FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2149669489> ?p ?o ?g. }

• W2149669489 endingPage "15381" @default.
• W2149669489 startingPage "15375" @default.
• W2149669489 abstract "The catalytic residue of eukaryotic and prokaryotic sulfatases is a α-formylglycine. In the sulfatase ofKlebsiella pneumoniae the formylglycine is generated by posttranslational oxidation of serine 72. We cloned theatsBA operon of K. pneumoniae and found that the sulfatase was expressed in inactive form in Escherichia coli transformed with the structural gene (atsA). Coexpression of the atsB gene, however, led to production of high sulfatase activity, indicating that the atsB gene product plays a posttranslational role that is essential for the sulfatase to gain its catalytic activity. This was verified after purification of the sulfatase from the periplasm of the cells. Peptide analysis of the protein expressed in the presence of AtsB revealed that half of the polypeptides carried the formylglycine at position 72, while the remaining polypeptides carried the encoded serine. The inactive sulfatase expressed in the absence of AtsB carried exclusively serine 72, demonstrating that the atsB gene is required for formylglycine modification. This gene encodes a 395-amino acid residue iron sulfur protein that has a cytosolic localization and is supposed to directly or indirectly catalyze the oxidation of the serine to formylglycine. The catalytic residue of eukaryotic and prokaryotic sulfatases is a α-formylglycine. In the sulfatase ofKlebsiella pneumoniae the formylglycine is generated by posttranslational oxidation of serine 72. We cloned theatsBA operon of K. pneumoniae and found that the sulfatase was expressed in inactive form in Escherichia coli transformed with the structural gene (atsA). Coexpression of the atsB gene, however, led to production of high sulfatase activity, indicating that the atsB gene product plays a posttranslational role that is essential for the sulfatase to gain its catalytic activity. This was verified after purification of the sulfatase from the periplasm of the cells. Peptide analysis of the protein expressed in the presence of AtsB revealed that half of the polypeptides carried the formylglycine at position 72, while the remaining polypeptides carried the encoded serine. The inactive sulfatase expressed in the absence of AtsB carried exclusively serine 72, demonstrating that the atsB gene is required for formylglycine modification. This gene encodes a 395-amino acid residue iron sulfur protein that has a cytosolic localization and is supposed to directly or indirectly catalyze the oxidation of the serine to formylglycine. Mammalian sulfatases (see Ref. 1von Figura K. Schmidt B. Selmer T. Dierks T. Bioessays. 1998; 20: 505-510Crossref PubMed Scopus (80) Google Scholar) are involved in the turnover of endogenous sulfated substrates. Sulfatases of lower eukaryotes and bacteria, on the other hand, are expressed under conditions of sulfur starvation and function in sulfate scavenging from exogenous substrates (2Dodgson K.S. White G.F. Fitzgerald J.W. Sulfatases of Microbial Origin. CRC Press, Boca Raton, FL1982Google Scholar). Despite their different functions all these sulfatases form a highly conserved protein family showing strong homology on the level of both primary (3Franco B. Meroni G. Parenti G. Levilliers J. Bernard L. Gebbia M. Cox L. Maroteaux P. Sheffield L. Rappold G.A. Andria G. Petit C. Ballabio A. Cell. 1995; 81: 15-25Abstract Full Text PDF PubMed Scopus (258) Google Scholar, 4Parenti G. Meroni G. Ballabio A. Curr. Opin. Gen. Dev. 1997; 7: 386-391Crossref PubMed Scopus (139) Google Scholar) and three-dimensional structure (5Bond C.S. Clements P.R. Ashby S.J. Collyer C.A. Harrop S.J. Hopwood J.J. Guss J.M. Structure (Lond.). 1997; 5: 277-289Abstract Full Text Full Text PDF PubMed Scopus (252) Google Scholar, 6Lukatela G. Krauss N. Theis K. Selmer T. Gieselmann V. von Figura K. Saenger W. Biochemistry. 1998; 37: 3654-3664Crossref PubMed Scopus (270) Google Scholar). Furthermore, sulfatases of prokaryotic, lower eukaryotic, and human origin share a unique amino acid residue, a α-formylglycine (FGly), 1The abbreviations used are: FGly, Cα-formylglycine; AtsA-His6(±B), His-tagged AtsA protein expressed in the presence or absence of atsB ; ORF, open reading frame; P2, serine 72-containing form of tryptic peptide 2; P2*, FGly 72-containing form of tryptic peptide 2; PAGE, polyacrylamide gel electrophoresis; RP-HPLC, reversed phase high-performance liquid chromatography; kbp, kilobase pair(s); bp, base pair(s); PCR, polymerase chain reactionthat is essential for catalytic activity (7Miech C. Dierks T. Selmer T. von Figura K. Schmidt B. J. Biol. Chem. 1998; 273: 4835-4837Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar, 8Dierks T. Miech C. Hummerjohann J. Schmidt B. Kertesz M.A. von Figura K. J. Biol. Chem. 1998; 273: 25560-25564Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar, 9Selmer T. Hallmann A. Schmidt B. Sumper M. von Figura K. Eur. J. Biochem. 1996; 238: 341-345Crossref PubMed Scopus (56) Google Scholar, 10Schmidt B. Selmer T. Ingendoh A. von Figura K. Cell. 1995; 82: 271-278Abstract Full Text PDF PubMed Scopus (295) Google Scholar). Like the FGly all other putative active site residues are conserved (11Waldow A. Schmidt B. Dierks T. von Bülow R. von Figura K. J. Biol. Chem. 1999; 274: 12284-12288Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). This reflects the importance of the catalytic mechanism underlying sulfate ester cleavage, during which the FGly acts as the catalytic residue (6Lukatela G. Krauss N. Theis K. Selmer T. Gieselmann V. von Figura K. Saenger W. Biochemistry. 1998; 37: 3654-3664Crossref PubMed Scopus (270) Google Scholar,12Recksiek M. Selmer T. Dierks T. Schmidt B. von Figura K. J. Biol. Chem. 1998; 273: 6096-6103Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). Failure to generate the FGly residue is the cause of multiple sulfatase deficiency, a rare but fatal human lysosomal storage disorder (10Schmidt B. Selmer T. Ingendoh A. von Figura K. Cell. 1995; 82: 271-278Abstract Full Text PDF PubMed Scopus (295) Google Scholar, 13Kolodny E.H. Fluharty A.L. Scriver C.R. Beaudet A.L. Sly W.S. Valle D. The Metabolic and Molecular Bases of Inherited Disease. McGraw-Hill, New York1995: 2693-2741Google Scholar). In eukaryotic sulfatases the FGly is generated in the endoplasmic reticulum by oxidation of a conserved cysteine residue (14Dierks T. Schmidt B. von Figura K. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 11963-11968Crossref PubMed Scopus (109) Google Scholar, 15Dierks T. Lecca M.R. Schmidt B. von Figura K. FEBS Lett. 1998; 423: 61-65Crossref PubMed Scopus (36) Google Scholar). This oxidation occurs during or shortly after translocation of the nascent polypeptide into this compartment and is directed by a linear sequence motif starting with the residue to be modified. As shown in vitro for human arylsulfatase A (16Dierks T. Lecca M.R. Schlotterhose P. Schmidt B. von Figura K. EMBO J. 1999; 18: 2084-2091Crossref PubMed Scopus (119) Google Scholar), this motif consists of the dodecamer sequence CTPSRAALLTGR comprising an essential core element (CXPXR) and a stimulating auxiliary element (AALLTGR). The core element is fully conserved, and the auxiliary element is partially conserved, among all eukaryotic members of the sulfatase family and also in the well characterized sulfatase ofPseudomonas aeruginosa (17Beil S. Kehrli H. James P. Staudenmann W. Cook A.M. Leisinger T. Kertesz M.A. Eur. J. Biochem. 1995; 229: 385-394Crossref PubMed Scopus (103) Google Scholar). Unlike this prokaryotic cysteine-type sulfatase, which is located in the cytosol, the other well characterized prokaryotic sulfatase, the arylsulfatase of Klebsiella pneumoniae (18Murooka Y. Ishibashi K. Yasumoto M. Sasaki M. Sugino H. Azakami H. Yamashita M. J. Bacteriol. 1990; 172: 2131-2140Crossref PubMed Google Scholar), is a serine-type sulfatase, which is located in the periplasm and which carries a FGly residue that is generated by oxidation of a serine rather than a cysteine (7Miech C. Dierks T. Selmer T. von Figura K. Schmidt B. J. Biol. Chem. 1998; 273: 4835-4837Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar). Nevertheless, the two sequence motifs (SXPXR and SMLLTGN) are also conserved in theKlebsiella sulfatase. After expression of this protein under strongly inducing conditions, 60% of the polypeptides carried the FGly residue, and the remaining 40% carried the serine predicted from the DNA sequence (7Miech C. Dierks T. Selmer T. von Figura K. Schmidt B. J. Biol. Chem. 1998; 273: 4835-4837Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar). Conversion of serine to FGly obviously is catalyzed also byEscherichia coli, since the Klebsiella sulfatase can be expressed in E. coli as an active enzyme (18Murooka Y. Ishibashi K. Yasumoto M. Sasaki M. Sugino H. Azakami H. Yamashita M. J. Bacteriol. 1990; 172: 2131-2140Crossref PubMed Google Scholar). This organism furthermore is able to quantitatively oxidize cysteine 51 to FGly after overexpression of the cysteine-type sulfatase of P. aeruginosa (8Dierks T. Miech C. Hummerjohann J. Schmidt B. Kertesz M.A. von Figura K. J. Biol. Chem. 1998; 273: 25560-25564Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar). Surprisingly, no FGly modification was observed when a mutant of the Pseudomonas sulfatase was expressed, in which cysteine 51 was substituted by a serine. This suggests thatE. coli harbors two FGly generating systems or that a common modification system is modulated by a cofactor (8Dierks T. Miech C. Hummerjohann J. Schmidt B. Kertesz M.A. von Figura K. J. Biol. Chem. 1998; 273: 25560-25564Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar). Transformation of E. coli with the structural gene encoding the Pseudomonas sulfatase (atsA) is sufficient to obtain catalytically active and FGly-containing sulfatase protein. Active expression of the Klebsiella sulfatase, however, was reported to require not only the sulfatase gene (atsA) but in addition an adjacent non-sulfatase gene termed atsB (18Murooka Y. Ishibashi K. Yasumoto M. Sasaki M. Sugino H. Azakami H. Yamashita M. J. Bacteriol. 1990; 172: 2131-2140Crossref PubMed Google Scholar). AtsB therefore was considered to function as a positive regulator of sulfatase expression in Klebsiella. In the present study we characterized this regulation in more detail. Data presented here show that regulation by AtsB is not due to a function as a transcriptional activator, as had been suggested originally (19Azakami H. Sugino H. Yokoro N. Iwata N. Murooka Y. J. Bacteriol. 1993; 175: 6287-6292Crossref PubMed Google Scholar, 20Azakami H. Sugino H. Iwata N. Yokoro N. Yamashita M. Murooka Y. Gene (Amst.). 1995; 164: 89-94Crossref PubMed Scopus (8) Google Scholar). AtsB rather plays a crucial role in a posttranslational event, namely the conversion of serine 72 to FGly. Genomic DNA of K. pneumoniae DSM 681 (Deutsche SammLung von Mikroorganismen, Braunschweig, Germany) was prepared according to Ref. 21Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology. J. Wiley, New York1996Google Scholar. For generation of a subgenomic bank, 110 μg of genomic DNA were digested with BamHI. After Southern blotting of 10% of the digest, a positive signal was obtained in the 6.8-kbp region using a 585-bp probe generated by PCR amplification of atsA nucleotides 2495–3079 (see Ref. 18Murooka Y. Ishibashi K. Yasumoto M. Sasaki M. Sugino H. Azakami H. Yamashita M. J. Bacteriol. 1990; 172: 2131-2140Crossref PubMed Google Scholar) and labeled with [α-32P]dCTP (Rediprime DNA Labeling, Amersham Pharmacia Biotech). After electrophoretic separation of the remaining digest, 5–8-kbp fragments were recovered from the gel, cloned into pBluescript II KS (Stratagene) and transformed into E. coli DH5α by electroporation. Positive clones were identified first by colony hybridization using the probe described above and, second, by sulfatase assays using 5-bromo-6-chloro-3-indoxyl sulfate (Biosynth) orp-nitrocatechol sulfate (Sigma) as a substrate (7Miech C. Dierks T. Selmer T. von Figura K. Schmidt B. J. Biol. Chem. 1998; 273: 4835-4837Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar, 17Beil S. Kehrli H. James P. Staudenmann W. Cook A.M. Leisinger T. Kertesz M.A. Eur. J. Biochem. 1995; 229: 385-394Crossref PubMed Scopus (103) Google Scholar). TheatsA and atsB ORFs were localized by restriction mapping (cf. Ref. 18Murooka Y. Ishibashi K. Yasumoto M. Sasaki M. Sugino H. Azakami H. Yamashita M. J. Bacteriol. 1990; 172: 2131-2140Crossref PubMed Google Scholar) and DNA sequencing. Thereby it turned out that the atsB ORF was 30 bp shorter and theatsA ORF 339 bp longer than published previously (18Murooka Y. Ishibashi K. Yasumoto M. Sasaki M. Sugino H. Azakami H. Yamashita M. J. Bacteriol. 1990; 172: 2131-2140Crossref PubMed Google Scholar). The entire atsBA operon was subcloned as a 3832-bpBamHI/XcmI fragment (clone pATSBA#R5), and both DNA strands were sequenced using Big-Dye Terminator Cycle Sequencing (Perkin-Elmer Biosystems). The sequence obtained was deposited in the EBI data base (accession number AJ131525). For protein expression the single atsA and atsB and also the bicistronicatsBA ORFs were placed under control of the lacpromoter of pBluescript II KS or pBBR1MCS (22Kovach M.E. Phillips R.W. Elzer P.H. Roop R.M. Peterson K.M. BioTechniques. 1994; 16: 800-802PubMed Google Scholar) (see Fig. 1). To facilitate insertion into the multi cloning sites of these vectors we introduced a BamHI site 3′ of the atsAstop codon (noncoding primer: CGGGATCCGGAAGAACGATAGCCGTGGTGG) and aHindIII or KpnI site directly 5′ of the ribosome binding sites of atsA (coding primer: CCCAAGCTTGAACAGGAGAGTCAGTCGTGA) or atsB (coding primer: GGGGTACCAACAGTACCGGTCATTAACCG), respectively, using PCR methods. Disruption of the atsB ORF was achieved after deletion of a 882-bp NheI/StuI fragment and in-frame religation of the blunted ends (see Fig. 1). To facilitate purification of the expressed sulfatase protein, a C-terminal Arg-Gly-Ser-(His)6 tag was added to the AtsA protein. This was achieved after adding a corresponding oligonucleotide (noncoding sequence: CGGGATCCTAGTGATGGTGATGGTGATGCGATCCTCT) to the lastatsA codon and subcloning of the PCR product as aXhoI/BamHI fragment back into the corresponding template plasmid. Protein expression was achieved after transforming E. coliDH5α with pBluescript II KS containing the described atsconstructs. For coexpression of atsA and atsBfrom two different plasmids (Fig. 2 A) a double transformation was performed using atsA cloned into pBBR1MCS and atsB cloned into pBluescript II KS. Double transformants were selected due to their ampicillin and chloramphenicol resistance. The presence of the two genes was verified by PCR analysis. The transformed cells were grown aerobically in Luria-Bertani medium with constant shaking at 37 °C. After 2–3 h 1 mm isopropyl thiogalactopyranoside was added and growth continued for another 5–6 h. Preparation of periplasm from these cells and purification of the His6-tagged proteins on nickel-nitrilotriacetic acid-agarose (Qiagen) under native conditions was carried out according to the protocols (The QIAexpressionist) given by the manufacturer. Expression of the recombinant sulfatase protein was quantitated by Western blotting using polyclonal antibodies raised against the native arylsulfatase protein purified fromKlebsiella (7Miech C. Dierks T. Selmer T. von Figura K. Schmidt B. J. Biol. Chem. 1998; 273: 4835-4837Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar). The used antibodies showed no cross-reactivity with E. coli antigens after purification of the antiserum by pre-adsorption to immobilized E. coliprotein. Protein determinations were carried out according to Bradford or Lowry (23Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (216377) Google Scholar, 24Lowry O.H. Rosebrough N.J. Farr A.L. Randall R.J. J. Biol. Chem. 1951; 193: 265-275Abstract Full Text PDF PubMed Google Scholar). The activity of the recombinant sulfatase was determined in duplicate assays using p-nitrocatechol sulfate as a substrate (7Miech C. Dierks T. Selmer T. von Figura K. Schmidt B. J. Biol. Chem. 1998; 273: 4835-4837Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar). It was verified that these determinations were carried out under initial rate conditions at saturating substrate concentration (V max determinations). The purified AtsA-His6 protein was almost devoid of any contaminating proteins (>95% purity), as checked by SDS-PAGE (Fig. 3,A and C) and RP-HPLC on a C4 column (not shown). The presence of FGly at the protein level was determined after subjecting the purified AtsA-His6 protein to treatment with NaB[3H]H4 under denaturing conditions, desalting, SDS-PAGE, and fluorography (Fig. 3, A andC), as had been described previously (8Dierks T. Miech C. Hummerjohann J. Schmidt B. Kertesz M.A. von Figura K. J. Biol. Chem. 1998; 273: 25560-25564Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar). The presence of FGly at the peptide and amino acid level was determined after tryptic digestion of AtsA-His6 protein, treated or not with NaB[3H]H4, and purification of tryptic peptides by RP-HPLC, which was performed as described (8Dierks T. Miech C. Hummerjohann J. Schmidt B. Kertesz M.A. von Figura K. J. Biol. Chem. 1998; 273: 25560-25564Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar). Fractions from RP-HPLC were analyzed by liquid scintillation counting, amino acid sequencing, radiosequencing, and matrix-assisted laser desorption ionization mass spectrometry using indole-2-carboxylic acid andp-nitroaniline as a matrix (8Dierks T. Miech C. Hummerjohann J. Schmidt B. Kertesz M.A. von Figura K. J. Biol. Chem. 1998; 273: 25560-25564Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar, 10Schmidt B. Selmer T. Ingendoh A. von Figura K. Cell. 1995; 82: 271-278Abstract Full Text PDF PubMed Scopus (295) Google Scholar). In order to study the role of theatsB gene on expression of active Klebsiellaarylsulfatase, encoded by the atsA gene, we needed the cloned atsBA operon. Since the atsBA plasmid described previously (18Murooka Y. Ishibashi K. Yasumoto M. Sasaki M. Sugino H. Azakami H. Yamashita M. J. Bacteriol. 1990; 172: 2131-2140Crossref PubMed Google Scholar) was not available, we generated a subgenomic bank of Klebsiella DNA and identified the entireatsBA operon on a 6.8-kbp BamHI fragment (see “Experimental Procedures”). The DNA sequence of a subcloned 3832-bpBamHI/XcmI fragment (accession number AJ131525) revealed that the atsB ORF codes for an iron sulfur protein consisting of 395 amino acid residues, i.e. 10 residues less than published previously (Ref. 18Murooka Y. Ishibashi K. Yasumoto M. Sasaki M. Sugino H. Azakami H. Yamashita M. J. Bacteriol. 1990; 172: 2131-2140Crossref PubMed Google Scholar, GenBankTM accession number M31938), and lacking a signal peptide (Fig.1). The atsA ORF, on the other hand, encodes the arylsulfatase protein consisting of 577 amino acid residues, i.e. 113 residues more than published by Murookaet al. (18Murooka Y. Ishibashi K. Yasumoto M. Sasaki M. Sugino H. Azakami H. Yamashita M. J. Bacteriol. 1990; 172: 2131-2140Crossref PubMed Google Scholar), and including a 20 residues signal peptide directing translocation of this protein into the periplasm (Fig. 1). The correctness of the revised atsA sequence was verified on the protein level by mass spectrometry and amino acid sequencing of several tryptic peptides of purified Klebsiellaarylsulfatase protein (7Miech C. Dierks T. Selmer T. von Figura K. Schmidt B. J. Biol. Chem. 1998; 273: 4835-4837Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar), including peptide 44 (GLTAGDAPWQ, residues 487–496), which is located within the extra 113 residues predicted from the revised DNA sequence. This C-terminal part of the protein was found to be essential for enzyme activity (data not shown). The protein sequence directly following the serine 72 to be converted to FGly (SAPARSMLLTGN, residues 72–83) is homologous to the sequence motif directing FGly modification in human arylsulfatase A (Ref. 16Dierks T. Lecca M.R. Schlotterhose P. Schmidt B. von Figura K. EMBO J. 1999; 18: 2084-2091Crossref PubMed Scopus (119) Google Scholar, see Introduction). Although E. coli carries three sulfatase-related genes (25Schirmer A. Kolter R. Chem. Biol. 1998; 5: R181-R186Abstract Full Text PDF PubMed Scopus (28) Google Scholar), active endogenous sulfatases have not yet been found in this species. Transformation of E. coli with theatsA gene of P. aeruginosa (8Dierks T. Miech C. Hummerjohann J. Schmidt B. Kertesz M.A. von Figura K. J. Biol. Chem. 1998; 273: 25560-25564Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar) or with theKlebsiella atsBA operon (18Murooka Y. Ishibashi K. Yasumoto M. Sasaki M. Sugino H. Azakami H. Yamashita M. J. Bacteriol. 1990; 172: 2131-2140Crossref PubMed Google Scholar), however, leads to the expression of active arylsulfatases. Since in prokaryotes arylsulfatase expression is repressed during growth in the presence of sulfate, we cloned the atsBA operon without its endogenous promoter into an expression vector downstream of the lac promoter (Fig.1), allowing controlled expression at logarithmic growth in Luria-Bertani medium. E. coli DH5α transformed with theatsBA plasmid was found to express high arylsulfatase activities reaching a maximum of 2–3 units/mg of cell protein after aerobic growth for 5–6 h in the presence of isopropyl thiogalactopyranoside (Fig.2 A, lane 1). The recombinant AtsA protein was detected by Western blotting using antibodies against the purified Klebsiella arylsulfatase (Fig. 2) and was found to be located in the periplasm (not shown). Its electrophoretic mobility was in agreement with the predicted mass of 62,230 Da (Figs. 2 and 3 A) and was identical to the mobility of the arylsulfatase purified fromKlebsiella (not shown). AtsB and AtsA are coexpressed from a bicistronic transcript. Since we wanted to study AtsA and AtsB independently, we cloned each of the two ORFs separately downstream of the lac promoter into two vectors carrying different selection markers, thus allowing selection of double transformants. The AtsA protein expressed by these double transformants showed a similar specific activity when compared with the bicistronic expression, as concluded from the activities and Western blot signals determined (Fig. 2 A, lanes 1 and2). Most interestingly, expression of atsA alone did not lead to any detectable sulfatase activity (<1 milliunits/mg of cell protein), although the AtsA protein was produced at normal levels (Fig.2 A, lane 3). Since expression of atsBalone also did not lead to any sulfatase activity (Fig. 2 A,lane 4), it has to be concluded that the atsBgene product has a posttranslational function that is essential for the AtsA arylsulfatase to gain its enzymatic activity. The dependence of active AtsA expression on a functional atsB gene was confirmed by the bicistronic expression of atsA together with an atsB fragment that carried a 882-bp in-frame deletion corresponding to amino acid residues 89–382 of AtsB (see Fig.1). As a consequence of this deletion, no arylsulfatase activity was measurable, although the AtsA protein was present (Fig. 2 A,lane 5). This rules out that the dissection of the bicistronic gene organization abolished active AtsA expression. TheatsB gene product rather acts in trans on the AtsA protein, as shown by the coexpression of AtsB and AtsA from two different plasmids. In order to analyze the expressed AtsA protein for the presence of FGly in position 72, the recombinant arylsulfatase had to be purified. To facilitate purification we expressed the AtsA protein in a His-tagged form (AtsA-His6). This protein showed a similar catalytic activity as wild-type AtsA (Fig. 2B, compare lanes 1 and2). The AtsA-His6 protein was purified from the periplasm of the cells by chromatography on nickel-agarose, yielding a homogenous protein preparation (>95% purity), as checked by SDS-PAGE (Fig. 3 A) and RP-HPLC (not shown). This preparation showed a specific enzymatic activity of 73 units/mg of purified protein (Fig.2 B, lane 4). As expected, the AtsA-His6 protein purified from E. coliexpressing only the structural gene but not the atsB gene showed no activity (Fig. 2 B, lane 3, and Fig.3 C). To examine whether serine 72 was converted to FGly, the purified AtsA-His6 proteins, expressed in the absence (AtsA-His6(−B)) or presence of AtsB (AtsA-His6(+B)), were denatured and incubated with NaB[3H]H4. This treatment reduces the formyl group of FGly leading to formation of a [3H]serine residue (7Miech C. Dierks T. Selmer T. von Figura K. Schmidt B. J. Biol. Chem. 1998; 273: 4835-4837Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar, 8Dierks T. Miech C. Hummerjohann J. Schmidt B. Kertesz M.A. von Figura K. J. Biol. Chem. 1998; 273: 25560-25564Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar, 9Selmer T. Hallmann A. Schmidt B. Sumper M. von Figura K. Eur. J. Biochem. 1996; 238: 341-345Crossref PubMed Scopus (56) Google Scholar, 10Schmidt B. Selmer T. Ingendoh A. von Figura K. Cell. 1995; 82: 271-278Abstract Full Text PDF PubMed Scopus (295) Google Scholar). After gel filtration aliquots of the protein samples were analyzed by SDS-PAGE, followed by Coomassie Blue staining and fluorography. Thereby it turned out that AtsA-His6(+B) carried a 3H label, whereas AtsA-His6(−B) did not (Fig. 3, A and C). The proteins were subjected to digestion with trypsin, and the tryptic peptides were separated by RP-HPLC. The radioactivity recovered during chromatography of the AtsA-His6(+B) peptides was found to be associated with a single tryptic peptide showing a mass of 1590 Da (Fig.3 B). A mass of 1589.8 Da is predicted for the serine 72-containing form of peptide 2 (P2) comprising residues 63–76 of the AtsA protein. In the corresponding fractions of the tryptic peptides of AtsA-His6(−B) a 1590-Da peptide was also identified; the radioactivity measured in these fractions, however, did not exceed the background level (Fig. 3 D). Sequencing of the 1590-Da peptides in both cases led to the amino acid sequence of P2 comprising a serine in position 72 (Fig. 4,A and B). However, only in the case of P2 from AtsA-His6(+B) radioactivity was released in the 10th sequencing cycle corresponding to serine 72 (Fig. 4 C). This indicates that prior to reduction FGly had been present in position 72, which by treatment with NaB[3H]H4 was reduced to [3H]serine. On the contrary, no release of radioactivity in any of 15 cycles was observed during sequencing of the HPLC fractions containing P2 from AtsA-His6(−B) (not shown). In conclusion, the atsB gene product is required to oxidize serine 72 to FGly in the newly synthesized sulfatase polypeptide. To determine the FGly content in the recombinant AtsA-His6(+B) protein, we analyzed its tryptic peptides without prior treatment of the protein with NaB[3H]H4. In the HPLC chromatogram a peptide with a mass of 1588 Da was identified eluting at a 0.4 min earlier retention time than the 1590-Da P2 (Fig.5, A–C). A mass of 1587.8 Da is predicted for the FGly 72-containing form of peptide 2 (P2*). The presence of the FGly was verified when using p-nitroaniline as a matrix for matrix-assisted laser desorption ionization mass spectrometry, which led to a mass of 1708 Da for P2* (Fig.5 D). The increase in mass by 120 Da, which was not observed for P2 (Fig. 5 E), is due to a Schiff base formation ofp-nitroaniline and the formyl group of P2* (7Miech C. Dierks T. Selmer T. von Figura K. Schmidt B. J. Biol. Chem. 1998; 273: 4835-4837Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar, 8Dierks T. Miech C. Hummerjohann J. Schmidt B. Kertesz M.A. von Figura K. J. Biol. Chem. 1998; 273: 25560-25564Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar, 9Selmer T. Hallmann A. Schmidt B. Sumper M. von Figura K. Eur. J. Biochem. 1996; 238: 341-345Crossref PubMed Scopus (56) Google Scholar, 10Schmidt B. Selmer T. Ingendoh A. von Figura K. Cell. 1995; 82: 271-278Abstract Full Text PDF PubMed Scopus (295) Google Scholar). The presence of the FGly in P2* could also be demonstrated by amino acid sequencing. Whereas the entire sequence of P2 could be determined (Fig.5G), almost no recovery of the residues C-terminal of position 72 (X in Fig. 5 F) was observed in the case of P2*. In addition, the signal for methionine 71 was reduced in P2*. The presence of a FGly residue is known to block Edman degradation at the position of the FGly and to reduce its efficiency in the preceding cycle (7Miech C. Dierks T. Selmer T. von Figura K. Schmidt B. J. Biol. Chem. 1998; 273: 4835-4837Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar, 8Dierks T. Miech C. Hummerjohann J. Schmidt B. Kertesz M.A. von Figura K. J. Biol. Chem. 1998; 273: 25560-25564Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar, 9Selmer T. Hallmann A. Schmidt B. Sumper M. von Figura K. Eur. J. Biochem. 1996; 238: 341-345Crossref PubMed Scopus (56) Google Scholar, 10Schmidt B. Selmer T. Ingendoh A. von Figura K. Cell. 1995; 82: 271-278Abstract Full Text PDF PubMed Scopus (295) Google Scholar). From the sequencing data (Fig. 5, F andG) the FGly content of AtsA-His6(+B) was calculated to be 48 ± 2%. Thus, the modification degree observed for the recombinant sulfatase in E. coli is similar to the degree of 60% determined previously for the protein purified fromKlebsiella (7Miech C. Dierks T. Selmer T. von Figura K. Schmidt B. J. Biol. Chem. 1998; 273: 4835-4837Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar). The present study demonstrates that the atsB gene product is required for FGly modification in the arylsulfatase ofK. pneumoniae. This modification is a prerequisite for sulfatase activity, as had been shown previously for other pro- and eukaryotic sulfatases (8Dierks T. Miech C. Hummerjohann J. Schmidt B. Kertesz M.A. von Figura K. J. Biol. Chem. 1998; 273: 25560-25564Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar, 9Selmer T. Hallmann A. Schmidt B. Sumper M. von Figura K. Eur. J. Biochem. 1996; 238: 341-345Crossref PubMed Scopus (56) Google Scholar, 10Schmidt B. Selmer T. Ingendoh A. von Figura K. Cell. 1995; 82: 271-278Abstract Full Text PDF PubMed Scopus (295) Google Scholar). In the absence of a functionalatsB gene inactive sulfatase polypeptides were synthesized lacking the FGly. In the presence of atsB, however, 48% of the recombinant sulfatase molecules, expressed in His-tagged form inE. coli, carried the FGly leading to an overall specific activity of 73 units/mg of purified protein. This approximately agrees with the modification efficiency of 60% and a specific activity of 123 units/mg determined for the wild-type protein purified from K. pneumoniae. Extrapolated to 100% FGly content, activities of 152 or 205 units/mg, respectively, are calculated for the two protein preparations. These results rule out that AtsB acts as a transcriptional activator, as had been suggested originally (19Azakami H. Sugino H. Yokoro N. Iwata N. Murooka Y. J. Bacteriol. 1993; 175: 6287-6292Crossref PubMed Google Scholar, 20Azakami H. Sugino H. Iwata N. Yokoro N. Yamashita M. Murooka Y. Gene (Amst.). 1995; 164: 89-94Crossref PubMed Scopus (8) Google Scholar). AtsB rather plays an essential role in the posttranslational oxidation of a conserved serine to FGly. The data, furthermore, show that FGly formation involves an enzyme-mediated process. This agrees with the finding that in man a genetic defect is the cause for the lack of FGly in sulfatases from multiple sulfatase deficiency patients (10Schmidt B. Selmer T. Ingendoh A. von Figura K. Cell. 1995; 82: 271-278Abstract Full Text PDF PubMed Scopus (295) Google Scholar, 13Kolodny E.H. Fluharty A.L. Scriver C.R. Beaudet A.L. Sly W.S. Valle D. The Metabolic and Molecular Bases of Inherited Disease. McGraw-Hill, New York1995: 2693-2741Google Scholar). In E. coli, absence of AtsB does not lead to a general deficiency of FGly formation. While oxidation of serine to FGly is abolished under these conditions, oxidation of cysteine in the sulfatase of P. aeruginosa occurs with maximum efficiency (8Dierks T. Miech C. Hummerjohann J. Schmidt B. Kertesz M.A. von Figura K. J. Biol. Chem. 1998; 273: 25560-25564Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar). Thus, E. coli obviously harbors a second FGly-generating system that is independent of atsB and may specifically oxidize cysteine but not serine. The latter is concluded from the observation that substitution of the critical cysteine by serine abolished FGly formation in the Pseudomonas sulfatase (8Dierks T. Miech C. Hummerjohann J. Schmidt B. Kertesz M.A. von Figura K. J. Biol. Chem. 1998; 273: 25560-25564Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar). Whether or not the Klebsiella atsB gene would promote FGly formation in this substitution mutant remains to be investigated. Modification of both serine-type and cysteine-type sulfatases most likely occurs in the cytosol, since in the former case the AtsB protein, and in the latter case the sulfatase itself, lack a signal peptide. Although no endogenous sulfatase activity has ever been measuredin E. coli, this species carries two genes encoding putative serine-type sulfatases termed aslA and f571(GenBankTM accession numbers M87049 and U00096). Like theKlebsiella atsA gene, also aslA andf571 have an adjacent gene in the same operon (aslB and f390, respectively) encoding an AtsB homolog of about 400 amino acids (25Schirmer A. Kolter R. Chem. Biol. 1998; 5: R181-R186Abstract Full Text PDF PubMed Scopus (28) Google Scholar). These homologs did not take over function in the absence of AtsB. All three AtsB homologs are 34–41% identical and represent iron sulfur proteins that comprise three conserved cysteine clusters, each consisting of 3–5 cysteines with short and conserved distances between these cysteines (25Schirmer A. Kolter R. Chem. Biol. 1998; 5: R181-R186Abstract Full Text PDF PubMed Scopus (28) Google Scholar). Most iron sulfur proteins are involved in redox reactions and function as electron transfer proteins (26Beinert H. Holm R.H. Münck E. Science. 1997; 277: 653-659Crossref PubMed Scopus (1519) Google Scholar). Therefore we speculate that also AtsB functions as an oxidoreductase oxidizing the critical serine of the unfolded sulfatase polypeptide during or shortly after synthesis and, at the same time, transferring electrons to an acceptor molecule. AtsB may act directly on the sulfatase polypeptide or may oxidize and thereby regenerate the electron acceptor. The role of AtsB homologs in sulfatase activation is highlighted by a paper reporting that Bacteroides thetaiotaomicron mutated in the atsB-related chuR gene is defective in the utilization of two sulfated substrates, namely chondroitin sulfate and heparin (27Cheng Q. Hwa V. Salyers A.A. J. Bacteriol. 1992; 174: 7185-7193Crossref PubMed Google Scholar). No chondroitin sulfatase activity was detectable in this mutant, which, however, was ascribed to transcriptional regulation of chondroitin sulfate and heparin utilizing genes by chuR. Further AtsB homologs that are similar in size, but carry only 1 or 2 cysteine clusters, can also be found among a group of proteins involved in the synthesis of cofactors such as PQQ, molybdopterin, Fe-Mo cofactor, tungsten cofactor, or heme d1 (28Goosen N. Horsman H.P. Huinen R.G. van de Putte P. J. Bacteriol. 1989; 171: 447-455Crossref PubMed Google Scholar, 29Neubauer H. Pantel I. Gotz F. FEMS Microbiol. Lett. 1998; 164: 55-62PubMed Google Scholar, 30Mulligan M.E. Haselkorn R. J. Biol. Chem. 1989; 264: 19200-19207Abstract Full Text PDF PubMed Google Scholar, 31Kletzin A. Mukund S. Kelley-Crouse T.L. Chan M.K. Rees D.C. Adams M.W. J. Bacteriol. 1995; 177: 4817-4819Crossref PubMed Google Scholar, 32Kawasaki S. Arai H. Kodama T. Igarashi Y. J. Bacteriol. 1997; 179: 235-242Crossref PubMed Google Scholar). Interestingly, one of the homologs without known function is YidF ofE. coli and is encoded in the yid operon also coding for the cysteine-type sulfatase YidJ (33Burland V. Plunkett III, G. Daniels D.L. Blattner F.R. Genomics. 1993; 16: 551-561Crossref PubMed Scopus (168) Google Scholar). YidF is a 165-amino acids protein showing 19% identity to the C-terminal half of AtsB. It may therefore be involved in FGly modification of cysteine-type sulfatases (25Schirmer A. Kolter R. Chem. Biol. 1998; 5: R181-R186Abstract Full Text PDF PubMed Scopus (28) Google Scholar). We thank Petra Schlotterhose and Katja Unthan-Hermeling for technical assistance, Klaus Neifer for peptide and DNA sequencing, and Enno Hartmann for his help in data base screening." @default.
• W2149669489 created "2016-06-24" @default.
• W2149669489 creator A5005763386 @default.
• W2149669489 creator A5012975261 @default.
• W2149669489 creator A5022708995 @default.
• W2149669489 creator A5044024390 @default.
• W2149669489 creator A5068192515 @default.
• W2149669489 creator A5088781538 @default.
• W2149669489 date "1999-05-01" @default.
• W2149669489 modified "2023-10-13" @default.
• W2149669489 title "The Iron Sulfur Protein AtsB Is Required for Posttranslational Formation of Formylglycine in the Klebsiella Sulfatase" @default.
• W2149669489 cites W1538870760 @default.
• W2149669489 cites W1547413582 @default.
• W2149669489 cites W1597907784 @default.
• W2149669489 cites W1604953446 @default.
• W2149669489 cites W1625822134 @default.
• W2149669489 cites W1775749144 @default.
• W2149669489 cites W1984296057 @default.
• W2149669489 cites W1992386239 @default.
• W2149669489 cites W2001521415 @default.
• W2149669489 cites W2009235439 @default.
• W2149669489 cites W2011655913 @default.
• W2149669489 cites W2012660345 @default.
• W2149669489 cites W2013248441 @default.
• W2149669489 cites W2017241270 @default.
• W2149669489 cites W2020547901 @default.
• W2149669489 cites W2022110979 @default.
• W2149669489 cites W2046958726 @default.
• W2149669489 cites W2077335984 @default.
• W2149669489 cites W2081474793 @default.
• W2149669489 cites W2086003789 @default.
• W2149669489 cites W2090079874 @default.
• W2149669489 cites W2097589722 @default.
• W2149669489 cites W2102410852 @default.
• W2149669489 cites W2110615865 @default.
• W2149669489 cites W2127321094 @default.
• W2149669489 cites W2143420721 @default.
• W2149669489 cites W2152707194 @default.
• W2149669489 cites W4293247451 @default.
• W2149669489 doi "https://doi.org/10.1074/jbc.274.22.15375" @default.
• W2149669489 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10336424" @default.
• W2149669489 hasPublicationYear "1999" @default.
• W2149669489 type Work @default.
• W2149669489 sameAs 2149669489 @default.
• W2149669489 citedByCount "74" @default.
• W2149669489 countsByYear W21496694892012 @default.
• W2149669489 countsByYear W21496694892013 @default.
• W2149669489 countsByYear W21496694892014 @default.
• W2149669489 countsByYear W21496694892015 @default.
• W2149669489 countsByYear W21496694892016 @default.
• W2149669489 countsByYear W21496694892018 @default.
• W2149669489 countsByYear W21496694892019 @default.
• W2149669489 countsByYear W21496694892020 @default.
• W2149669489 countsByYear W21496694892021 @default.
• W2149669489 crossrefType "journal-article" @default.
• W2149669489 hasAuthorship W2149669489A5005763386 @default.
• W2149669489 hasAuthorship W2149669489A5012975261 @default.
• W2149669489 hasAuthorship W2149669489A5022708995 @default.
• W2149669489 hasAuthorship W2149669489A5044024390 @default.
• W2149669489 hasAuthorship W2149669489A5068192515 @default.
• W2149669489 hasAuthorship W2149669489A5088781538 @default.
• W2149669489 hasBestOaLocation W21496694891 @default.
• W2149669489 hasConcept C104317684 @default.
• W2149669489 hasConcept C181199279 @default.
• W2149669489 hasConcept C185592680 @default.
• W2149669489 hasConcept C2779116282 @default.
• W2149669489 hasConcept C2780871851 @default.
• W2149669489 hasConcept C547475151 @default.
• W2149669489 hasConcept C55493867 @default.
• W2149669489 hasConceptScore W2149669489C104317684 @default.
• W2149669489 hasConceptScore W2149669489C181199279 @default.
• W2149669489 hasConceptScore W2149669489C185592680 @default.
• W2149669489 hasConceptScore W2149669489C2779116282 @default.
• W2149669489 hasConceptScore W2149669489C2780871851 @default.
• W2149669489 hasConceptScore W2149669489C547475151 @default.
• W2149669489 hasConceptScore W2149669489C55493867 @default.
• W2149669489 hasIssue "22" @default.
• W2149669489 hasLocation W21496694891 @default.
• W2149669489 hasOpenAccess W2149669489 @default.
• W2149669489 hasPrimaryLocation W21496694891 @default.
• W2149669489 hasRelatedWork W1531601525 @default.
• W2149669489 hasRelatedWork W2319480705 @default.
• W2149669489 hasRelatedWork W2384464875 @default.
• W2149669489 hasRelatedWork W2606230654 @default.
• W2149669489 hasRelatedWork W2607424097 @default.
• W2149669489 hasRelatedWork W2748952813 @default.
• W2149669489 hasRelatedWork W2899084033 @default.
• W2149669489 hasRelatedWork W2948807893 @default.
• W2149669489 hasRelatedWork W4387497383 @default.
• W2149669489 hasRelatedWork W2778153218 @default.
• W2149669489 hasVolume "274" @default.
• W2149669489 isParatext "false" @default.
• W2149669489 isRetracted "false" @default.
• W2149669489 magId "2149669489" @default.
• W2149669489 workType "article" @default.