FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2149631731> ?p ?o ?g. }

• W2149631731 endingPage "1618" @default.
• W2149631731 startingPage "1614" @default.
• W2149631731 abstract "We show that certain DNA sequences have the ability to influence the positioning of RecA monomers in RecA-DNA complexes. A tendency for RecA monomers to be phased was observed in RecA protein complexes with several oligonucleotides containing a recombinational hotspot sequence, the chi-site from Escherichia coli. This influence was observed in both the 5′ to 3′ and 3′ to 5′ directions with respect to chi. A 5′-end phosphate group and probably some other features in DNA also influence the phasing of RecA monomers. We conclude that natural DNAs contain a number of features that influence the positioning of RecA monomers. The ability of specific DNA sequences to influence the positioning of RecA monomers demonstrates some specificity in the binding of individual bases at different sites within a RecA monomer and, most likely, reflects the stereochemical non-equivalence of these sites. The possible biological implications of the phasing of RecA monomers in presynaptic DNA-protein cofilaments are discussed. We show that certain DNA sequences have the ability to influence the positioning of RecA monomers in RecA-DNA complexes. A tendency for RecA monomers to be phased was observed in RecA protein complexes with several oligonucleotides containing a recombinational hotspot sequence, the chi-site from Escherichia coli. This influence was observed in both the 5′ to 3′ and 3′ to 5′ directions with respect to chi. A 5′-end phosphate group and probably some other features in DNA also influence the phasing of RecA monomers. We conclude that natural DNAs contain a number of features that influence the positioning of RecA monomers. The ability of specific DNA sequences to influence the positioning of RecA monomers demonstrates some specificity in the binding of individual bases at different sites within a RecA monomer and, most likely, reflects the stereochemical non-equivalence of these sites. The possible biological implications of the phasing of RecA monomers in presynaptic DNA-protein cofilaments are discussed. single-stranded dimethyl sulfate adenosine 5′-O-(3-thiotriphosphate) double-stranded RecA protein is the central component of homologous recombination in Escherichia coli. In the last few years a number of RecA protein analogues from different sources have been characterized. That these proteins exhibit rather similar properties suggests that the fundamental features of homologous recombination are common in prokaryotes and eukaryotes (for review, see Refs. 1Camerini-Otero R.D. Hsieh P. Annu. Rev. Genet. 1995; 29: 509-552Google Scholar and 2Bianco I.P.R. Tracy R.B. Kowalczykowski S.C. Front. Biosc. 1998; 3: 570-603Google Scholar). In vitro, the first step of RecA-promoted strand exchange reaction is the formation of a RecA protein complex with single-stranded DNA (presynaptic complex). RecA protein monomers bind cooperatively, completely cover the DNA, and thus form a close-packed DNA-protein co-filament. The most widely accepted binding stoichiometry is that each RecA monomer interacts with 3 nucleotides of single-stranded (ss)1 DNA (3Takahashi M. Kubista M. Norden B. J. Mol. Biol. 1989; 205: 137-147Google Scholar,4Zlotnick A. Mitchell R.S. Brenner S.L. J. Biol. Chem. 1990; 265: 17050-17054Google Scholar). Thus, the repeat unit of the presynaptic complex should correspond to 3 nucleotides interacting with one RecA monomer. Earlier we demonstrated that when RecA protein binding is initiated on a fluorescent dye molecule attached to the 5′-end of an oligonucleotide there is a modulation of the DMS reactivity of a guanine residue along the oligonucleotide with a period of 3 bases (5Volodin A.A. Smirnova H.A. Bocharova T.N. FEBS Lett. 1997; 407: 325-328Google Scholar). This result indicated that there was a strictly ordered (phased) arrangement of RecA monomers on the dye-tagged oligonucleotides. In the present study we have asked the question of whether natural DNA contains some features that can influence the positioning of RecA monomers. Homologous recombination is considered to proceed mainly in a sequence-independent manner. At the same time, however, it has been demonstrated that there are some preferred DNA binding and pairing sequences for RecA and the chi-site sequence is among these (6Tracy R.B. Kowalczykowski S.C. Genes Dev. 1996; 10: 1890-1903Google Scholar). The chi-site is a recombination hot spot in E. coli (7Lam S.T. Stahl M.M. McMilin K.D. Stahl F.W. Genetics. 1974; 77: 425-433Google Scholar) with the sequence -GCTGGTGG (8Smith G.R. Kunes S.M. Schultz D.W. Taylor A. Triman K.L. Cell. 1981; 24: 429-436Google Scholar) that contains two 3-base repeats that conform with the RecA protein-DNA binding stoichiometry and might provide a physical basis for the ordered arrangement of RecA monomers in RecA protein complexes with chi-containing DNA. For these reasons the chi-site sequence has been chosen in the present study as an example of a DNA sequence that may influence the positioning of RecA monomers along a DNA strand. The present study provides evidence that DNA sequences can influence the phasing of RecA monomers in presynaptic RecA-DNA complexes. That is, that natural DNAs can introduce some order in the arrangement of the RecA monomers in complexes with DNA participating in homologous recombination. The possible biological implications of this phenomenon are discussed. RecA protein was purified by the method of Cox et al. (18Cox M.M. McEntee K. Lehman I.R. J. Biol. Chem. 1981; 256: 4676-4678Google Scholar). Oligonucleotides were synthesized by automated β-cyanoethyl phosphoramidite DNA synthesis on a 380B DNA synthesizer (Applied Biosystems). All oligonucleotides were purified by PAGE with a standard protocol (19Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual.2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989: 11.23-11.28Google Scholar). Radioactive label was introduced on the 5′-end of an oligonucleotide with the use of polynucleotide kinase (Promega) or on the 3′-end via the attachment of an additional nucleotide ([α-32P]ATP) with terminal deoxynucleotidyl transferase (Promega) in accordance with the manufacturer's recommendations. The sequences of synthesized oligonucleotides are listed in Table I.Table IChi-site-containing oligonucleotides used for formation of complexes with RecA protein1*TACAAAAAGCTGGTGGACGACGGCCAGTAAA2*TACAAAAGCTGGTGGAACGACGGCCAGTAAAI3*TACAAAGCTGGTGGAAACGACGGCCAGTAAA4*TACAAGCTGGTGGAAAACGACGGCCAGTAAA5*TACAGCTGGTGGAAAAACGACGGCCAGTAAA6*TACGCTGGTGGAAAAAACGACGGCCAGTAAA1*TACACGACGGCCAGTAAAAAGCTGGTGGAAACGACGGCCAGTAAGAAAII2*TACACGACGGCCAGTAAAAGCTGGTGGAAAACGACGGCCAGTAAGAAA3*TACACGACGGCCAGTAAAGCTGGTGGAAAAACGACGGCCAGTAAGAAA4*TACACGACGGCCAGTAAGCTGGTGGAAAAAACGACGGCCAGTAAGAAA1TACACGACGGCCAGTAAAAAGCTGGTGGAAACGACGGCCAGTAAGAAAA*III2TACACGACGGCCAGTAAAAGCTGGTGGAAAACGACGGCCAGTAAGAAAA*3TACACGACGGCCAGTAAAGCTGGTGGAAAAACGACGGCCAGTAAGAAAA*4TACACGACGGCCAGTAAGCTGGTGGAAAAAACGACGGCCAGTAAGAAAA*1*TACAACGACGGCCAGTAAAAAGCTGGTGGAAACGACGGCCAGTAAGAAAIV2*TACACGACGGCCAGTAAAAAGCTGGTGGAAACGACGGCCAGTAAGAAA3*TCACGACGGCCAGTAAAAAGCTGGTGGAAACGACGGCCAGTAAGAAAComplementaryACTGGCCGTCGT(to the control sequence)oligonucleotidesTCCACCAGCT(to the chi-site)Star designates 32P radioactive labeled phosphate group in the case of the 5′-end of an oligonucleotide and radioactive adenine nucleotide in the case of the 3′-end. The chi-site and control sequences are in bold. The chi-site is underlined. Open table in a new tab Star designates 32P radioactive labeled phosphate group in the case of the 5′-end of an oligonucleotide and radioactive adenine nucleotide in the case of the 3′-end. The chi-site and control sequences are in bold. The chi-site is underlined. RecA protein complexes with oligonucleotides were formed by incubating 15 μm single-stranded oligonucleotides and 6.5 μm protein in the presence of 0.25 mm ATPγS in a buffer containing 20 mm of triethanolamine acetate (TEA-Ac) (pH 7.5), 2 mm MgAc, 5% glycerol at 37 °C for 30 min. The complexes formed were chilled on ice, and DMS was added to a final concentration of 0.4%. After 30 min at 0 °C the reaction was stopped by the addition of mercaptoethanol and SDS (to 0.2%) followed by ethanol precipitation. DNA cleavage reactions were performed at 95 °C by two successive incubations: 10 min in 10 mm TEA-Ac (pH 7.5) and 10 min in 0.1 mNaOH. The reaction products were analyzed by electrophoresis on 16% denaturing polyacrylamide gels followed by visualization and quantitation in a PhosphorImager (Molecular Dynamics). The electrophoretic profiles were normalized to the signal amplitudes for unmodified oligonucleotides. The approach used was described earlier (5Volodin A.A. Smirnova H.A. Bocharova T.N. FEBS Lett. 1997; 407: 325-328Google Scholar) and is briefly outlined here. The oligonucleotides used for the formation of complexes with RecA protein contained a chi-site sequence at different locations and a DNA sequence (referred to as a ≪control sequence≫) located in the same position within the oligonucleotide. An example of the oligonucleotides and a general outline of the experimental approach is presented in Fig. 1. The control sequence contained four guanine bases (designated in Fig. 1Aby 1–4) conveniently modifiable with DMS. Whereas in ss-DNA·RecA complexes the guanine bases react with DMS with the same efficiency as in free ss-DNA, the reactivity of guanine toward DMS is increased in RecA-double-stranded (ds) DNA complexes (5;9). Therefore, to apply the DNA chemical modification method, two shorter oligonucleotides complementary to different regions in the chi-site containing oligonucleotide were added after formation of RecA·ss-oligonucleotide presynaptic complexes (Fig. 1B). One of these oligonucleotide annealed to the control sequence, another to the chi-site-containing region. This experimental design resulted in the formation of RecA protein ds-DNA complexes in these regions and allowed us to characterize the arrangement of RecA monomers in both of these regions. Fig. 2 presents the results of DMS modification of RecA protein complexes with 5′-end-radiolabeled oligonucleotides (Table I, series I). The patterns of DMS modification in the control sequence region exhibit periodic changes that depend on the position of chi along the oligonucleotides. A comparison of the modification efficiency of the two neighboring G residues in the control sequences (G-2 and G-3) reveals changes that proceed as a result of the shift of the chi-site by one nucleotide (compare lanes 1 and 2; 2and 3; 3 and 4). That the pattern reverts after a shift of the chi-site by 3 nucleotides can be gleaned by comparing lanes 1 and 4. Thus, the modification pattern shows a repeat with a period of 3 nucleotides. Analysis of the relative reactivity of each of the other G residues in the control sequence confirms the presence of a 3-nucleotide periodicity in the modification pattern. According to their ≪in phase≫ location (3 nucleotides apart from each other), the G-1 and G-2 residues are always characterized by similar reactivity changes. On the other hand, the reactivity of G-4, in accordance with its ≪out of phase≫ location relative to the G-3, G-2, and G-1 residues does not correlate with the reactivity of any of these 3 residues, but also exhibits a periodic variation depending on the position of the chi-site (compare scans 1 and 4). As expected there is not a dependence of the modification pattern on the distance between the chi-site and the control sequence on naked duplex DNA and in the absence of RecA the modification patterns of the control sequence was the same for all the oligonucleotides (data not shown). The results presented demonstrate that in RecA protein complexes with these oligonucleotides RecA monomers tend to arrange in a phased manner depending on the position of chi in the oligonucleotide. This phenomenon is similar to the phasing of RecA on a fluorescent dye molecule located at the 5′-end of an oligonucleotide described earlier (5Volodin A.A. Smirnova H.A. Bocharova T.N. FEBS Lett. 1997; 407: 325-328Google Scholar). An additional experiment was carried out where only the complementary oligonucleotide to the control sequence was added to the ss-DNA·RecA complex (see scheme in Fig. 1B). The changes of the modification pattern of the control sequence observed were the same as when both complementary oligonucleotides were added (data not shown). This result indicates that the phasing of RecA monomers occurs when RecA binds to the chi sequence in ss-DNA. Similar modification patterns were obtained for the case of RecA complexes with 3′-labeled oligonucleotides with a dephosphorylated 5′-end (not shown). The above example demonstrated the capability of the chi-site to influence the phasing in the 5′- to 3′-end direction. To check that this influence expands in the opposite direction as well, another set of radiolabeled oligonucleotides was used (Table I, series II and III). These oligonucleotides contained chi in the central part of the oligonucleotide and control sequences near both oligonucleotide ends. As demonstrated in Fig. 3 the shift of the position of chi along the oligonucleotide induces changes of the modification patterns in both directions from chi (compare scans 2 and 3 in Fig. 3) and confirms the capability of chi to influence phasing in both directions. Fig. 3 shows that in the case of 3′-labeled oligonucleotides with a dephosphorylated 5′-end the characteristic changes in the modification pattern are to some extent greater than for the case of oligonucleotides with phosphorylated radiolabeled 5′-ends. A possible explanation is that the 5′-end phosphate acts as another phasing origin for RecA in competition with chi. An analysis of the modification patterns of the chi-site regions also reveals changes in the modification of the G residues in those regions that correlates with the position of the chi-site in the oligonucleotides. In this case also, the modification pattern reverts after a shift by 3 nucleotides (Fig. 3, compare profiles 1and 4). This last result also may be explained by the presence of some origin of RecA phasing other than the chi-site and that the shift of the chi-site relative to this origin induces changes in the chi-site pattern of modification. To locate this origin of phasing, a series of oligonucleotides with the same internal sequences but containing additional (or removed) nucleotides near the 5′- or 3′-ends were used. As demonstrated in Fig. 4, changing the oligonucleotide length by adding (or removing) nucleotides at the phosphorylated 5′-end of the oligonucleotide resulted in corresponding changes both in the chi-site and the control sequence modification patterns whereas the introduction of an additional nucleotide to the 3′-end had no effect (data not shown). This result demonstrates the influence of a phosphorylated 5′-end on the phasing of RecA. Therefore, the modification patterns of the control sequences exhibit a dependence upon both the chi-site position and the changes of the oligonucleotides lengths by adding (or removing) nucleotides from the phosphorylated 5′-end. These results may be explained by the presence in solution of a mixture of two kinds of complexes. In one the binding of RecA monomers has been initiated at chi and generates periodic changes in the modification pattern of the control sequence in the set of oligonucleotides of the same length (Figs. 2 and 3). In another kind of complexe the binding was initiated at the phosphorylated 5′-end of the oligonucleotide (Fig. 4). These two modes of binding generate changes in both the control sequence and the chi-site modification patterns. The data presented demonstrate that a specific DNA sequence, in the present case the chi-site from E. coli, is able to influence the positioning of RecA monomers in recombinational protein-DNA filaments. The phasing occurs when the RecA protein interacts with ss-DNA; that is, when the presynaptic complex is formed and can be observed in both the 5′ and 3′ directions from the origin of phasing. If the RecA monomers have some preference to bind to a particular DNA sequence the cooperative binding of RecA will ensure that the ensuing closed-packed filament will tend to be phased with respect to this sequence. Given that each RecA monomer contains three different sites of binding for DNA nucleotides, the local environment of one of these sites within a RecA monomer is either more hydrophobic (10Johnsrud L. Proc. Natl. Acad. Sci. U. S. A. 1978; 75: 5314-5318Google Scholar) or alters the accessibility of guanines such that G residues at one of these sites is most easily modified. It is this differential reactivity of G residues to DMS in the DNA in a RecA·DNA complex that allows us to observe the phasing of RecA monomers (Fig.5). That is, when a guanine is situated in one of these sites a stronger modification signal is observed (Fig.5, A, B, and D) and when guanines appear between these sites they exhibit a relatively low level of modification (Fig. 5C). The modification pattern reverts after the shift of the chi-site by 3 nucleotides (Fig. 5, Aand D) in agreement with the stoichiometry of RecA protein binding to ss-DNA. The exact structure of the DNA binding domain of RecA protein remains to be established. Unfortunately, there are no data that could resolve the different sites on RecA that interact with each of the 3 individual nucleotides bound to each monomer. As is evident from the variation of G-base reactivity toward DMS at the different sites in the RecA monomer, our data presented here and obtained previously (5Volodin A.A. Smirnova H.A. Bocharova T.N. FEBS Lett. 1997; 407: 325-328Google Scholar) show that individual nucleotides bind to distinct and distinguishable sites in each RecA monomer. In addition, that DNA sequences can influence the phasing of RecA implies the non-equivalence of the nucleotide binding sites and some base preference of the binding at each of the three sites. We do not suppose that the phasing of RecA is mediated exclusively by the chi-site sequence. Because the nucleotide binding centers of a RecA monomer differ in their affinity for different bases, thermodynamically favorable modes of RecA monomer arrangements (“phasing”) should exist for RecA complexes on a wide range of non-uniform DNA sequences. Obviously, this phasing is more facile on sequences that exhibit a modulation of base sequence with a period of 3 nucleotides (for example, in regions of DNA with a strong codon bias). In preliminary experiments we have confirmed that a number of randomly chosen sequences can influence the phasing of RecA monomers to varying degrees (not shown). A detailed investigation of this question requires further study and would be more informative with a DNA modification agent that is not base-specific. In a bacterial cell RecA acts as a component of a rather complex protein machine (for review, see Ref. 11Kowalczykowski S.C. Trends Biochem. Sci. 2000; 25: 156-165Google Scholar) and other components of the recombination/repair system may also influence the phasing of RecA. The physical non-equivalence of individual nucleotide binding sites in a RecA monomer raises the issue of the functional organization of recombinational protein-DNA complexes. The main function of RecA protein is to promote the recognition of homology between similar but not identical DNA molecules. Nucleotide bases bound at the 3 distinct sites of the RecA monomer may tolerate non-homology in a partner DNA quite differently, either before or during strand exchange. Such a triplet organization bears a striking resemblance to the structure of the protein coding regions in DNA, where the informational value of a nucleotide depends on its position inside a codon and, consequently, also exhibits a periodic variation with a period of 3 nucleotides. Additional studies are needed to answer the question of whether this is just a coincidence or a feature of functional importance in genetic processes promoted by RecA. We suggest a relationship between the phasing of RecA monomers with some functionally important features in DNA. For example, there are several facts about chi and the distribution (location) of G and T bases in coding regions of DNA that allow us to speculate about a mechanism by which the RecA monomers on ss-DNA can be phased with the protein coding frames of this DNA. Chi is not only a recombinational hotspot but is also one of the most overrepresented sequences inE. coli (12Blattner F.R. Plunkett 3rd, G. Bloch C.A. Perna N.T. Burland V. Riley M. Collado-Vides J. Glasner J.D. Rode C.K. Mayhew G.F. Gregor J. Davis N.W. Kirkpatrick H.A. Goeden M.A. Rose D.J. Mau B. Shao Y. Science. 1997; 277: 1453-1474Google Scholar) with an extremely strong tendency to be phased relative to the protein coding frame (13Colbert T. Taylor A.F. Smith G.R. Trends Genet. 1998; 14: 485-488Google Scholar). The 3 nucleotide periodicity in the arrangement of G and T bases is a property of the codon bias ofE. coli DNA (13Colbert T. Taylor A.F. Smith G.R. Trends Genet. 1998; 14: 485-488Google Scholar, 14Biaudet V. El Karoui M. Gruss A. Mol. Microbiol. 1998; 29: 666-669Google Scholar) in general and particularly in the vicinity of chi (15Tracy R.B. Chedin F. Kowalczykowski S.C. Cell. 1997; 90: 205-206Google Scholar). The propensity of DNA sequences to influence the positioning of RecA demonstrated here together with the observations that both chi and the GT-islands of preferred pairing (6Tracy R.B. Kowalczykowski S.C. Genes Dev. 1996; 10: 1890-1903Google Scholar) are in phase with open-reading frames allows us to suggest that in presynaptic complexes RecA monomers may be phased with respect to the protein coding frame. RecA phasing with respect to open-reading frames and the ability of RecA to significantly decrease the fidelity of heteroduplex formation (16Malkov V.A. Sastry L. Camerini-Otero R.D. J. Mol. Biol. 1997; 271: 168-177Google Scholar, 17Malkov V.A. Camerini-Otero R.D. J. Mol. Biol. 1998; 278: 317-330Google Scholar) compared with that of heteroduplex formation in the absence of protein might have an important role in permitting recombination between homologous but not identical protein encoding DNAs with different codon usage. If, for example, the phasing allows this “anti-proofreading” decrease in fidelity to be mostly at the third position in a codon, the wobble position could be more easily assimilated in genetic crosses. Such a decrease in fidelity in the third position of a codon could maximize the probability of exchanges between functionally active genes with different DNA sequences but encoding identical protein sequences as takes place, for example, in the process of horizontal gene transfer. This may not be the only possible role of the phasing of RecA monomers. Because of the plurality and complexity of the processes RecA protein participates in it is difficult to foresee all possible consequence of this phenomenon. Nevertheless, we suggest that the DNA sequence-dependent positioning of RecA monomers may be an important structural and functional feature of recombinational protein-DNA cofilaments. We thank Drs. Vlad Malkov, Oleg Voloshin, and Igor Panyutin for useful discussions and Drs. Peggy Hsieh, Howard Nash, and Susan Gottesman for critically reading the manuscript. We are also grateful to George Poy for oligonucleotide synthesis and Linda Robinson for technical help." @default.
• W2149631731 created "2016-06-24" @default.
• W2149631731 creator A5012187026 @default.
• W2149631731 creator A5051631618 @default.
• W2149631731 date "2002-01-01" @default.
• W2149631731 modified "2023-09-30" @default.
• W2149631731 title "Influence of DNA Sequence on the Positioning of RecA Monomers in RecA-DNA Cofilaments" @default.
• W2149631731 cites W1496926654 @default.
• W2149631731 cites W1506534753 @default.
• W2149631731 cites W1511299884 @default.
• W2149631731 cites W171067487 @default.
• W2149631731 cites W1980505207 @default.
• W2149631731 cites W1996986837 @default.
• W2149631731 cites W2012273694 @default.
• W2149631731 cites W2020490067 @default.
• W2149631731 cites W2037479608 @default.
• W2149631731 cites W2046830681 @default.
• W2149631731 cites W2057833497 @default.
• W2149631731 cites W2102118794 @default.
• W2149631731 cites W2110934739 @default.
• W2149631731 cites W2133279612 @default.
• W2149631731 cites W2134153749 @default.
• W2149631731 cites W2154564531 @default.
• W2149631731 cites W2185737992 @default.
• W2149631731 cites W2306443312 @default.
• W2149631731 doi "https://doi.org/10.1074/jbc.m108871200" @default.
• W2149631731 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11700314" @default.
• W2149631731 hasPublicationYear "2002" @default.
• W2149631731 type Work @default.
• W2149631731 sameAs 2149631731 @default.
• W2149631731 citedByCount "11" @default.
• W2149631731 countsByYear W21496317312017 @default.
• W2149631731 countsByYear W21496317312018 @default.
• W2149631731 crossrefType "journal-article" @default.
• W2149631731 hasAuthorship W2149631731A5012187026 @default.
• W2149631731 hasAuthorship W2149631731A5051631618 @default.
• W2149631731 hasBestOaLocation W21496317311 @default.
• W2149631731 hasConcept C153911025 @default.
• W2149631731 hasConcept C166940927 @default.
• W2149631731 hasConcept C178790620 @default.
• W2149631731 hasConcept C185592680 @default.
• W2149631731 hasConcept C2778112365 @default.
• W2149631731 hasConcept C51679486 @default.
• W2149631731 hasConcept C521977710 @default.
• W2149631731 hasConcept C54355233 @default.
• W2149631731 hasConcept C552990157 @default.
• W2149631731 hasConcept C55493867 @default.
• W2149631731 hasConcept C70721500 @default.
• W2149631731 hasConcept C86803240 @default.
• W2149631731 hasConceptScore W2149631731C153911025 @default.
• W2149631731 hasConceptScore W2149631731C166940927 @default.
• W2149631731 hasConceptScore W2149631731C178790620 @default.
• W2149631731 hasConceptScore W2149631731C185592680 @default.
• W2149631731 hasConceptScore W2149631731C2778112365 @default.
• W2149631731 hasConceptScore W2149631731C51679486 @default.
• W2149631731 hasConceptScore W2149631731C521977710 @default.
• W2149631731 hasConceptScore W2149631731C54355233 @default.
• W2149631731 hasConceptScore W2149631731C552990157 @default.
• W2149631731 hasConceptScore W2149631731C55493867 @default.
• W2149631731 hasConceptScore W2149631731C70721500 @default.
• W2149631731 hasConceptScore W2149631731C86803240 @default.
• W2149631731 hasIssue "2" @default.
• W2149631731 hasLocation W21496317311 @default.
• W2149631731 hasOpenAccess W2149631731 @default.
• W2149631731 hasPrimaryLocation W21496317311 @default.
• W2149631731 hasRelatedWork W1920751942 @default.
• W2149631731 hasRelatedWork W1991523530 @default.
• W2149631731 hasRelatedWork W2002128513 @default.
• W2149631731 hasRelatedWork W2003848246 @default.
• W2149631731 hasRelatedWork W2020824267 @default.
• W2149631731 hasRelatedWork W2031436818 @default.
• W2149631731 hasRelatedWork W2057739827 @default.
• W2149631731 hasRelatedWork W2075354549 @default.
• W2149631731 hasRelatedWork W2078710798 @default.
• W2149631731 hasRelatedWork W2092874662 @default.
• W2149631731 hasVolume "277" @default.
• W2149631731 isParatext "false" @default.
• W2149631731 isRetracted "false" @default.
• W2149631731 magId "2149631731" @default.
• W2149631731 workType "article" @default.