FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2152697044> ?p ?o ?g. }

• W2152697044 endingPage "3820" @default.
• W2152697044 startingPage "3810" @default.
• W2152697044 abstract "Mammalian CNS contains a disproportionally large and remarkably stable pool of cholesterol. Despite an efficient recycling there is some requirement for elimination of brain cholesterol. Conversion of cholesterol into 24S-hydroxycholesterol by the cholesterol 24-hydroxylase (CYP46A1) is the quantitatively most important mechanism. Based on the protein expression and plasma levels of 24S-hydroxycholesterol, CYP46A1 activity appears to be highly stable in adults. Here we have made a structural and functional characterization of the promoter of the human CYP46A1 gene. No canonical TATA or CAAT boxes were found in the promoter region. Moreover this region had a high GC content, a feature often found in genes considered to have a largely housekeeping function. A broad spectrum of regulatory axes using a variety of promoter constructs did not result in a significant transcriptional regulation. Oxidative stress caused a significant increase in transcriptional activity. The possibility of a substrate-dependent transcriptional regulation was explored in vivo in a sterol-deficient mouse model (Dhcr24 null) in which almost all cholesterol had been replaced with desmosterol, which is not a substrate for CYP46A1. Compared with heterozygous littermates there was no statistically significant difference in the mRNA levels of Cyp46a1. During the first 2 weeks of life in the wild-type mouse, however, a significant increase of Cyp46a1 mRNA levels was found, in parallel with an increase in 24S-hydroxycholesterol level and a reduction of cholesterol synthesis. The failure to demonstrate a significant transcriptional regulation under most conditions is discussed in relation to the turnover of brain and neuronal cholesterol. Mammalian CNS contains a disproportionally large and remarkably stable pool of cholesterol. Despite an efficient recycling there is some requirement for elimination of brain cholesterol. Conversion of cholesterol into 24S-hydroxycholesterol by the cholesterol 24-hydroxylase (CYP46A1) is the quantitatively most important mechanism. Based on the protein expression and plasma levels of 24S-hydroxycholesterol, CYP46A1 activity appears to be highly stable in adults. Here we have made a structural and functional characterization of the promoter of the human CYP46A1 gene. No canonical TATA or CAAT boxes were found in the promoter region. Moreover this region had a high GC content, a feature often found in genes considered to have a largely housekeeping function. A broad spectrum of regulatory axes using a variety of promoter constructs did not result in a significant transcriptional regulation. Oxidative stress caused a significant increase in transcriptional activity. The possibility of a substrate-dependent transcriptional regulation was explored in vivo in a sterol-deficient mouse model (Dhcr24 null) in which almost all cholesterol had been replaced with desmosterol, which is not a substrate for CYP46A1. Compared with heterozygous littermates there was no statistically significant difference in the mRNA levels of Cyp46a1. During the first 2 weeks of life in the wild-type mouse, however, a significant increase of Cyp46a1 mRNA levels was found, in parallel with an increase in 24S-hydroxycholesterol level and a reduction of cholesterol synthesis. The failure to demonstrate a significant transcriptional regulation under most conditions is discussed in relation to the turnover of brain and neuronal cholesterol. Although the brain is the most cholesterol-rich organ in the body, relatively little is known about the mechanisms by which it maintains steady-state cholesterol levels (1.Dietschy J.M. Turley S.D. J. Lipid Res. 2004; 45: 1375-1397Abstract Full Text Full Text PDF PubMed Scopus (776) Google Scholar, 2.Björkhem I. Meaney S. Arterioscler. Thromb. Vasc. Biol. 2004; 24: 806-815Crossref PubMed Scopus (726) Google Scholar). This is in marked contrast to the situation in virtually every other tissue or organ. One finding that has been consistently confirmed is that, due to the efficiency of the blood-brain barrier, the brain is unable to take up cholesterol from the circulation and relies on de novo synthesis to meet its substantial cholesterol requirements. However, the rate of cholesterol synthesis in the adult brain is very low, and the bulk of brain cholesterol has a half-life that is at least 100 times longer than that of cholesterol in most other organs (3.Dietschy J.M. Turley S.D. Curr. Opin. Lipidol. 2001; 12: 105-112Crossref PubMed Scopus (733) Google Scholar). One consequence of this “uncoupling” of brain and whole body cholesterol homeostasis has been the evolution of specific mechanisms for maintenance of cerebral cholesterol levels. Two mechanisms for removal of brain cholesterol are currently recognized (1.Dietschy J.M. Turley S.D. J. Lipid Res. 2004; 45: 1375-1397Abstract Full Text Full Text PDF PubMed Scopus (776) Google Scholar). The first is analogous to classic “reverse cholesterol transport” and is mediated by a flux of cholesterol present in apolipoprotein E containing lipoproteins through cerebrospinal fluid into the circulation (4.Pitas R.E. Boyles J.K. Lee S.H. Hui D. Weisgraber K.H. J. Biol. Chem. 1987; 262: 14352-14360Abstract Full Text PDF PubMed Google Scholar, 5.Pitas R.E. Boyles J.K. Lee S.H. Foss D. Mahley R.W. Biochim. Biophys. Acta. 1987; 917: 148-161Crossref PubMed Scopus (574) Google Scholar). In adults, this mechanism is believed to be responsible for elimination of 1–2 mg of cholesterol per 24 h. The details of this particular mechanism for sterol transport are, however, not known. More recently we described a second mechanism for the elimination of brain cholesterol conversion into 24S-hydroxycholesterol (24S-OH), 3The abbreviations used are: 24S-OH, 24S-hydroxycholesterol; CYP46A1, cholesterol 24-hydroxylase; MOPS, 4-morpholinepropanesulfonic acid; RACE, rapid amplification of cDNA ends; HMG-CoA, 3-hydroxy-3-methylglutaryl-coenzyme A reductase; EST, expressed sequence tag; PPAR, peroxisome proliferator-activated receptor. a more polar sterol that can traverse the blood-brain barrier, enter the circulation, and travel to the liver (6.Björkhem I. Lütjohann D. Diczfalusy U. Ståhle L. Ahlborg G. Wahren J. J. Lipid Res. 1998; 39: 1594-1600Abstract Full Text Full Text PDF PubMed Google Scholar, 7.Lütjohann D. Breuer O. Ahlborg G. Nennesmo I. Sidén Å. Diczfalusy U. Björkhem I. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9799-9804Crossref PubMed Scopus (569) Google Scholar). In the liver it may be converted into bile acids or excreted as a sulfated and/or glucuronidated metabolite (8.Björkhem I. Andersson U. Ellis E. Alvelius G. Ellegård L. Diczfalusy U. Sjövall J. Einarsson C. J. Biol. Chem. 2001; 276: 37004-37010Abstract Full Text Full Text PDF PubMed Scopus (106) Google Scholar). This efflux of 24S-OH is believed to be the main mechanism by which the brain facilitates the removal of cholesterol, and, in humans, accounts for the removal of 5–7 mg of cholesterol each day (6.Björkhem I. Lütjohann D. Diczfalusy U. Ståhle L. Ahlborg G. Wahren J. J. Lipid Res. 1998; 39: 1594-1600Abstract Full Text Full Text PDF PubMed Google Scholar). The cytochrome P-450 species responsible for 24S-hydroxylation of cholesterol, cholesterol 24-hydroxylase (CYP46A1), has been characterized at the molecular level (9.Lund E.G. Guileyardo J.M. Russell D.W. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 7238-7243Crossref PubMed Scopus (528) Google Scholar, 10.Mast N. Norcross R. Andersson U. Shou M. Nakayama K. Björkhem I. Pikuleva I.A. Biochemistry. 2003; 42: 14284-14292Crossref PubMed Scopus (105) Google Scholar). In normal brain it has been demonstrated to be almost exclusively located in central nervous system neurons (9.Lund E.G. Guileyardo J.M. Russell D.W. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 7238-7243Crossref PubMed Scopus (528) Google Scholar, 11.Bogdanovic N. Bretillon L. Lund E.G. Diczfalusy U. Lannfelt L. Winblad B. Russell D.W. Björkhem I. Neurosci. Lett. 2001; 314: 45-48Crossref PubMed Scopus (157) Google Scholar, 12.Brown 3rd, J. Theisler C. Silberman S. Magnuson D. Gottardi-Littell N. Lee J.M. Yager D. Crowley J. Sambamurti K. Rahman M.M. Reiss A.B. Eckman C.B. Wolozin B. J. Biol. Chem. 2004; 279: 34674-34681Abstract Full Text Full Text PDF PubMed Scopus (223) Google Scholar). In addition to these mechanisms there is some experimental evidence for a third mechanism for removal of cholesterol from the brain (13.Xie C. Lund E.G. Turley S.D. Russell D.W. Dietschy J.M. J. Lipid Res. 2003; 44: 1780-1789Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar). It was recently shown that a disruption of the Cyp46a1 gene in mice leads to a reduction in the net sterol flux from the brain by ∼65%, with a parallel decrease in the rate of brain cholesterol synthesis by ∼50%, without alteration of the total brain cholesterol levels (13.Xie C. Lund E.G. Turley S.D. Russell D.W. Dietschy J.M. J. Lipid Res. 2003; 44: 1780-1789Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar, 14.Lund E.G. Xie C. Kotti T. Turley S.D. Dietschy J.M. Russell D.W. J. Biol. Chem. 2003; 278: 22980-22988Abstract Full Text Full Text PDF PubMed Scopus (313) Google Scholar). These mice did not have an obvious phenotype and were biochemically indistinguishable from wild-type littermates. One possible mechanism for elimination of brain cholesterol involves conversion of cholesterol into 27-hydroxycholesterol by sterol 27-hydroxylase, which is similar to 24S-OH in that it is capable of traversing lipophilic membranes (15.Meaney S. Bodin K. Diczfalusy U. Björkhem I. J. Lipid Res. 2002; 43: 2130-2135Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar). Because we have been unable to demonstrate a net flux of 27-hydroxycholesterol from the human brain into the circulation (7.Lütjohann D. Breuer O. Ahlborg G. Nennesmo I. Sidén Å. Diczfalusy U. Björkhem I. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9799-9804Crossref PubMed Scopus (569) Google Scholar), this mechanism is probably less important from a quantitative point of view. However, because 27-hydroxycholesterol may be metabolized to more polar products in the brain (16.Zhang J. Akwa Y. el-Etr M. Baulieu E.E. Sjövall J. Biochem. J. 1997; 322: 175-184Crossref PubMed Scopus (68) Google Scholar), we cannot yet exclude the possibility that there may be a net flux of a metabolite of 27-hydroxycholesterol from the brain. The human CYP46A1 enzyme has been characterized in some detail with respect to substrate specificity and enzymatic properties (10.Mast N. Norcross R. Andersson U. Shou M. Nakayama K. Björkhem I. Pikuleva I.A. Biochemistry. 2003; 42: 14284-14292Crossref PubMed Scopus (105) Google Scholar). At present, however, there are very few data on the regulation of this enzyme. Studies performed when the CYP46A1 was originally cloned demonstrated a significant increase in the expression of the CYP46A1 protein in the brain shortly after birth (9.Lund E.G. Guileyardo J.M. Russell D.W. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 7238-7243Crossref PubMed Scopus (528) Google Scholar). Regulated spatiotemporal expression was observed in the Cyp46a1(–/–) mouse, which incorporated a β-galactosidase gene under the control of the endogenous transcriptional regulatory sequences in the Cyp46a1 gene (14.Lund E.G. Xie C. Kotti T. Turley S.D. Dietschy J.M. Russell D.W. J. Biol. Chem. 2003; 278: 22980-22988Abstract Full Text Full Text PDF PubMed Scopus (313) Google Scholar). In accordance with these reports, the levels of 24S-hydroxycholesterol in the circulation are markedly increased during the first months of human life (17.Lütjohann D. Björkhem I. Locatelli S. Dame C. Schmolling J. von Bergmann K. Fahnenstich H. Acta Paediatr. 2001; 90: 652-657Crossref PubMed Google Scholar). However, at the age of ∼1 year in humans (and 2–4 weeks in mouse) expression levels of the enzyme reach a steady state, which is maintained during adulthood (9.Lund E.G. Guileyardo J.M. Russell D.W. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 7238-7243Crossref PubMed Scopus (528) Google Scholar). In accordance with this, the levels of 24S-hydroxycholesterol are remarkably stable during human adulthood (7.Lütjohann D. Breuer O. Ahlborg G. Nennesmo I. Sidén Å. Diczfalusy U. Björkhem I. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9799-9804Crossref PubMed Scopus (569) Google Scholar, 18.Bretillon L. Lütjohann D. Ståhle L. Widhe T. Bindl L. Eggertsen G. Diczfalusy U. Björkhem I. J. Lipid Res. 2000; 41: 840-845Abstract Full Text Full Text PDF PubMed Google Scholar). There is, however, some evidence that the expression of CYP46A1 may be affected in the brain of patients with neurodegenerative conditions such as Alzheimer disease, where the gene displays an ectopic expression pattern. Although predominately confined to neurons in the healthy brain, CYP46A1 immunoreactivity has been detected in astrocytes of brain tissues from Alzheimer disease patients (11.Bogdanovic N. Bretillon L. Lund E.G. Diczfalusy U. Lannfelt L. Winblad B. Russell D.W. Björkhem I. Neurosci. Lett. 2001; 314: 45-48Crossref PubMed Scopus (157) Google Scholar, 12.Brown 3rd, J. Theisler C. Silberman S. Magnuson D. Gottardi-Littell N. Lee J.M. Yager D. Crowley J. Sambamurti K. Rahman M.M. Reiss A.B. Eckman C.B. Wolozin B. J. Biol. Chem. 2004; 279: 34674-34681Abstract Full Text Full Text PDF PubMed Scopus (223) Google Scholar). With the exception of some limited studies exploring the liver-X-receptor axis (19.Whitney K.D. Watson M.A. Collins J.L. Benson W.G. Stone T.M. Numerick M.J. Tippin T.K. Wilson J.G. Winegar D.A. Kliewer S.A. Mol. Endocrinol. 2002; 16: 1378-1385Crossref PubMed Scopus (151) Google Scholar), no data have been presented on the regulation of CYP46A1 by nuclear receptors or hormones. The present study was initiated to define the basal characteristics of the human promoter of CYP46A1 and to investigate if different endogenous or exogenous compounds are able to significantly alter the transcriptional activity. Because the activity of this enzyme is likely to be of importance for cerebral cholesterol homeostasis, it was regarded to be of interest to study if there is a change in the expression of Cyp46A1 during the neonatal phase, in parallel with a rapid expansion of the cholesterol pool in the brain and also in a mouse model with markedly reduced levels of brain cholesterol. Materials—The GeneAmp High Fidelity PCR System is a product of Applied Biosystems (Foster City, CA). A TA Cloning kit was purchased from Invitrogen. TransFast™ Transfection Reagent, Dual-Glo™ Luciferase Assay System, pGL3-Basic vector, and phRL-TK vector were from Promega (Madison, WI). Human Brain RACE-ready cDNA was from Ambion (Cambridgeshire, UK). SH-SY5Y, HepG2, and HEK293 cell lines were from ATCC (Manassas, VA). Oligonucleotides for PCR and sequence analyses were obtained from Cyber Gene (Stockholm). All other chemicals were of the highest grade commercially available. Mouse with a Cholesterol Deficiency—Mice with an inactive Dhcr24 gene were generated and maintained as described in detail before (20.Wechsler A. Brafman A. Shafir M. Heverin M. Gottlieb H. Damari G. Gozlan-Kelner S. Spivak I. Moshkin O. Fridman E. Becker Y. Skaliter R. Einat P. Faerman A. Björkhem I. Feinstein E. Science. 2003; 302: 2087Crossref PubMed Scopus (156) Google Scholar). Following the suckling period, the animals were provided with a commercial rodent diet (Harlan Teklad Rat/Mouse Diet) ad libitum. Sterol Analysis—Sterol concentrations were determined in the brain of 3-month-old mice as previously described (20.Wechsler A. Brafman A. Shafir M. Heverin M. Gottlieb H. Damari G. Gozlan-Kelner S. Spivak I. Moshkin O. Fridman E. Becker Y. Skaliter R. Einat P. Faerman A. Björkhem I. Feinstein E. Science. 2003; 302: 2087Crossref PubMed Scopus (156) Google Scholar, 21.Heverin M. Bogdanovic N. Lütjohann D. Bayer T. Pikuleva I. Bretillon L. Diczfalusy U. Winblad B. Björkhem I. J. Lipid Res. 2004; 45: 186-193Abstract Full Text Full Text PDF PubMed Scopus (248) Google Scholar). Briefly, the brain tissue was snap-frozen in liquid nitrogen and pulverized mechanically prior to extraction with chloroform/methanol (2:1; v/v). Butylated hydroxytoluene (0.5 μg/mg tissue) was added at the time of extraction. To detect both free and esterified sterols a hydrolysis step was included in all cases. Cholesterol and desmosterol were analyzed by isotope dilution mass spectrometry using [2H6]cholesterol as internal standard, whereas the concentration of lathosterol was analyzed by use of [2H3]lathosterol (25.Sambrook J. Russell D.W. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, 2001Google Scholar). The following ions were monitored: [2H6]cholesterol, m/z 464; cholesterol, m/z 458; and desmosterol, m/z 456. Oxysterols in brain were determined by isotope dilution-mass spectrometry, essentially as described previously (21.Heverin M. Bogdanovic N. Lütjohann D. Bayer T. Pikuleva I. Bretillon L. Diczfalusy U. Winblad B. Björkhem I. J. Lipid Res. 2004; 45: 186-193Abstract Full Text Full Text PDF PubMed Scopus (248) Google Scholar). Quantification of mRNA Levels by Real-time PCR—Total RNA was prepared from the brains of the wild-type and knock-out mice with the Quick Prep™ Total RNA Extraction kit (Amersham Biosciences), DNase-treated using an RNeasy Protect Mini Kit (Qiagen Gmbh, Hilden, Germany), and quality-checked on a 2.2 m formaldehyde/MOPS 1.2% agarose gel. A maximum of 10 μg was reverse transcribed into cDNA with the SuperScript III RNase H′Reverse Transcriptase (Invitrogen). PCR amplification was performed in triplicate using 5 μl of a 1:10 dilution of each cDNA preparation (25 μl/well) according to the manufacturer's recommendations. The primers used for the real-time PCR analysis are shown in Table 1. The specificity of the reaction was confirmed by sequencing the PCR product. A final concentration of 250 nm of probes and 900 nm of primers was used for all fluorescence probe assays, whereas in SYBR Green assays a final concentration of 200 nm of primers was used. For all SYBR Green assays a melting curve was obtained to confirm that the signal corresponded to a unique amplification. The relative amount of target mRNA was quantified by singleplex real-time RT-PCR analysis using an ABI PRISMR 7000 Sequence Detection System, with hypoxanthine guanine phosphoribosyl transferase as the internal standard in all cases. Relative mRNA levels were calculated according to the comparative threshold cycle (ΔΔCT) method according to the manufacturer's instructions with all comparisons performed relative to the situation in the adult brain.TABLE 1Oligodeoxyribonucleotide primers used for quantitative real-time PCR analysisGeneForward (5′-3′)Reverse (5′-3′)ProbeApolipoprotein EGCAGGCGGAGCTCTTCCACCACTGGCGATGCATGTCSyBR GreenSREBP-1cGGAGCCATGGATTGCACATTGGCCCGGGAAGTCACTGTSyBR GreenCYP46TGTCATCGCTGGCTTTTCAGGACGATGGTAGTTGTGGTGATAGCTa5′-Blue 6-carboxyfluorescein.GGTGGGCCCTGCCTGACTCCb3′-4-(4′-dimethylaminophenenylazo)benzoic acid.HMG-CoA reductaseCCGGCAACAACAAGATCTGTGATGTACAGGATGGCGATGCATa5′-Blue 6-carboxyfluorescein.GTCGCTGCTCAGCACGTCCTCTTcTetramethylrhodamine.HMG-CoA synthaseCTCTGTCTATGGTTCCCTGGCTTCCAATCCTCTTCCCTGCCTa5′-Blue 6-carboxyfluorescein.GTCCTGGCACAGTACTCACCTCAGCAb3′-4-(4′-dimethylaminophenenylazo)benzoic acid.HPRTdHypoxanthine phosphoribosyltransferase.GGTGAAAAGGACCTCTCGAAGTGATAGTCAAGGGCATATCCAACAACACa5′-Blue 6-carboxyfluorescein.CAGACTTTGTTGGATTTGAAATTCCAGACAAb3′-4-(4′-dimethylaminophenenylazo)benzoic acid.a 5′-Blue 6-carboxyfluorescein.b 3′-4-(4′-dimethylaminophenenylazo)benzoic acid.c Tetramethylrhodamine.d Hypoxanthine phosphoribosyltransferase. Open table in a new tab Comparative Genomic Analysis—Genomic regions of the human, chimpanzee, rhesus macaque, dog, cow, mouse, and rat cholesterol 24-hydroxylase genes were analyzed by orthologous sequence comparison to localize conserved non-coding regions, i.e. potential regulatory regions. The default conservation settings of the MULAN and VISTA software (available online at www.dcode.org and gsd.lbl.gov/vista/index.shtml, respectively) were used to examine the regions of interest (22.Couronne O. Poliakov A. Bray N. Ishkhanov T. Ryaboy D. Rubin E. Pachter L. Dubchak I. Genome Res. 2003; 13: 73-80Crossref PubMed Scopus (183) Google Scholar). Selected sequences were further analyzed for the presence of putative regulatory elements (23.Loots G.G. Ovcharenko I. Nucleic Acids Res. 2004; 32: W217-W221Crossref PubMed Scopus (349) Google Scholar) or promoter modules (24.Werner T. Mamm. Genome. 1999; 10: 168-175Crossref PubMed Scopus (137) Google Scholar) using regulatory VISTA (rVISTA, URL as above) and Frame Worker (www.genomatix.de), respectively. Analysis of Transcriptional Start Site—Human brain FirstChoice RACE-ready cDNA (Ambion), which is a library of brain cDNA with complete 5′-ends, was used for amplification of the 5′-end of CYP46 cDNA in two separate RACE experiments. Each experiment used a different combination of primer sets as per the manufacturer's instructions. One RACE experiment was done with the outer primer supplied by the manufacturer and primer R15 (for primers sequences, see Table 2), with a subsequent nested PCR using the kit inner primer and primer R11. The second experiment was conducted with the outer primer and primer R14, followed by the inner primer and reverse primer. A typical PCR reaction consisted of denaturation at 94 °C for 3 min, followed by 30 cycles of denaturation at (94 °C, 15 s), annealing (58 °C, 30 s), and extension (72 °C, 1 min), with a final extension (72 °C, 7 min) using GeneAmp High Fidelity PCR System supplemented with 5% Me2SO in the reaction buffer. The PCR products were resolved by agarose gel electrophoresis and recovered using a GenElute Agarose Spin Column. The DNA fragments were cloned into pCR 2.1 by T/A cloning and transformed into Escherichia coli, TOP10F'. A total of 32 clones were randomly selected from the two RACE experiments and the insert DNA were sequenced as described above.TABLE 2Sequences of oligonucleotide primers used in this studyNameSequence (5′ to 3′)PositionUsageF2gcagtctcccaacagatggaaac-2713aPosition indicates the distance of the 5′-end of the indicated primer from the translation start site (where + 1 refers A of ATG).CloningR11ggatgtgctagcggctg+100bThe location of the 5′-end of the primer.Cloning, RACER15cctccaacataagtttcactgc+661bThe location of the 5′-end of the primer.RACER14accgactcaggactcgtgacg+278bThe location of the 5′-end of the primer.RACERevgcacgaaggtgcagcagaggc+70bThe location of the 5′-end of the primer.RACEPA-F2actcgagtctcccaacagatggaaac-2711aPosition indicates the distance of the 5′-end of the indicated primer from the translation start site (where + 1 refers A of ATG).pGL3PA-1aggctcgagtagagatggggtttctccgtg-2102aPosition indicates the distance of the 5′-end of the indicated primer from the translation start site (where + 1 refers A of ATG).pGL3PA-F11ctcgagccctggtcattatttc-988aPosition indicates the distance of the 5′-end of the indicated primer from the translation start site (where + 1 refers A of ATG).pGL3PA-F12ctcgagatgccgttatttggagg-501aPosition indicates the distance of the 5′-end of the indicated primer from the translation start site (where + 1 refers A of ATG).pGL3PA-Rtaagcttagccgactcagctgtcag-65aPosition indicates the distance of the 5′-end of the indicated primer from the translation start site (where + 1 refers A of ATG).pGL3EXP-Fctagaagccaaggcagatgg+502bThe location of the 5′-end of the primer.Reverse transcription-PCREXP-Rctcgtgaccagcaatgaaga+915bThe location of the 5′-end of the primer.Reverse transcription-PCRa Position indicates the distance of the 5′-end of the indicated primer from the translation start site (where + 1 refers A of ATG).b The location of the 5′-end of the primer. Open table in a new tab Cloning of 5′-Upstream Region of Human CYP46 Gene—Standard methods for molecular biology were as described by Sambrook et al. (25.Sambrook J. Russell D.W. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, 2001Google Scholar). The promoter region of human CYP46 gene was cloned from human genomic DNA (Applied Biosystems) using GeneAmp High Fidelity PCR System supplemented with 5% Me2SO in the reaction buffer. An initial denaturation at 94 °C for 3 min was followed by 35 cycles of denaturing (94 °C, 15 s), annealing (53 °C, 30 s), and extension (68 °C, 3 min). A final extension at 72 °C, 7 min was applied to ensure the introduction of A overhangs. A primer pair consisting of F2a and R11 (Table 2) was designed to amplify the region between –2713 and + 100 nucleotides of human CYP46 gene (GenBank™ accession number, AL160313; +1 refers to A of the initiating methionine). The amplified fragment was separated on an agarose gel, recovered using GenElute-Agarose Spin Column (Sigma) and subsequently cloned into pCR2.1 via T/A cloning. Nucleotide sequence of insert DNA was determined using a DYEnamic ET Terminator Cycle Sequencing Kit (Amersham Biosciences). The plasmid harboring a region between –2713 and + 100 nucleotides of the human CYP46 gene was designated p10–12. Expression of CYP46A1—Total RNA was extracted from cells using TRIzol (Invitrogen) according to the manufacturer's guidelines. RT-PCR was performed on 1 μg of total RNA using the One Step RNA PCR kit (Takara Bio Inc.) and the primers EXP-F and EXP-R. Human fetal and adult brain total RNA were included as a positive control. Reaction conditions were as follows: 52 °C for 30 min, 94 °C for 2 min, followed by 35 cycles of denaturation at (94 °C, 30 s), annealing (53.8 °C, 1 min), and extension (72 °C, 1 min), with a final extension (72 °C, 10 min). Cell Culture—SH-SY5Y (a human neuroblastoma cell line derived from metastatic bone marrow) and HEK293 cells (transformed human embryonic kidney cells) were routinely cultured in minimal essential medium (Sigma) supplemented with 10% fetal calf serum, 2 mm l-glutamine, 1× non-essential amino acid mix (Sigma), 100 units/ml penicillin, and 100 μg/ml streptomycin. HepG2 cells (human hepatocellular carcinoma) were maintained in Dulbecco's modified Eagle's medium (Sigma) supplemented with 10% fetal calf serum, 2 mm l-glutamine, 100 units/ml penicillin, and 100 μg/ml streptomycin. The cells were grown at 37 °C in a humidified atmosphere of 5% CO2. Construction of Luciferase Vectors—Four fragments of the 5′-upstream region of the human CYP46 gene were amplified with upstream primers (see Table 2) containing an overhanging XhoI site (PA-F2a, PA-1, F11, and F12) and downstream primer overhanging HindIII site (PA-R) using the plasmid p10–12 as a template. PCR conditions were essentially as described above. The amplified fragments were subcloned into pCR 2.1, sequence-verified, and recloned into the XhoI and HindIII site of pGL3-basic vector (Promega). These plasmids were named pG-2700 (5′-end, –2711 bp), pG-2100 (–2102 bp), pG-1000 (–988 bp), and pG-500 (–510 bp), according to the positions 5′-end from the translation start site. pG-1300 (–1280 bp) was created by digestion of the pG-2700 with KpnI, followed by self-ligation of the fragment containing vector, because pG-2700 has two KpnI sites at –1280 bp and upstream of the introduced XhoI site in the multiple cloning site of the vector. Similarly, digestion and self-ligation for pG-1000 with SmaI produced pG-650 (–659 bp). MluI and SacI digestion and self-ligation for pGL-500 were used to create pGL-400 (–410 bp) and pGL-250 (–258 bp), respectively. All reporter constructs shared a common 3′-end 65 bp upstream of translation start site. A schematic drawing of the reporter constructs is shown in Fig. 7. Transfection and Luciferase Assay—Plasmids for transfection were prepared using a plasmid purification kit (Qiagen). Luciferase assay was performed using a Dual-Glo luciferase assay system (Promega) with phRL-TK vector as an internal control for normalization of transfection efficiency. Transfection experiments were performed in 96-well culture plates, and luciferase activities were measured using a Victor 1420 Multilabel counter (Wallac). Briefly, 1 day before transfection, recipient cells were seeded into 96-well plates at a density of 2–6 × 104 cells/well. After removal of culture medium, the cells were cotransfected with 100 ng of reporter construct DNA and 20 ng of control plasmid (phRL-TK) per well using TransFast reagent according to the manufacturer's recommendations. Three hours later, 200 μl of medium (or medium containing a test agent) was added to each well, and the cells were incubated for an additional 48 h. Luciferase activities were measured by the Dual-Glo luciferase assay system according to the manufacturer's instructions. Firefly luciferase activity was normalized to Renilla luciferase activity. In the experiments testing effects of oxidative stress, the cells were transfected with use of 15 μl of Lipofectin (Invitrogen), 2.5 μgof pGL3 Enhancer plasmid, and 1 μg of phRL-TK vector. The cells were incubated in serum-free media at 37 °C for 3–5 h. The following agents were tested: 22R-hydroxycholesterol (1 and 10 μg/ml), 25-hydroxycholesterol (1 and 10 μg/ml), 24S-hydroxycholesterol (1 and 10 μg/ml), cholesterol (10 and 50 μg/ml), pravastatin (1 μg/ml), testosterone (100 nm), dexamethasone (100 nm), estradiol (100 nm), WY-14643 (50 nm), growth hormone (500 ng/ml), cortisol (1.4 μm), triiodothyronine (2.5 μm), insulin (0.1 IU/ml), rifampicin (12.4 nm), progesterone (0.1 μm), dibutyryl cyclic AMP (0.2 mm), lithocholic acid (25 μm), interleukin-6 (50 pg/ml), chenodeoxycholic acid (25 μm), and tert-butylhydroperoxide (0.05–5 μm). Final concentrations are shown in parentheses after the compound. Changes in B" @default.
• W2152697044 created "2016-06-24" @default.
• W2152697044 creator A5005756896 @default.
• W2152697044 creator A5007872813 @default.
• W2152697044 creator A5036246480 @default.
• W2152697044 creator A5040863697 @default.
• W2152697044 creator A5053216955 @default.
• W2152697044 creator A5053228763 @default.
• W2152697044 creator A5057009246 @default.
• W2152697044 creator A5067258591 @default.
• W2152697044 creator A5072704585 @default.
• W2152697044 creator A5073617826 @default.
• W2152697044 creator A5082393804 @default.
• W2152697044 creator A5089327305 @default.
• W2152697044 date "2006-02-01" @default.
• W2152697044 modified "2023-10-17" @default.
• W2152697044 title "Studies on the Transcriptional Regulation of Cholesterol 24-Hydroxylase (CYP46A1)" @default.
• W2152697044 cites W1608575213 @default.
• W2152697044 cites W1767847062 @default.
• W2152697044 cites W1831733740 @default.
• W2152697044 cites W1963021413 @default.
• W2152697044 cites W1966485745 @default.
• W2152697044 cites W1972073890 @default.
• W2152697044 cites W1981800986 @default.
• W2152697044 cites W1982493902 @default.
• W2152697044 cites W1988981743 @default.
• W2152697044 cites W2000339918 @default.
• W2152697044 cites W2002793897 @default.
• W2152697044 cites W2003742510 @default.
• W2152697044 cites W2003877984 @default.
• W2152697044 cites W2004232360 @default.
• W2152697044 cites W2007202486 @default.
• W2152697044 cites W2007960303 @default.
• W2152697044 cites W2010508749 @default.
• W2152697044 cites W2011240362 @default.
• W2152697044 cites W2012523495 @default.
• W2152697044 cites W2012781668 @default.
• W2152697044 cites W2013889250 @default.
• W2152697044 cites W2017274978 @default.
• W2152697044 cites W2022460223 @default.
• W2152697044 cites W2025792182 @default.
• W2152697044 cites W2028195118 @default.
• W2152697044 cites W2030269791 @default.
• W2152697044 cites W2038605859 @default.
• W2152697044 cites W2048958063 @default.
• W2152697044 cites W2057365200 @default.
• W2152697044 cites W2067064610 @default.
• W2152697044 cites W2081722421 @default.
• W2152697044 cites W2081998909 @default.
• W2152697044 cites W2084011989 @default.
• W2152697044 cites W2086793697 @default.
• W2152697044 cites W2097553343 @default.
• W2152697044 cites W2105216461 @default.
• W2152697044 cites W2105755033 @default.
• W2152697044 cites W2106009748 @default.
• W2152697044 cites W2106515170 @default.
• W2152697044 cites W2112939466 @default.
• W2152697044 cites W2115738891 @default.
• W2152697044 cites W2116824509 @default.
• W2152697044 cites W2117842413 @default.
• W2152697044 cites W2133639929 @default.
• W2152697044 cites W2139747033 @default.
• W2152697044 cites W2155518349 @default.
• W2152697044 cites W2159671926 @default.
• W2152697044 cites W2164535648 @default.
• W2152697044 cites W3026115269 @default.
• W2152697044 cites W37344274 @default.
• W2152697044 cites W4234609882 @default.
• W2152697044 doi "https://doi.org/10.1074/jbc.m505179200" @default.
• W2152697044 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16321981" @default.
• W2152697044 hasPublicationYear "2006" @default.
• W2152697044 type Work @default.
• W2152697044 sameAs 2152697044 @default.
• W2152697044 citedByCount "130" @default.
• W2152697044 countsByYear W21526970442012 @default.
• W2152697044 countsByYear W21526970442013 @default.
• W2152697044 countsByYear W21526970442014 @default.
• W2152697044 countsByYear W21526970442015 @default.
• W2152697044 countsByYear W21526970442016 @default.
• W2152697044 countsByYear W21526970442017 @default.
• W2152697044 countsByYear W21526970442018 @default.
• W2152697044 countsByYear W21526970442019 @default.
• W2152697044 countsByYear W21526970442020 @default.
• W2152697044 countsByYear W21526970442021 @default.
• W2152697044 countsByYear W21526970442022 @default.
• W2152697044 countsByYear W21526970442023 @default.
• W2152697044 crossrefType "journal-article" @default.
• W2152697044 hasAuthorship W2152697044A5005756896 @default.
• W2152697044 hasAuthorship W2152697044A5007872813 @default.
• W2152697044 hasAuthorship W2152697044A5036246480 @default.
• W2152697044 hasAuthorship W2152697044A5040863697 @default.
• W2152697044 hasAuthorship W2152697044A5053216955 @default.
• W2152697044 hasAuthorship W2152697044A5053228763 @default.
• W2152697044 hasAuthorship W2152697044A5057009246 @default.
• W2152697044 hasAuthorship W2152697044A5067258591 @default.
• W2152697044 hasAuthorship W2152697044A5072704585 @default.
• W2152697044 hasAuthorship W2152697044A5073617826 @default.
• W2152697044 hasAuthorship W2152697044A5082393804 @default.

• next