FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2149603102> ?p ?o ?g. }

• W2149603102 endingPage "15221" @default.
• W2149603102 startingPage "15213" @default.
• W2149603102 abstract "The forkhead thyroid-specific transcription factor TTF-2 is the main mediator of thyrotropin and insulin regulation of thyroperoxidase (TPO) gene expression. This function depends on multimerization and specific orientation of its DNA-binding site, suggesting that TTF-2 is part of a complex interaction network within the TPO promoter. This was confirmed by transfection experiments and by protein-DNA interaction studies, which demonstrated that CTF/NF1 proteins bind 10 base pairs upstream of the TTF-2-binding site to enhance its action in hormone-induced expression of the TPO gene. GST pull-down assays showed that TTF-2 physically interacts with CTF/NF1 proteins. In addition, we demonstrate that increasing the distance between both transcription factors binding sites by base pair insertion results in loss of promoter activity and in a drastic decrease on the ability of the promoter to respond to the hormones. CTF/NF1 is a family of transcription factors that contributes to constitutive and cell-type specific gene expression. Originally identified as factors implicated in the replication of adenovirus, this group of proteins (CTF/NF1-A, -B, -C, and -X) is now known to be involved in the regulation of several genes. In contrast to other reports regarding the involvement of these proteins in inducible gene expression, we show here that members of this family of transcription factors are regulated by hormones. With the use of specific CTF/NF1 DNA probes and antibodies we demonstrate that CTF/NF1-C is a thyrotropin-, cAMP-, and insulin-inducible protein. Thus CTF/NF1 proteins do not only mediate hormone-induced gene expression cooperating with TTF-2, but are themselves hormonally regulated. All these findings are clearly of important value in understanding the mechanisms governing the transcription regulation of RNA polymerase II promoters, which often contain binding sites for multiple transcription factors. The forkhead thyroid-specific transcription factor TTF-2 is the main mediator of thyrotropin and insulin regulation of thyroperoxidase (TPO) gene expression. This function depends on multimerization and specific orientation of its DNA-binding site, suggesting that TTF-2 is part of a complex interaction network within the TPO promoter. This was confirmed by transfection experiments and by protein-DNA interaction studies, which demonstrated that CTF/NF1 proteins bind 10 base pairs upstream of the TTF-2-binding site to enhance its action in hormone-induced expression of the TPO gene. GST pull-down assays showed that TTF-2 physically interacts with CTF/NF1 proteins. In addition, we demonstrate that increasing the distance between both transcription factors binding sites by base pair insertion results in loss of promoter activity and in a drastic decrease on the ability of the promoter to respond to the hormones. CTF/NF1 is a family of transcription factors that contributes to constitutive and cell-type specific gene expression. Originally identified as factors implicated in the replication of adenovirus, this group of proteins (CTF/NF1-A, -B, -C, and -X) is now known to be involved in the regulation of several genes. In contrast to other reports regarding the involvement of these proteins in inducible gene expression, we show here that members of this family of transcription factors are regulated by hormones. With the use of specific CTF/NF1 DNA probes and antibodies we demonstrate that CTF/NF1-C is a thyrotropin-, cAMP-, and insulin-inducible protein. Thus CTF/NF1 proteins do not only mediate hormone-induced gene expression cooperating with TTF-2, but are themselves hormonally regulated. All these findings are clearly of important value in understanding the mechanisms governing the transcription regulation of RNA polymerase II promoters, which often contain binding sites for multiple transcription factors. The mechanisms by which cells selectively activate the transcription of a specific gene are essential. Tissue-specific transcription factors that bind DNA sequences within the promoter are the main mediators of tissue-specific gene expression (1Mitchell P.J. Tjian R. Science. 1989; 245: 371-378Crossref PubMed Scopus (2206) Google Scholar). It has become clear, however, that transcriptional activation of a given gene is defined not only by the activity of an individual factor or a single DNA-binding site, but rather, depends on combinatorial interactions between multiple proteins (2Tjian R. Maniatis T. Cell. 1994; 77: 5-8Abstract Full Text PDF PubMed Scopus (955) Google Scholar, 3Pugh B.F. Curr. Opin. Cell Biol. 1996; 8: 303-311Crossref PubMed Scopus (84) Google Scholar). To understand the mechanism of tissue-specific transcriptional activation, it is first necessary to identify cis-regulatory elements and to characterize tissue-specific transcription factors, and then to define protein-protein interaction that determine their function. The focus of our work has been to understand the regulatory mechanisms underlying hormonal transcription of the thyroperoxidase (TPO) 1The abbreviations used are: TPO, thyroperoxidase; TSH, thyrotropin; GST, glutathioneS-transferase; CAT, chloramphenicol acetyltransferase; bp, base pair(s); RSV, Rous sarcoma virus; kb, kilobase(s); EMSA, electrophoretic mobility shift assay; MMTV, mouse mammary tumor virus; PAGE, polyacrylamide gel electrophoresis; TTF-2, thyroid-specific transcription factor 2; UFB, ubiquitious factor B. gene, a tissue-specific enzyme expressed only in differentiated thyroid cells. Its function involves the iodination and coupling of tyrosine residues into the thyroglobulin molecule to generate thyroid hormones (4De Groot L.J. Niepomniszce H. Metabolism. 1977; 26: 665-718Abstract Full Text PDF PubMed Scopus (149) Google Scholar, 5Salvatore G. Stambury J.B. Rall J.E. De Visscher M. The Thyroid Gland. Raven Press, New York1980: 443-487Google Scholar, 6Taurog A. Braverman L.E. Utiger R.D. The Thyroid: A Fundamental and Clinical Text. Lippincott-Raven, New York1996: 47-81Google Scholar). Both thyroglobulin and TPO are cell type-specific genes whose respective promoters have been characterized (7Civitareale D. Lonigro R. Sinclair A. Di Lauro R. EMBO J. 1989; 8: 2537-2542Crossref PubMed Scopus (325) Google Scholar, 8Francis-Lang H. Price M. Polycarpou-Schwarz M. Di Lauro R. Mol. Cell. Biol. 1992; 12: 576-588Crossref PubMed Scopus (209) Google Scholar). With the use of DNA binding assay, three thyroid-specific transcription factors have been identified: TTF-1, TTF-2, and Pax-8 (9Damante G. Di Lauro R. Biochim. Biophys. Acta. 1994; 1218: 255-266Crossref PubMed Scopus (193) Google Scholar). Cloning of these three proteins demonstrated that they are members of different transcription factor families. TTF-1 and Pax-8 are homeo- and paired-containing proteins, respectively (10Guazzi S. Price M. De Felice M. Damante G. Mattei M.-G. Di Lauro R. EMBO J. 1990; 9: 3631-3639Crossref PubMed Scopus (470) Google Scholar, 11Plachov D. Chowdhurand K. Walther C. Simon D. Guenet J.L. Gruss P. Development. 1990; 110: 643-651Crossref PubMed Google Scholar), and TTF-2 is a forkhead protein (12Zannini M. Avantaggiato V. Biffali E. Arnone M.I. Sato K. Pischetola M. Taylor B.A. Phillips S.J. Simeone A. Di Lauro R. EMBO J. 1997; 16: 3185-3197Crossref PubMed Scopus (218) Google Scholar). The three factors are expressed at the beginning of thyroid development (11Plachov D. Chowdhurand K. Walther C. Simon D. Guenet J.L. Gruss P. Development. 1990; 110: 643-651Crossref PubMed Google Scholar, 12Zannini M. Avantaggiato V. Biffali E. Arnone M.I. Sato K. Pischetola M. Taylor B.A. Phillips S.J. Simeone A. Di Lauro R. EMBO J. 1997; 16: 3185-3197Crossref PubMed Scopus (218) Google Scholar, 13Lazzaro D. Price M. De Felice M. Di Lauro R. Development. 1991; 113: 1093-1104Crossref PubMed Google Scholar) and are considered decisive in the maintenance of thyroid phenotype. All of them bind within the thyroglobulin and TPO promoter at similar positions (7Civitareale D. Lonigro R. Sinclair A. Di Lauro R. EMBO J. 1989; 8: 2537-2542Crossref PubMed Scopus (325) Google Scholar, 8Francis-Lang H. Price M. Polycarpou-Schwarz M. Di Lauro R. Mol. Cell. Biol. 1992; 12: 576-588Crossref PubMed Scopus (209) Google Scholar, 14Zannini M. Francis-Lang H. Plachov D. Di Lauro R. Mol. Cell. Biol. 1992; 12: 4230-4241Crossref PubMed Scopus (274) Google Scholar) although the TPO promoter differs in several aspects from that of thyroglobulin. It is thus approximately an order of magnitude less active than the thyroglobulin promoter; the Pax-8 protein overlapping the TTF-1-binding site has a different position (14Zannini M. Francis-Lang H. Plachov D. Di Lauro R. Mol. Cell. Biol. 1992; 12: 4230-4241Crossref PubMed Scopus (274) Google Scholar) and the ubiquitous transcription factors that bind to both promoters occupy different sites in each one (7Civitareale D. Lonigro R. Sinclair A. Di Lauro R. EMBO J. 1989; 8: 2537-2542Crossref PubMed Scopus (325) Google Scholar, 8Francis-Lang H. Price M. Polycarpou-Schwarz M. Di Lauro R. Mol. Cell. Biol. 1992; 12: 576-588Crossref PubMed Scopus (209) Google Scholar). Several ligands regulate the expression of the TPO gene through alteration of the activity of the transcription factors that control its expression. For example, we have recently demonstrated that the transcription factor TTF-2 is under the hormonal control of the thyrotropin (TSH) and the cAMP as well as to the insulin and insulin-like growth factor I signaling pathways (15Ortiz L. Zannini M. Di Lauro R. Santisteban P. J. Biol. Chem. 1997; 272: 23334-23339Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). TTF-2 binds to a single site that acts as a hormone response element. This function depends on multimerization and specific orientation of the TTF-2-binding site (16Aza-Blanc P. Di Lauro R. Santisteban P. Mol. Endocrinol. 1993; 7: 1297-1306PubMed Google Scholar). This suggests that TTF-2 is part of a complex interaction network within the TPO promoter, whose final result is to turn-on the specific expression of the TPO gene in response to external hormonal stimuli. As the binding site for TTF-2 functions in an orientation-specific manner, we asked whether TTF-2 alone regulates the expression of this gene or requires the action of neighboring sequences. Neighboring regulatory elements of TTF-2 bind the thyroid-specific transcription factor TTF-1 and the ubiquitous transcription factor UFB (8Francis-Lang H. Price M. Polycarpou-Schwarz M. Di Lauro R. Mol. Cell. Biol. 1992; 12: 576-588Crossref PubMed Scopus (209) Google Scholar). Here we show by transient transfection assays and site-directed mutagenesis that the binding sites for TTF-2 and UFB are important for hormone-induced expression at the TPO promoter. Furthermore, we show that UFB is a binding site for members of the CTF/NF1 family of transcription factors. These are a multiprotein family in which four different genes have been cloned, NF1-A, NF1-B, NF1-C, and NF1-X (17Santoro C. Mermod N. Andrews P.C. Tjian R. Nature. 1988; 334: 218-224Crossref PubMed Scopus (492) Google Scholar, 18Gil G. Smith J.R. Goldstein J.L. Slaughter C.A. Orth K. Brown M.S. Osborne T.F. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 8963-8967Crossref PubMed Scopus (137) Google Scholar, 19Rupp R. Kruse U. Multhaup G. Gobel U. Beandreuther K. Sippel A. Nucleic Acids Res. 1990; 18: 2607-2616Crossref PubMed Scopus (149) Google Scholar), as well as different isoforms generated by alternative splicing (17Santoro C. Mermod N. Andrews P.C. Tjian R. Nature. 1988; 334: 218-224Crossref PubMed Scopus (492) Google Scholar, 20Kruse U. Sippel A.E. FEBS Lett. 1994; 348: 46-50Crossref PubMed Scopus (106) Google Scholar, 21Nebl G. Cato A.C.B. Cell. Mol. Biol. Res. 1995; 41: 85-95PubMed Google Scholar, 22Liu Y. Bernard H.U. Apt D. J. Biol. Chem. 1997; 272: 10739-10745Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar). Although their expression is fully ubiquitous, differences can be detected in the distribution and abundance of their different transcripts (23Paonessa G. Gounari F. Frank R. Cortese R. EMBO J. 1988; 7: 3115-3123Crossref PubMed Scopus (173) Google Scholar, 24Chaudhry A.Z. Lyons G.E. Gronostajski R.M. Dev. Dyn. 1997; 208: 313-325Crossref PubMed Scopus (178) Google Scholar). Strikingly, we have found that, as occurs for TTF-2 (15Ortiz L. Zannini M. Di Lauro R. Santisteban P. J. Biol. Chem. 1997; 272: 23334-23339Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar), CTF/NF1 gene expression is up-regulated by TSH and insulin in inducing the expression of the TPO gene. Furthermore, we present evidence, from a GST pull-down assay, that these constitutive factors interact physically with TTF-2. This interaction appears to be functional, since the TPO promoter activity and its hormonal response are lost in transfection experiments in which the distance between the CTF/NF1 and TTF-2-binding site has been altered. Thus the hormonal control of TPO gene transcription, which takes place exclusively in thyroid-differentiated cells, depends on the correct stereospecific interaction of two hormonally expressed transcription factors: TTF-2 and CTF/NF1. Tissue culture medium, bovine TSH, and bovine insulin were purchased from Sigma, and forskolin from Roche Molecular Biochemicals (Mannheim, Germany). Donor, fetal calf serum, and Dulbecco's modified Eagle's medium were from Life Technologies, Inc. (Gaithersburg, MD); Nytran membranes were obtained from Schleicher & Schüll (Richmond, CA). TnT and luciferase assay kits were purchased from Promega (Madison, WI). [α-32P]dCTP, [γ-32P]ATP, and [35S]methionine were from ICN (Irvine, CA). FRTL-5 cells (ATTC CRL 8305; American Type Culture Collection, Manassas, VA) were cultured as described previously (25Ambesi-Impiombato F.S. Parks L.A.M. Coon H.G. Proc. Natl. Acad. Sci. U. S. A. 1980; 77: 3455-3459Crossref PubMed Scopus (974) Google Scholar) in Coon's modified Ham's F-12 medium supplemented with 5% donor calf serum and a six-hormone mixture including 1 nm TSH and 10 μg/ml insulin (complete medium). The effect of TSH and insulin were studied by starving confluent or transfected cells for both hormones in the presence of 0.2% serum (basal medium) (26Santisteban P. Kohn L.D. Di Lauro R. J. Biol. Chem. 1987; 262: 4048-4052Abstract Full Text PDF PubMed Google Scholar). After 4 days, each ligand was added to the culture medium at the concentrations given. HeLa cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum. For transient expression assays, transfections were performed by the calcium phosphate coprecipitation method, as described for each cell line (16Aza-Blanc P. Di Lauro R. Santisteban P. Mol. Endocrinol. 1993; 7: 1297-1306PubMed Google Scholar, 27Graham F.L. Van der Eb A.J. Virology. 1973; 52: 456-467Crossref PubMed Scopus (6493) Google Scholar). The plasmid RSV-CAT (28Gorman C.M. Merlino G.T. Willingham M.C. Pastan I. Howard B.M. Proc. Natl. Acad. Sci. U. S. A. 1982; 79: 6777-6781Crossref PubMed Scopus (880) Google Scholar) was used to correct for transfection efficiency. Luciferase and CAT activities of cell extracts were determined as described (29Gorman C.M. Moffat L.F. Howard B.H. Mol. Cell. Biol. 1982; 2: 1044-1051Crossref PubMed Scopus (5294) Google Scholar, 30De Wet J.R. Wood K.V. Deluca M. Helsinki D.R. Subramani S. Mol. Cell. Biol. 1987; 7: 725-737Crossref PubMed Scopus (2480) Google Scholar). p420 TPO LUC containing the minimum TPO promoter linked to the luciferase cistron (8Francis-Lang H. Price M. Polycarpou-Schwarz M. Di Lauro R. Mol. Cell. Biol. 1992; 12: 576-588Crossref PubMed Scopus (209) Google Scholar) and the deletion p60 TPO LUC (16Aza-Blanc P. Di Lauro R. Santisteban P. Mol. Endocrinol. 1993; 7: 1297-1306PubMed Google Scholar) have been previously described. The deletions p120 and p92 TPOLUC, as well as insertions p120(+5) and p120(+10), were generated by the polymerase chain reaction on the p420 TPO LUC template, using as flanking primers the 3′ polymerase chain reaction primer LUC-1: 5′-GGATAGAATGGCGCCGGGCCTTTCTTTATG-3′ and the following oligonucleotides as 5′ polymerase chain reaction primers: TPO-120, 5′-AAGAGCTCATACTAAACAAACAG-3′; TPO-92, 5′-AAGAGCTCGACACACAAGCACTTGGCAG-3′; TPO-120 (+5), 5′-AAGAGCTGACACACAAGCACTTGGCAGAAACGGATCAAATACTAAAC-3′; and TPO-120 (+10), 5′- AAGAGCTGACACACAAGCACTTGGCAGAAACGGATCCGACGAAATACTAAAC-3′. Amplified fragments were digested with SacI andPstI and subcloned into pBS LUC-2 (8Francis-Lang H. Price M. Polycarpou-Schwarz M. Di Lauro R. Mol. Cell. Biol. 1992; 12: 576-588Crossref PubMed Scopus (209) Google Scholar). The mutated constructs, pBmm TPO LUC and pZm TPO LUC were previously described (8Francis-Lang H. Price M. Polycarpou-Schwarz M. Di Lauro R. Mol. Cell. Biol. 1992; 12: 576-588Crossref PubMed Scopus (209) Google Scholar). In the pBmm mutant the TTGG sequence is altered to GGTC and TTF-1 and UFB binding activity is thus undetectable. pZm contains a 4-bp mutation within the Z site, which interferes with TTF-2 binding. Constructs containing tandem repeats of Z site (−93 to −73) in front of the minimal promoter TATA LUC have been described elsewhere (16Aza-Blanc P. Di Lauro R. Santisteban P. Mol. Endocrinol. 1993; 7: 1297-1306PubMed Google Scholar). The pBZ TATA LUC was made by insertion of a double strand synthetic oligonucleotide containing the BZ (−118 to −73) region of the TPO promoter 5′ → 3′, into the SmaI site of the plasmid TATA LUC (16Aza-Blanc P. Di Lauro R. Santisteban P. Mol. Endocrinol. 1993; 7: 1297-1306PubMed Google Scholar). pSG-LexVP-16 has been previously described (31Schneikert J. Peterziel H. Defossez P.-A. Klocker H. de Launoit Y. Cato A.C.B. J. Biol. Chem. 1996; 271: 23907-23913Abstract Full Text Full Text PDF PubMed Scopus (138) Google Scholar). pBAT-hCTF-1 and pBAT-CTF/NF1-X constructs were obtained by digesting the coding sequence of NF1/CTF1 and NF1-X from the RSV-based expression vector (21Nebl G. Cato A.C.B. Cell. Mol. Biol. Res. 1995; 41: 85-95PubMed Google Scholar) with XbaI/XhoI and EcoRI/XbaI followed by a fill-in reaction and ligation into the SmaI site of the plasmid pBAT (32Annweiler A. Hipskind R.A. Wirth T. Nucleic Acids Res. 1991; 19: 3750Crossref PubMed Scopus (53) Google Scholar). The bacterial expression plasmid pGEX-4T3 was utilized to direct overexpression of the full-length GST-TTF-2 fusion protein. The full-length TTF-2 cDNA was digested with BamHI andEcoRI and subcloned into the pGEX-4T3 vector. The mammalian expression vector RSV-CTF/NF1-C has been previously described (21Nebl G. Cato A.C.B. Cell. Mol. Biol. Res. 1995; 41: 85-95PubMed Google Scholar). The expression vectors CMV-CTF/NF1-B and CMV-CTF/NF1-X (33Gao B. Jiang L. Kunos G. Mol. Cell. Biol. 1996; 16: 5997-6008Crossref PubMed Google Scholar) were kindly provided by Dr. B. Gao (MCV-VCU, Richmond, VA). Total RNA was extracted by the guanidinium isothiocyanate procedure (34Chomczynsky P. Sacchi N. Anal. Biochem. 1987; 162: 156-159Crossref PubMed Scopus (63183) Google Scholar). Polyadenylated RNA preparation was performed with oligo(dT)-cellulose chromatography as described by Neblet al. (35Nebl G. Mermod N. Cato A.C.B. J. Biol. Chem. 1994; 269: 7371-7378Abstract Full Text PDF PubMed Google Scholar). Thirty micrograms of total RNA or 5 μg of poly(A)+ were denatured and fractionated on a 1% agarose gel containing 3.7% formaldehyde. RNA was then blotted and fixed onto Nytran membranes. The radioactive probes used included a 0.35-kbHindIII/EcoRI fragment from the 3′-untranslated region of rat TTF-2 (p3′UTRT) (12Zannini M. Avantaggiato V. Biffali E. Arnone M.I. Sato K. Pischetola M. Taylor B.A. Phillips S.J. Simeone A. Di Lauro R. EMBO J. 1997; 16: 3185-3197Crossref PubMed Scopus (218) Google Scholar), a 0.6-kb EcoRI fragment from rat TTF-1 (10Guazzi S. Price M. De Felice M. Damante G. Mattei M.-G. Di Lauro R. EMBO J. 1990; 9: 3631-3639Crossref PubMed Scopus (470) Google Scholar), a 1.1-kb EcoRI fragment from the 5′-end of human CTF-1 (17Santoro C. Mermod N. Andrews P.C. Tjian R. Nature. 1988; 334: 218-224Crossref PubMed Scopus (492) Google Scholar), a 0.5-kb PstI/EcoRI fragment from the 5′-end of the hamster NF-1 X (18Gil G. Smith J.R. Goldstein J.L. Slaughter C.A. Orth K. Brown M.S. Osborne T.F. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 8963-8967Crossref PubMed Scopus (137) Google Scholar), a 1.5-kb EcoRI from the 5′-end of hamster NF-1/Red (18Gil G. Smith J.R. Goldstein J.L. Slaughter C.A. Orth K. Brown M.S. Osborne T.F. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 8963-8967Crossref PubMed Scopus (137) Google Scholar), and a 1.0-kb PstI fragment of p91 α-actin (36Minty A.J. Caravatti M. Robert B. Cohen A. Daubas P. Weydert A. Gros F. Buckingham M.E. J. Biol. Chem. 1981; 256: 1008-1014Abstract Full Text PDF PubMed Google Scholar). Hybridizations were carried out at 65 °C in 4 × SSC (1 × SSC is 0.15 m NaCl, 0.125 m sodium citrate), 10 mm EDTA, and 0.05% SDS. After hybridization, the filters were washed at 65 °C for 30 min each in 3.3% phosphate buffer, pH 7.2, 0.1% SDS and successively lower salt concentrations (2, 1, and 0.5 × SSC) before autoradiography. For electrophoretic mobility shift assays (EMSA), the nuclear protein fraction was extracted by the procedure described by Andrews and Faller (37Andrews N.C. Faller D.V. Nucleic Acids Res. 1991; 19: 2499Crossref PubMed Scopus (2211) Google Scholar). Protein concentration was measured according to Bradford (38Bradford M.M. Anal. Biochem. 1976; 72: 248-260Crossref PubMed Scopus (216334) Google Scholar) with the Bio-Rad protein assay kit using bovine serum albumin as standard. The recombinant purified NF-1 protein, used in both EMSA and DNase footprinting, was kindly provided by Dr. M. Beato (Institut fur Molecularbiologie und Tumorforshung, Marburg, Germany). The footprinting probe, corresponding to the −257 to +30 region of the TPO promoter was prepared by polymerase chain reaction using TPOF1 (−257 to −236): 5′-ATAAGAGAAACTCCCAGGAACC-3′, and TPOF6 (+9 to +30): 5′-ACTTCAGAAATGTGAATCTCAA-3′ labeled oligonucleotides as flanking primers on the p420 template. DNase I footprinting reactions were carried out in a 50-μl reaction volume as follows: recombinant NF-1 (5 or 25 ng) was preincubated with 5 × 104 cpm for 45 min on ice in 20 mm HEPES, pH 7.9, 50 mm KCl, 0.1 mm EDTA, 0.5 mm dithiothreitol, 10% glycerol, and 0.4 mg/ml bovine serum albumin. DNase I digestion was performed by the addition of 6 ng of DNase I in 10 mmMgCl2, 2 mm CaCl2 and incubation for 1 min at room temperature. Footprinting reactions were terminated by addition of 200 μl of a stop mixture (20 mm Tris-HCl, pH 8.0, 1 m NaCl, 20 mm EDTA, 0.5% SDS, and 250 μg/ml proteinase K). The samples were incubated for 1 h at 45 °C, extracted with phenol-chloroform, ethanol precipitated, and resuspended in formamide dye. Equal number of counts per sample were loaded and resolved on an 8% sequencing gel, together with G and G + A chemical sequencing reactions. Gels were fixed, dried, and visualized by autoradiography. EMSA were carried out as described previously (39Santisteban P. Acebr—n A. Polycarpou-Schwarz M. Di Lauro R. Mol. Endocrinol. 1992; 6: 1310-1317Crossref PubMed Scopus (75) Google Scholar) using 32P-labeled double-stranded oligonucleotide UFB (5′-CAAGCACTTGGCAGAAACAAATAC-3′) or consensus NF-1 (5′-CATATTGGCTTCAATCCAAA-3′) derived from the MMTV promoter (40Jones K.A. Kadonaga J.T. Rosenfeld P.J. Kelland T.J. Tjian R. Cell. 1987; 48: 79-89Abstract Full Text PDF PubMed Scopus (572) Google Scholar). For supershift experiments, 1 μl of anti-NF-1/8199/2902 (kindly provided by Dr. N. Tanese, New York University, New York) or preimmune serums were added to the preincubation mixture. An overnight culture of the bacterial strand BL21 cells harboring plasmid pGEX-4T3 or pGEX-TTF-2 was diluted 1:10 in a 2 × YT medium plus ampicillin, pH 7.0, and cultured at 27 °C to optical density at 600 nm of 0.6–0.75. Protein expression was then induced by adding 0.1 mm isopropyl-β-d-thiogalactopyranoside and cultures were incubated for an additional 2 h at the same temperature. Cells were harvested and the fusion proteins purified as described (41Gupta M.P. Amin C.S. Gupta M. Hay N. Zak R. Mol. Cell. Biol. 1997; 17: 3924-3936Crossref PubMed Google Scholar). The integrity of the GST fusion proteins bound to the beads was analyzed by resolution by 8% SDS-polyacrylamide gel electrophoresis (PAGE) and Coomassie Blue staining. Known amounts of bovine serum albumin were included on the same gel for determination of the yield. For in vitro translation in reticulocyte lysate, we used a coupled transcription/translation system (TnT, Promega) in the presence of [35S]methionine (1000 mCi/mmol). The protocol for the GST pull-down assay was essentially as described (42Zeiner M. Gehring U. Proc. Natl Acad. Sci. U. S. A. 1995; 92: 11465-11469Crossref PubMed Scopus (164) Google Scholar). GST or GST-TTF-2 proteins (5 μg) immobilized on glutahione-Sepharose 4B beads were washed extensively with LBST-100 buffer (25 mm Hepes-KOH, pH 7.9, 100 mm NaCl, 6% glycerol, 5 mm MgCl, 1 mm dithiothreitol, 0.05% Triton X-100, 1 mm phenylmethylsulfonyl fluoride, 5 mm EDTA) and the volume was raised to 180 μl with LBST-100 buffer. Radioactively labeled protein (20 μl) was then added and gently mixed at room temperature for 30 min, followed by a further 30-min incubation with gentle shaking at 4 °C. The beads were washed four times with successively increasing NaCl concentrations (LBST-100, LBST-300, and LBST-500), and the bound proteins were analyzed in 8% SDS-PAGE followed by autoradiography. Previous results from our laboratory have demonstrated that TPO promoter activity is hormonally regulated by TSH through the cAMP pathway, as well as by insulin and insulin-like growth factor I. This regulation is mediated mainly by the cis-regulatory element (Z) to which the forkhead thyroid transcription factor-2 (TTF-2) binds (see Fig. 1A,for cartoon). Further analysis showed that the TTF-2-binding site acts as a hormone response element in a heterologous construct and that it requires a specific orientation for activation of the TPO promoter (16Aza-Blanc P. Di Lauro R. Santisteban P. Mol. Endocrinol. 1993; 7: 1297-1306PubMed Google Scholar). This suggests that TTF-2 may require other bound factors for activation of TPO expression gene. To identify the regulatory elements on the TPO promoter that cooperate with the TTF-2-binding site, we transfected into FRTL-5 thyroid cells different promoter constructs of this gene (Fig. 1, upper panels) linked to the coding region of the firefly luciferase gene (30De Wet J.R. Wood K.V. Deluca M. Helsinki D.R. Subramani S. Mol. Cell. Biol. 1987; 7: 725-737Crossref PubMed Scopus (2480) Google Scholar). The transfected cells were cultured for 72 h in a minimal medium depleted of TSH and insulin but supplemented with 0.2% serum to ensure only a basal expression of the TPO (16Aza-Blanc P. Di Lauro R. Santisteban P. Mol. Endocrinol. 1993; 7: 1297-1306PubMed Google Scholar, 43Isozaki O. Kohn L.D. Kozak C.A. Kimura S. Mol. Endocrinol. 1989; 3: 1681-1692Crossref PubMed Scopus (74) Google Scholar). TPO promoter activity was enhanced by treatment of the cells with TSH or insulin for 24 h. The promoter activity was determined by luciferase activity measurements while CAT activity derived from a co-transfected RSV-CAT construct was used to correct for variability in transfection efficiency. In this transfection assay, only the p420 TPO LUC and p120 TPO LUC constructs showed hormone inducibility (Fig. 1A, lower panel). Neither p92 TPO-LUC nor p60 TPO-LUC, in which successive deletions were performed of the B and Z site, respectively, responded to TSH and insulin treatment. As both inducers enhanced the promoter activity of construct p120 but not p92 TPO LUC, the B element missing in the p92 construct must be important for the hormone response. The B element has been previously reported to bind the transcription factors TTF-1 and UBF. Mutations introduced into both binding sites (pBmm) that abolished binding by their respective factors (8Francis-Lang H. Price M. Polycarpou-Schwarz M. Di Lauro R. Mol. Cell. Biol. 1992; 12: 576-588Crossref PubMed Scopus (209) Google Scholar) drastically reduced hormone regulation of expression at the TPO promoter (Fig. 1B). Mutations in the Z regulatory element destroying the binding of TTF-2 (pZm) also abrogated hormone inducibility (Fig. 1B) indicating a concerted action of the B and Z regulatory sites for hormone inducibility. The fact that the multimerization of the Z element confers hormone inducibility to the minimal promoter TATA LUC and a single Z element was unable (Fig. 1C) implies that the hormone regulatory activity of the Z element comes from cooperative action with itself or possibly with other transcription factor. To find out whether the B regulatory element can confer hormone inducibility to a single Z element, we cloned the B and Z regulatory units in front of the minimal promoter. This construct in the transfection experiments produced an identical result as p4xZ in its response to hormone treatment. We therefore concluded that the hormonal response of the TPO promoter activity is dependent on an active cooperation between TTF-2 and the factors binding to the B site. It is important to mention that in the above study the TSH effect was mimicked by forskolin (data not shown). Analyses of the BZ region (−120 to −73) of the TPO promoter by in vitrofootprinting with nuclear extracts from FRTL-5 thyroid and non-thyroid Rat-1 cells had identified three different transcription factors that bind to this sequence (8Francis-Lang H. Price M. Polycarpou-Schwarz M. Di Lauro R. Mol. Cell. Biol. 1992; 12: 576-588Crossref PubMed Scopus (209) Google Scholar). Two of these are thyroid-specific and were identified as TTF-1 and TTF-2, ho" @default.
• W2149603102 created "2016-06-24" @default.
• W2149603102 creator A5012245201 @default.
• W2149603102 creator A5041756483 @default.
• W2149603102 creator A5044585101 @default.
• W2149603102 creator A5047421912 @default.
• W2149603102 creator A5091509175 @default.
• W2149603102 date "1999-05-01" @default.
• W2149603102 modified "2023-09-27" @default.
• W2149603102 title "The Interaction between the Forkhead Thyroid Transcription Factor TTF-2 and the Constitutive Factor CTF/NF-1 Is Required for Efficient Hormonal Regulation of the Thyroperoxidase Gene Transcription" @default.
• W2149603102 cites W106000010 @default.
• W2149603102 cites W1480830299 @default.
• W2149603102 cites W1487399858 @default.
• W2149603102 cites W1496124518 @default.
• W2149603102 cites W1524354116 @default.
• W2149603102 cites W1528256607 @default.
• W2149603102 cites W1560227765 @default.
• W2149603102 cites W1581884496 @default.
• W2149603102 cites W1691146464 @default.
• W2149603102 cites W1844026860 @default.
• W2149603102 cites W1899130495 @default.
• W2149603102 cites W1942467333 @default.
• W2149603102 cites W1965372133 @default.
• W2149603102 cites W1966002568 @default.
• W2149603102 cites W1968013290 @default.
• W2149603102 cites W1970234384 @default.
• W2149603102 cites W1972612844 @default.
• W2149603102 cites W1973912514 @default.
• W2149603102 cites W1976375093 @default.
• W2149603102 cites W1982695907 @default.
• W2149603102 cites W1983512144 @default.
• W2149603102 cites W1996075074 @default.
• W2149603102 cites W2002788937 @default.
• W2149603102 cites W2003893812 @default.
• W2149603102 cites W2004661553 @default.
• W2149603102 cites W2010356985 @default.
• W2149603102 cites W2010966468 @default.
• W2149603102 cites W2013812530 @default.
• W2149603102 cites W2016082446 @default.
• W2149603102 cites W2018458653 @default.
• W2149603102 cites W2022397619 @default.
• W2149603102 cites W2025958196 @default.
• W2149603102 cites W2039284752 @default.
• W2149603102 cites W2059080130 @default.
• W2149603102 cites W205934865 @default.
• W2149603102 cites W2063393711 @default.
• W2149603102 cites W2068394666 @default.
• W2149603102 cites W2068577315 @default.
• W2149603102 cites W2070690231 @default.
• W2149603102 cites W2072393635 @default.
• W2149603102 cites W2076376599 @default.
• W2149603102 cites W2081495213 @default.
• W2149603102 cites W2082528130 @default.
• W2149603102 cites W2085355931 @default.
• W2149603102 cites W2090263938 @default.
• W2149603102 cites W2093267475 @default.
• W2149603102 cites W2094646101 @default.
• W2149603102 cites W2105168909 @default.
• W2149603102 cites W2108659309 @default.
• W2149603102 cites W2118533860 @default.
• W2149603102 cites W2130535740 @default.
• W2149603102 cites W2134112039 @default.
• W2149603102 cites W2302993874 @default.
• W2149603102 cites W4293247451 @default.
• W2149603102 doi "https://doi.org/10.1074/jbc.274.21.15213" @default.
• W2149603102 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10329730" @default.
• W2149603102 hasPublicationYear "1999" @default.
• W2149603102 type Work @default.
• W2149603102 sameAs 2149603102 @default.
• W2149603102 citedByCount "53" @default.
• W2149603102 countsByYear W21496031022012 @default.
• W2149603102 countsByYear W21496031022013 @default.
• W2149603102 countsByYear W21496031022014 @default.
• W2149603102 countsByYear W21496031022015 @default.
• W2149603102 countsByYear W21496031022016 @default.
• W2149603102 countsByYear W21496031022017 @default.
• W2149603102 countsByYear W21496031022018 @default.
• W2149603102 countsByYear W21496031022019 @default.
• W2149603102 countsByYear W21496031022020 @default.
• W2149603102 countsByYear W21496031022021 @default.
• W2149603102 countsByYear W21496031022022 @default.
• W2149603102 countsByYear W21496031022023 @default.
• W2149603102 crossrefType "journal-article" @default.
• W2149603102 hasAuthorship W2149603102A5012245201 @default.
• W2149603102 hasAuthorship W2149603102A5041756483 @default.
• W2149603102 hasAuthorship W2149603102A5044585101 @default.
• W2149603102 hasAuthorship W2149603102A5047421912 @default.
• W2149603102 hasAuthorship W2149603102A5091509175 @default.
• W2149603102 hasBestOaLocation W21496031021 @default.
• W2149603102 hasConcept C104317684 @default.
• W2149603102 hasConcept C126322002 @default.
• W2149603102 hasConcept C134018914 @default.
• W2149603102 hasConcept C138885662 @default.
• W2149603102 hasConcept C179926584 @default.
• W2149603102 hasConcept C2908554999 @default.
• W2149603102 hasConcept C41895202 @default.
• W2149603102 hasConcept C502942594 @default.
• W2149603102 hasConcept C54355233 @default.

• next