FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2149934841> ?p ?o ?g. }

• W2149934841 endingPage "1664" @default.
• W2149934841 startingPage "1664" @default.
• W2149934841 abstract "Rice yellow mottle virus (RYMV), genus Sobemovirus, is a widespread rice pathogen reported in nearly all rice-growing countries of Africa. Although the virus was detected in Cameroon, Chad, Tanzania, Rwanda, Burundi, and Uganda (2,3), RYMV has never been described in the Democratic Republic of Congo (DRC). In July 2012, plants with leaf yellowing and mottling symptoms were observed in large irrigated rice production schemes 30 km south of Bukavu, in eastern DRC, and in lowland subsistence fields in the surroundings of Bukavu. Several dozen hectares affected by the disease were abandoned by the farmers. Symptomatic leaf samples were collected in different farmer fields. Back-inoculations to susceptible rice variety IR64 resulted in the same yellowing and mottling symptoms 7 to 9 days post-inoculation. Infected leaves gave positive results using double antibody sandwich (DAS)-ELISA tests with polyclonal antisera (as described in [1]), indicating for the first time the presence of RYMV in DRC. Triple antibody sandwich (TAS)-ELISA tests with discriminant monoclonal antibodies (1) revealed that they all belong to serotype 4 found in the neighboring region in Rwanda. Total RNA of three samples from South Kivu was extracted with the RNeasy Plant Mini kit (Qiagen, Germany). The 720 nucleotide coat protein (CP) gene was amplified by reverse transcription (RT)-PCR with primers 5′CTCCCCCACCCATCCCGAGAATT3′ and 5′CAAAGATGGCCAGGAA3′ (1). The sequences were deposited in GenBank (Accessions KC788208, KC788209, and KC788210). A set of CP sequences of 45 isolates representative of the RYMV diversity in Africa, including the sequences of the DRC samples, were used for phylogenetic reconstruction by maximum-likelihood method. The isolates from South Kivu belonged to strain S4-lv, mainly found around Lake Victoria. Specifically, within the S4-lv strain, the South Kivu isolates clustered with isolates from eastern and southern provinces of Rwanda and Burundi, respectively (2), suggesting a recent spread from these countries. Recently, efforts have been directed to shift from the traditional upland system to lowland and irrigated systems in which water availability allows sequential planting and maintenance of higher crop intensity. This agricultural change may increase insect vectors and alternate host plant populations which may result in higher RYMV incidence in DRC (3). Similar yellowing and mottling symptoms have been observed in Bas-Congo and Equateur provinces of the country, which would justify further surveys and characterisation of RYMV in the DRC. References: (1) D. Fargette et al. Arch. Virol. 147:583, 2002. (2) I. Ndikumana et al. Plant Dis. 96:1230, 2012. (3) O. Traoré et al. Mol. Ecol. 14:2097, 2005." @default.
• W2149934841 created "2016-06-24" @default.
• W2149934841 creator A5001004341 @default.
• W2149934841 creator A5012674075 @default.
• W2149934841 creator A5019339707 @default.
• W2149934841 creator A5032140282 @default.
• W2149934841 creator A5033072577 @default.
• W2149934841 creator A5058638753 @default.
• W2149934841 creator A5067174891 @default.
• W2149934841 creator A5075990800 @default.
• W2149934841 creator A5084864330 @default.
• W2149934841 date "2013-12-01" @default.
• W2149934841 modified "2023-10-12" @default.
• W2149934841 title "First Report of <i>Rice yellow mottle virus</i> on Rice in the Democratic Republic of Congo" @default.
• W2149934841 doi "https://doi.org/10.1094/pdis-06-13-0650-pdn" @default.
• W2149934841 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/30716857" @default.
• W2149934841 hasPublicationYear "2013" @default.
• W2149934841 type Work @default.
• W2149934841 sameAs 2149934841 @default.
• W2149934841 citedByCount "11" @default.
• W2149934841 countsByYear W21499348412015 @default.
• W2149934841 countsByYear W21499348412017 @default.
• W2149934841 countsByYear W21499348412019 @default.
• W2149934841 countsByYear W21499348412021 @default.
• W2149934841 countsByYear W21499348412022 @default.
• W2149934841 crossrefType "journal-article" @default.
• W2149934841 hasAuthorship W2149934841A5001004341 @default.
• W2149934841 hasAuthorship W2149934841A5012674075 @default.
• W2149934841 hasAuthorship W2149934841A5019339707 @default.
• W2149934841 hasAuthorship W2149934841A5032140282 @default.
• W2149934841 hasAuthorship W2149934841A5033072577 @default.
• W2149934841 hasAuthorship W2149934841A5058638753 @default.
• W2149934841 hasAuthorship W2149934841A5067174891 @default.
• W2149934841 hasAuthorship W2149934841A5075990800 @default.
• W2149934841 hasAuthorship W2149934841A5084864330 @default.
• W2149934841 hasBestOaLocation W21499348411 @default.
• W2149934841 hasConcept C109110057 @default.
• W2149934841 hasConcept C144027150 @default.
• W2149934841 hasConcept C159047783 @default.
• W2149934841 hasConcept C180032290 @default.
• W2149934841 hasConcept C2522874641 @default.
• W2149934841 hasConcept C42972112 @default.
• W2149934841 hasConcept C71924100 @default.
• W2149934841 hasConcept C86803240 @default.
• W2149934841 hasConceptScore W2149934841C109110057 @default.
• W2149934841 hasConceptScore W2149934841C144027150 @default.
• W2149934841 hasConceptScore W2149934841C159047783 @default.
• W2149934841 hasConceptScore W2149934841C180032290 @default.
• W2149934841 hasConceptScore W2149934841C2522874641 @default.
• W2149934841 hasConceptScore W2149934841C42972112 @default.
• W2149934841 hasConceptScore W2149934841C71924100 @default.
• W2149934841 hasConceptScore W2149934841C86803240 @default.
• W2149934841 hasIssue "12" @default.
• W2149934841 hasLocation W21499348411 @default.
• W2149934841 hasLocation W21499348412 @default.
• W2149934841 hasLocation W21499348413 @default.
• W2149934841 hasLocation W21499348414 @default.
• W2149934841 hasOpenAccess W2149934841 @default.
• W2149934841 hasPrimaryLocation W21499348411 @default.
• W2149934841 hasRelatedWork W1966760406 @default.
• W2149934841 hasRelatedWork W2016551366 @default.
• W2149934841 hasRelatedWork W2020266122 @default.
• W2149934841 hasRelatedWork W2027781036 @default.
• W2149934841 hasRelatedWork W2054377249 @default.
• W2149934841 hasRelatedWork W2070480238 @default.
• W2149934841 hasRelatedWork W2125155197 @default.
• W2149934841 hasRelatedWork W2155778121 @default.
• W2149934841 hasRelatedWork W2268109705 @default.
• W2149934841 hasRelatedWork W2401785340 @default.
• W2149934841 hasVolume "97" @default.
• W2149934841 isParatext "false" @default.
• W2149934841 isRetracted "false" @default.
• W2149934841 magId "2149934841" @default.
• W2149934841 workType "article" @default.