NAPPA, nucleic acid programmable protein array; APTES, aminopropyltrimethoxysilane; MIST, multiple spotting technique; wt-GFP, wild-type green fluorescent protein. approach (26Ramachandran N. Hainsworth E. Bhullar B. Eisenstein S. Rosen B. Lau A.Y. Walter J.C. LaBaer J. Self-assembling protein microarrays.Science. 2004; 305: 86-90Crossref PubMed Scopus (509) Google Scholar). It entails the immobilization of plasmids containing the cDNAs of interests as GST fusions on the surface in combination with an anti-GST capture antibody. The chip is then overlaid with a cell-free expression mixture, which causes expression of the protein and direct capture of the protein by the antibody via the GST domain. The NAPPA process is very cost-effective due to the small consumption of reagents and allows the production of proteins just prior to the microarray experiment, diminishing problems associated with the storage of protein microarrays. Nevertheless it is limited by several intrinsic drawbacks. For expression, NAPPA requires plasmids that contain the gene of interest as a GST fusion. This necessitates time-consuming cloning of cDNAs. Moreover it relies on the immobilization of the plasmid, which requires a biotinylation of the plasmid at defined stoichiometries to prevent dissociation from the array or a termination of transcription by biotin incorporation within the coding sequence. In addition, only low density protein microarrays with up to 512 spots per microscope slide can be produced because a higher density would cause proteins to diffuse to capture antibodies of adjacent spots. To overcome these problems, an optimized technology should meet several criteria. (a) Expression should be directly possible from a wide variety of different templates, including PCR products. (b) Expression should be facile and inexpensive. (c) The generation of protein microarrays should be feasible within a short time period, just prior to their use, to avoid storage effects. (d) Mode of binding should permit the production of high density protein microarrays capable of displaying several thousand proteins on a single microscopic slide. Here we present an approach that meets these demands. It is based on the multiple spotting technique (MIST) (27Angenendt P. Glökler J. Konthur Z. Lehrach H. Cahill D.J. 3D protein microarrays: performing multiplex immunoassays on a single chip.Anal. Chem. 2003; 75: 4368-4372Crossref PubMed Scopus (101) Google Scholar) and comprises the spotting of a DNA template in a first spotting and the transfer of a cell-free transcription and translation mixture on top of the very same spot in a second spotting run. Using this technique, high density protein microarrays with up to 13,000 spots per slide can be produced from a variety of different sources in an uncomplicated and inexpensive manner. The Rapid Translation System (RTS) 100 Escherichia coli HY kit was obtained from Roche Diagnostics GmbH. The plasmid used for expression is an integral part of the kit and is based on the pIVEX2.3 plasmid containing a gene encoding wild-type green fluorescent protein (wt-GFP) fused to a C-terminal His6 tag (pIVEX-GFP). PCR primers were synthesized by biomers.net GmbH, (Ulm, Germany). PCR Buffer E was purchased from Genaxxon Bioscience (Biberach, Germany), Taq polymerase was from Qiagen GmbH (Hilden, Germany), and dNTPs were from Fermentas GmbH (St. Leon-Roth, Germany). Dilutions of the pIVEX-GFP plasmid in water were prepared ranging from 1 μg/μl to 1 ng/μl. The dilutions as well as a negative control containing only water were spotted on homemade aminopropyltrimethoxysilane (APTES) slides (prepared as described Ref. 28Kusnezow W. Jacob A. Walijew A. Diehl F. Hoheisel J.D. Antibody microarrays: an evaluation of production parameters.Proteomics. 2003; 3: 254-264Crossref PubMed Scopus (272) Google Scholar) using a NanoPlotter 2.0 non-contact spotting system equipped with a with a nanoliter pipette (Gesim mbH, Grosserkmannsdorf, Germany). The volume that was dispensed per spot was 350 pl. After spotting of the DNA template, the in vitro transcription and translation mixture (RTS 100 mixture) was prepared without any template DNA as recommended by the manufacturer and spotted onto the very same position as the template DNA. In addition, the cell-free transcription and translation mixture was spotted on negative control spots to which only water had been dispensed. After spotting, the slides were placed in humidified extradeep hybridization chambers (TeleChem International Inc., Sunnyvale, CA) and incubated at 32 °C in a water bath for different incubation times. After incubation, the slides were blocked in 3% (w/v) fat-free milk powder/Tris-buffered saline containing 0.1% (v/v) Tween 20 (TBS-T) for 15 min on a shaker at room temperature. The slides were rinsed with TBS-T and incubated for 30 min in 0.5 μg/ml anti-GFP antibody (TP401, Acris Antibodies, Hiddenhausen, Germany) diluted in blocking buffer. After rinsing the slides with TBS-T, the slides were washed twice for 5 min in TBS-T and dried by pressurized air. Scanning was performed with a ScanArray 5000 (PerkinElmer Life Sciences). Analysis was done using GenePix Pro 5.0. All signal intensities used for analysis were signal intensities from which the local background had been subtracted. PCR templates containing the coding sequence of wt-GFP were generated by PCR of the pIVEX-GFP plasmid. PCR was performed in 50-μl volumes in 96-well polypropylene PCR plates (Steinbrenner Laborsysteme GmbH, Wiesenbach, Germany) with the following primers: forward primer, 5′-GTGGCGAGCCCGATCTTC-3′; reverse primer, 5′-GTCAGGCACCGTGTATGAAATC-3′. The composition of the reaction was 1× Buffer E (67 mm Tris-HCl, pH 8.8, 16 mm (NH4)2SO4, 2.5 mm MgCl2, 0.01% (v/v) Tween 20), 0.2 mm each dNTP, 0.2 μm each primer, and 2.5 units of Taq polymerase. Reactions were performed in a PTC-200 Thermocycler (Bio-Rad) at the following temperatures: denaturation at 95 °C for 2 min; 40 cycles of 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 40 s; and a final elongation step at 72 °C for 10 min. PCR products were checked on agarose gels and purified using a Qiaquick PCR purification kit (Qiagen GmbH). DNA was quantified by absorption using a Nanodrop ND-1000 (Peqlab Biotechnologie GmbH, Erlangen, Germany). Dilutions of the PCR were prepared from 20 ng/μl to 100 pg/μl using negative control PCR mixture (templates were substituted by water) supplemented with 0.5 m betaine (final concentration) for dilution. wt-GFP calibration curves ranging from 1 mg/ml to 2 μg/ml were prepared by diluting conventionally obtained wt-GFP with PBS and 0.5 m betaine (final concentration). Expression and detection were done as described in the previous paragraph with the following modifications. Nickel chelate-coated slides (Xenopore, Hawthorne, NJ) were used as solid support. As a negative control, the diluent used for the dilution series was used. Expression was performed at 32 °C for 4 h, the slides were blocked in 3% (w/v) BSA in TBS-T, and detection was achieved by incubation of the slides in 0.1 μg/ml anti-penta-His antibody-Alexa Fluor 647 conjugate (Qiagen GmbH) diluted in blocking buffer for 1 h. Washing was performed for 10 min in TBS-T, and the slides were rinsed with PBS before scanning. A construct lacking the C-terminal His6 tag was cloned using standard cloning methodology. The resulting plasmid was named pIVEX-GFP-notag, and the sequence was verified by sequencing. PCR of the pIVEX-GFP and pIVEX-GFP-notag plasmids was performed using the same primers and cycling conditions as described before. The PCR products were purified using a Qiaquick PCR purification kit (Qiagen GmbH) and quantified. PCR products were diluted down to 10 ng/μl in 10 mm Tris (pH 8.5) containing 0.5 m (final concentration) betaine and 0.5 ng/μl (final concentration) sonicated salmon sperm DNA (GE Healthcare). Detection was achieved as described in the previous paragraph using a mixture of 0.1 μg/ml anti-penta-His antibody-Alexa Fluor 647 conjugate and 0.5 μg/ml anti-GFP antibody-Texas Red conjugate (Ab6660, Abcam Plc, Cambridge, UK) in blocking buffer. 384 cDNAs were randomly chosen out of a human fetal brain library (hex-1) (29Büssow K. Nordhoff E. Lubbert C. Lehrach H. Walter G. A human cDNA library for high-throughput protein expression screening.Genomics. 2000; 65: 1-8Crossref PubMed Scopus (114) Google Scholar). Cells were inoculated in 2YT medium (16 g/liter tryptone, 10 g/liter yeast extract, 5 g/liter NaCl, pH 7.0) containing 100 μg/ml ampicillin, 15 μg/ml kanamycin, and 2% glucose and grown at 37 °C overnight. Individual wells of 50-μl volumes in 96-well polypropylene PCR plates were inoculated with 1 μl of bacterial culture. PCR was performed with the following primers: forward primer, 5′-GTAGCGGATCGAGTTCTCGATCCCGCGACACTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGAGAGGATCGCATCACCATCACCATCAC-3′; reverse primer, 5′-CGCGATCATGGCGACCACACCCGTCCTGTGGAGATCCAGATATAGTTCCTCCTTTCAGCATCTCCGATGCGGATGTACTAAAAACCCCTCAAGACCCGTTTAGAGGCCCCAAGGGGTTCGACTCACTATAGGGAGCGG-3′. The composition of the reaction was 1× Buffer E (67 mm Tris-HCl, pH 8.8, 16 mm (NH4)2SO4, 2.5 mm MgCl2, 0.01% (v/v) Tween 20), 0.2 mm each dNTP, 0.2 μm each primer, 1 unit of Taq polymerase. Reactions were performed in a PTC-200 Thermocycler (Bio-Rad) at the following temperatures: denaturation at 95 °C for 10 min; 40 cycles of 95 °C for 60 s, 60 °C for 60 s, 72 °C for 120 s; and 72 °C for 10 min. Prior to spotting, 0.5 m (final concentration) betaine and 0.5 ng/μl (final concentration) sonicated salmon sperm DNA were added to the PCR products. Expression and detection were performed as described under “Determination of the Absolute Yield of Expression” above. Protein expression in microtiter plates was performed with 48 clones in a reaction volume of 8 μl/reaction in 96-well polypropylene PCR plates. The transcription and translation mixture was prepared as recommended by the manufacturer, and unpurified PCR products diluted 1:2 in water were used as templates. Incubation of the mixture was performed overnight at 30 °C in a PTC-200 Thermocycler followed by spotting of the mixture on nickel chelate-coated slides. The slides were stored overnight at 4 °C, and detection was performed as described under “Determination of the Absolute Yield of Expression” above. The in situ protein expression on the chip is based on the creation of separate reaction entities on each spot of the microarrays by MIST (Fig. 1). In a first step, DNA templates are spotted on an activated glass slide. On top of the DNA templates, a cell-free transcription and translation mixture is spotted in a second spotting run before the whole slide is incubated in a humid hybridization chamber, which causes the spots to rehydrate and the expression to start. After incubation, the slide is blocked, and the expressed proteins are detected by specific antibodies. Transcription of DNA templates into mRNA and its subsequent translation into protein are a coupled enzymatic reaction mediated by T7 RNA polymerase and a complex cascade of enzymes within the ribosomal complex. As an enzymatic process, the amount of products that is produced is dependent on two factors: the amount of substrate, i.e. DNA template molecules, and time. To demonstrate this principle, a dilution series of plasmid encoding wt-GFP was applied to different APTES-coated microarrays. Then cell-free transcription and translation mixture was spotted on top, and the slides were incubated for different periods of time, starting directly after application of the expression mixture; the longest incubation was overnight (Fig. 2). For analysis, the mean signal intensity of each dilution and time point was calculated, and the mean signal intensity of the negative control spots without template was subtracted (Fig. 3). The diagram shows an increase of signal intensity with increasing concentration of template molecules for the varies time points. In addition, an increase of signals with longer incubation times of up to 2 h was observed, whereas there was a slight loss of signal intensity after prolonged incubation times, such as overnight. The coefficient of variation was computed for all signals >1000 and was determined to be in the range of 16–20%. To quantify the absolute amounts of wt-GFP that are produced and to demonstrate that unpurified PCR products can also be used as DNA templates, the gene coding for wt-GFP was amplified by PCR, and a dilution series was prepared. In a first spotting run, the PCR products were spotted on nickel chelate-coated slides. Then the cell-free expression mixture was added. For absolute quantification, a dilution series of purified wt-GFP was spotted on the very same set of slides for calibration (Fig. 4). Detection was performed using an anti-penta-His antibody, which recognizes the C-terminal His6 tag of both the on- and off-chip produced wt-GFP. Because of the terminal position of the His tag, only the quantification of full-length wt-GFP was possible. To be able to compare the signals from the expression of wt-GFP and the calibration series, it was assumed that the binding characteristics of both the newly synthesized wt-GFP and the purified wt-GFP were identical. A graph of spotted PCR template concentration versus expressed protein concentration was prepared by calculation of the mean of the signal intensities of the expression and normalizing them via the calibration data (Fig. 5). The graph displays the suitability of unpurified PCR products for expression on a chip with a saturation of the signals above 0.5 ng/μl DNA yielding full-length wt-GFP in the range of 300 μg/ml.Fig. 5Diagram of spotted PCR template concentration versus expressed protein concentration. The background-corrected signals obtained in Fig. 4 were quantified and normalized using the calibration series of wt-GFP.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Surface activation of solid support plays a crucial role in the expression on the chip because it must provide an environment that prevents complete blocking by DNA templates and cell-free transcription and translation mixture on the one hand and on the other hand permits the newly synthesized protein to immobilize. APTES as well as nickel chelate coating were evaluated, and both performed well (Figs. 2 and 4) with nickel chelate displaying moderately brighter signals (data not shown). To elucidate whether this effect was due to the expected affinity capture of the His6 tag or due to unspecific binding, a wt-GFP construct lacking the C-terminal His6 tag was generated. Both genes were amplified by PCR and spotted on nickel chelate-coated slides. Detection was performed simultaneously by an anti-penta-His-Alexa 647 antibody conjugate and an anti-GFP-Texas Red conjugate (Fig. 6). Direct comparison of both constructs displayed comparable signal intensities for the anti-GFP antibody, whereas only the construct with the His6 tag generated signals with the anti-penta-His antibody. 384 clones from a human fetal brain expression library were randomly chosen to elucidate whether the principle of the on-chip expression of proteins could be extended to the high throughput expression of proteins from an expression library. The clones were originally cloned in the pQE-30NST expression vector that carries a phage T5 promoter and two lac operators for isopropyl β-d-thiogalactoside-inducible recombinant protein expression. In addition, the cDNAs were flanked by a T7 and an SP6 promoter for transcription in sense and antisense directions. To make the cDNAs available for cell-free expression, they were amplified directly from the colony by PCR using a single primer pair harboring a T7 promoter along with the ribosomal binding site and part of the T7 terminator sequence. This led to a replacement of the original T5 promoter sequence as well as the antisense T7 promoter and provided the cDNAs in a format ready for spotting without any purification of the PCR products. The DNA fragments were spotted in quadruplicates, and detection was performed via their N-terminal His6 tag and an anti-penta-His antibody (Fig. 7). Expression of 24 clones showing high yields and 24 clones without expression was also carried out in microtiter plates to verify whether the unsuccessful expression of clones was due to the microarray setup. After expression, the mixture was spotted on nickel chelate slides, and an anti-penta-His antibody was applied for detection. All of the 24 clones showing high expression on a chip were also expressed in the microtiter format (Fig. 8), and none of the 24 clones without expression on the chip displayed a detectable expression in the microtiter plate. The generation of high density protein microarrays is a cost- and time-intensive process. Reasons for thi" @default.
• W2149107220 created "2016-06-24" @default.
• W2149107220 creator A5010495394 @default.
• W2149107220 creator A5017302776 @default.
• W2149107220 creator A5017815858 @default.
• W2149107220 creator A5082534459 @default.
• W2149107220 date "2006-09-01" @default.
• W2149107220 modified "2023-09-26" @default.
• W2149107220 title "Generation of High Density Protein Microarrays by Cell-free in Situ Expression of Unpurified PCR Products" @default.
• W2149107220 cites W1542780143 @default.
• W2149107220 cites W1968882335 @default.
• W2149107220 cites W1970659557 @default.
• W2149107220 cites W1979162495 @default.
• W2149107220 cites W1988589833 @default.
• W2149107220 cites W1990720034 @default.
• W2149107220 cites W1994434787 @default.
• W2149107220 cites W1999065162 @default.
• W2149107220 cites W1999577806 @default.
• W2149107220 cites W2001552323 @default.
• W2149107220 cites W2016831609 @default.
• W2149107220 cites W2016852270 @default.
• W2149107220 cites W2023931329 @default.
• W2149107220 cites W2025575050 @default.
• W2149107220 cites W2033692581 @default.
• W2149107220 cites W2035221444 @default.
• W2149107220 cites W2035812229 @default.
• W2149107220 cites W2037849218 @default.
• W2149107220 cites W2044079161 @default.
• W2149107220 cites W2057448348 @default.
• W2149107220 cites W2058681524 @default.
• W2149107220 cites W2070543174 @default.
• W2149107220 cites W2077442957 @default.
• W2149107220 cites W2080259922 @default.
• W2149107220 cites W2082796552 @default.
• W2149107220 cites W2090110765 @default.
• W2149107220 cites W2106647330 @default.
• W2149107220 cites W2112758080 @default.
• W2149107220 cites W2129815183 @default.
• W2149107220 cites W2133700365 @default.
• W2149107220 cites W2140597534 @default.
• W2149107220 cites W2152146170 @default.
• W2149107220 cites W2157058776 @default.
• W2149107220 cites W2170463678 @default.
• W2149107220 cites W4233751197 @default.
• W2149107220 cites W1979191377 @default.
• W2149107220 doi "https://doi.org/10.1074/mcp.t600024-mcp200" @default.
• W2149107220 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16825183" @default.
• W2149107220 hasPublicationYear "2006" @default.
• W2149107220 type Work @default.
• W2149107220 sameAs 2149107220 @default.
• W2149107220 citedByCount "98" @default.
• W2149107220 countsByYear W21491072202012 @default.
• W2149107220 countsByYear W21491072202013 @default.
• W2149107220 countsByYear W21491072202014 @default.
• W2149107220 countsByYear W21491072202015 @default.
• W2149107220 countsByYear W21491072202016 @default.
• W2149107220 countsByYear W21491072202017 @default.
• W2149107220 countsByYear W21491072202018 @default.
• W2149107220 countsByYear W21491072202019 @default.
• W2149107220 countsByYear W21491072202020 @default.
• W2149107220 countsByYear W21491072202021 @default.
• W2149107220 countsByYear W21491072202022 @default.
• W2149107220 crossrefType "journal-article" @default.
• W2149107220 hasAuthorship W2149107220A5010495394 @default.
• W2149107220 hasAuthorship W2149107220A5017302776 @default.
• W2149107220 hasAuthorship W2149107220A5017815858 @default.
• W2149107220 hasAuthorship W2149107220A5082534459 @default.
• W2149107220 hasBestOaLocation W21491072201 @default.
• W2149107220 hasConcept C104317684 @default.
• W2149107220 hasConcept C1491633281 @default.
• W2149107220 hasConcept C150194340 @default.
• W2149107220 hasConcept C153911025 @default.
• W2149107220 hasConcept C178790620 @default.
• W2149107220 hasConcept C185592680 @default.
• W2149107220 hasConcept C2777822432 @default.
• W2149107220 hasConcept C55493867 @default.
• W2149107220 hasConcept C6856738 @default.
• W2149107220 hasConcept C86803240 @default.
• W2149107220 hasConcept C95371953 @default.
• W2149107220 hasConceptScore W2149107220C104317684 @default.
• W2149107220 hasConceptScore W2149107220C1491633281 @default.
• W2149107220 hasConceptScore W2149107220C150194340 @default.
• W2149107220 hasConceptScore W2149107220C153911025 @default.
• W2149107220 hasConceptScore W2149107220C178790620 @default.
• W2149107220 hasConceptScore W2149107220C185592680 @default.
• W2149107220 hasConceptScore W2149107220C2777822432 @default.
• W2149107220 hasConceptScore W2149107220C55493867 @default.
• W2149107220 hasConceptScore W2149107220C6856738 @default.
• W2149107220 hasConceptScore W2149107220C86803240 @default.
• W2149107220 hasConceptScore W2149107220C95371953 @default.
• W2149107220 hasIssue "9" @default.
• W2149107220 hasLocation W21491072201 @default.
• W2149107220 hasLocation W21491072202 @default.
• W2149107220 hasOpenAccess W2149107220 @default.
• W2149107220 hasPrimaryLocation W21491072201 @default.
• W2149107220 hasRelatedWork W2115220490 @default.
• W2149107220 hasRelatedWork W2349371290 @default.
• W2149107220 hasRelatedWork W2398348280 @default.

• next