FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2153113090> ?p ?o ?g. }

• W2153113090 endingPage "1082" @default.
• W2153113090 startingPage "1070" @default.
• W2153113090 abstract "Background & Aims: Gastrin induces the expression of cyclooxygenase (COX)-2 and interleukin (IL)-8; however, the mechanism(s), especially in gastric epithelial cells, is not well understood. Here, we have determined the intracellular mechanisms mediating gastrin–dependent gene expression. Methods: AGS-E human gastric cancer cell line stably expressing cholecystokinin-2 receptor was treated with amidated gastrin-17. Real-time polymerase chain reaction, Western blot, and enzyme-linked immunosorbent assay were performed to determine COX-2 and IL-8 expression and Akt, Erk, and p38 phosphorylation. Gene promoter activity was determined by luciferase assay. Electrophoretic mobility shift assay analysis was performed for nuclear factor κB (NF-κB) and activator protein-1 activity. RNA stability was determined after actinomycin D treatment. HuR localization was determined by immunocytochemistry. Results: Gastrin induced COX-2 and IL-8 expression in AGS-E cells, which was inhibited by phosphatidylinositol 3′ kinase (PI3K) and p38 inhibitors. Gastrin-mediated Akt activation was observed to be downstream of p38. IL-8 expression was dependent on COX-2–mediated prostaglandin E2 synthesis. In the presence of an NF-κB inhibitor MG132, IL-8 transcription was inhibited, but not that of COX-2. This was confirmed after knockdown of the p65 RelA subunit of NF-κB. Further studies showed that COX-2 gene transcription is regulated by activator protein-1. Gastrin increased the stability of both COX-2 and IL-8 messenger RNA (mRNA) in a p38-dependent manner, the half-life increasing from 31 minutes to 8 hours and approximately 4 hours, respectively. Gastrin, through p38 activity, also enhanced HuR expression, nucleocytoplasmic translocation, and enhanced COX-2 mRNA binding. Conclusions: Gastrin differentially induces COX-2 and IL-8 expression at the transcriptional and posttranscriptional levels by PI3K and p38 mitogen-activated protein kinase pathways, respectively. Background & Aims: Gastrin induces the expression of cyclooxygenase (COX)-2 and interleukin (IL)-8; however, the mechanism(s), especially in gastric epithelial cells, is not well understood. Here, we have determined the intracellular mechanisms mediating gastrin–dependent gene expression. Methods: AGS-E human gastric cancer cell line stably expressing cholecystokinin-2 receptor was treated with amidated gastrin-17. Real-time polymerase chain reaction, Western blot, and enzyme-linked immunosorbent assay were performed to determine COX-2 and IL-8 expression and Akt, Erk, and p38 phosphorylation. Gene promoter activity was determined by luciferase assay. Electrophoretic mobility shift assay analysis was performed for nuclear factor κB (NF-κB) and activator protein-1 activity. RNA stability was determined after actinomycin D treatment. HuR localization was determined by immunocytochemistry. Results: Gastrin induced COX-2 and IL-8 expression in AGS-E cells, which was inhibited by phosphatidylinositol 3′ kinase (PI3K) and p38 inhibitors. Gastrin-mediated Akt activation was observed to be downstream of p38. IL-8 expression was dependent on COX-2–mediated prostaglandin E2 synthesis. In the presence of an NF-κB inhibitor MG132, IL-8 transcription was inhibited, but not that of COX-2. This was confirmed after knockdown of the p65 RelA subunit of NF-κB. Further studies showed that COX-2 gene transcription is regulated by activator protein-1. Gastrin increased the stability of both COX-2 and IL-8 messenger RNA (mRNA) in a p38-dependent manner, the half-life increasing from 31 minutes to 8 hours and approximately 4 hours, respectively. Gastrin, through p38 activity, also enhanced HuR expression, nucleocytoplasmic translocation, and enhanced COX-2 mRNA binding. Conclusions: Gastrin differentially induces COX-2 and IL-8 expression at the transcriptional and posttranscriptional levels by PI3K and p38 mitogen-activated protein kinase pathways, respectively. Gastrin, a peptide hormone involved in gastric acid production, is a potent cell-growth factor implicated in neoplastic transformation.1Dockray G.J. Varro A. Dimaline R. et al.The gastrins: their production and biological activities.Annu Rev Physiol. 2001; 63: 119-139Crossref PubMed Scopus (289) Google Scholar, 2Dufresne M. Seva C. Fourmy D. Cholecystokinin and gastrin receptors.Physiol Rev. 2006; 86: 805-847Crossref PubMed Scopus (368) Google Scholar, 3Watson S.A. Grabowska A.M. El-Zaatari M. et al.Gastrin—active participant or bystander in gastric carcinogenesis?.Nat Rev Cancer. 2006; 6: 936-946Crossref PubMed Scopus (124) Google Scholar Transgenic mice that over express gastrin present with parietal cell atrophy, foveolar hyperplasia, increased mucosal proliferation, and cancer.4Wang T.C. Dangler C.A. Chen D. et al.Synergistic interaction between hypergastrinemia and Helicobacter infection in a mouse model of gastric cancer.Gastroenterology. 2000; 118: 36-47Abstract Full Text Full Text PDF PubMed Scopus (514) Google Scholar Clinical studies have shown that hypergastrinemia may be associated with an increased risk of colorectal cancer, particularly in patients with Helicobacter pylori infection.5Hartwich A. Konturek S.J. Pierzchalski P. et al.Helicobacter pylori infection, gastrin, cyclooxygenase-2, and apoptosis in colorectal cancer.Int J Colorectal Dis. 2001; 16: 202-210Crossref PubMed Scopus (77) Google Scholar Survival signals activate the phosphatidylinositol 3′ kinase (PI3K)/Akt pathway and/or the mitogen-activated protein kinase (MAPK) pathways, Erk and p38.6Nunez G. del Peso L. Linking extracellular survival signals and the apoptotic machinery.Curr Opin Neurobiol. 1998; 8: 613-618Crossref PubMed Scopus (75) Google Scholar, 7Taylor S.T. Hickman J.A. Dive C. Survival signals within the tumour microenvironment suppress drug-induced apoptosis: lessons learned from B lymphomas.Endocr Relat Cancer. 1999; 6: 21-23Crossref PubMed Scopus (25) Google Scholar On stimulation, PI3K activates the downstream effector Akt, which then phosphorylates proteins implicated in cell-cycle control.8Chang F. Lee J.T. Navolanic P.M. et al.Involvement of PI3K/Akt pathway in cell cycle progression, apoptosis, and neoplastic transformation: a target for cancer chemotherapy.Leukemia. 2003; 17: 590-603Crossref PubMed Scopus (978) Google Scholar Gastrin and its precursor progastrin activate both PI3K/Akt and MAPKs.9Ferrand A. Bertrand C. Portolan G. et al.Signaling pathways associated with colonic mucosa hyperproliferation in mice overexpressing gastrin precursors.Cancer Res. 2005; 65: 2770-2777Crossref PubMed Scopus (46) Google Scholar, 10Fang J.Y. Richardson B.C. The MAPK signalling pathways and colorectal cancer.Lancet Oncol. 2005; 6: 322-327Abstract Full Text Full Text PDF PubMed Scopus (718) Google Scholar Erk isoforms p42mapk and p44mapk are activated by phosphorylation on specific tyrosine and threonine residues by a dual-specificity Erk kinase. Gastrin activates the human histidine decarboxylase promoter through Erk pathway in gastric cancer cells.11Hocker M. Henihan R.J. Rosewicz S. et al.Gastrin and phorbol 12-myristate 13-acetate regulate the human histidine decarboxylase promoter through Raf-dependent activation of extracellular signal-regulated kinase-related signaling pathways in gastric cancer cells.J Biol Chem. 1997; 272: 27015-27024Crossref PubMed Scopus (75) Google Scholar Gastrin also activates the p38 pathway to induce DNA synthesis.12Dehez S. Daulhac L. Kowalski-Chauvel A. et al.Gastrin-induced DNA synthesis requires p38-MAPK activation via PKC/Ca(2+) and Src-dependent mechanisms.FEBS Lett. 2001; 496: 25-30Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar Gastrin induces cyclooxygenase-2 (COX-2), the rate-limiting enzyme in prostaglandin synthesis.13Konturek S.J. Konturek P.C. Hartwich A. et al.Helicobacter pylori infection and gastrin and cyclooxygenase expression in gastric and colorectal malignancies.Regul Pept. 2000; 93: 13-19Crossref PubMed Scopus (64) Google Scholar Gastrin also induces interleukin 8 (IL-8) in hypergastrinemia.14Ogasa M. Miyazaki Y. Hiraoka S. et al.Gastrin activates nuclear factor kappaB (NFkappaB) through a protein kinase C dependent pathway involving NFkappaB inducing kinase, inhibitor kappaB (IkappaB) kinase, and tumour necrosis factor receptor associated factor 6 (TRAF6) in MKN-28 cells transfected with gastrin receptor.Gut. 2003; 52: 813-819Crossref PubMed Scopus (31) Google Scholar Both COX-2 and IL-8 transcription are regulated by nuclear transcription factor κB (NF-κB).15Yasumoto K. Okamoto S. Mukaida N. et al.Tumor necrosis factor alpha and interferon gamma synergistically induce interleukin 8 production in a human gastric cancer cell line through acting concurrently on AP-1 and NF-kB-like binding sites of the interleukin 8 gene.J Biol Chem. 1992; 267: 22506-22511Abstract Full Text PDF PubMed Google Scholar NF-κB is sequestered in the cytoplasm by inhibitor of nuclear factor κB.16Karin M. NF-kappaB and cancer: mechanisms and targets.Mol Carcinog. 2006; 45: 355-361Crossref PubMed Scopus (263) Google Scholar, 17Perkins N.D. Integrating cell-signalling pathways with NF-kappaB and IKK function.Nat Rev Mol Cell Biol. 2007; 8: 49-62Crossref PubMed Scopus (1945) Google Scholar Phosphorylation of IκB releases NF-κB, which then translocates to the nucleus to activate target genes.17Perkins N.D. Integrating cell-signalling pathways with NF-kappaB and IKK function.Nat Rev Mol Cell Biol. 2007; 8: 49-62Crossref PubMed Scopus (1945) Google Scholar Another mechanism of regulating COX-2 and IL-8 is by messenger RNA (mRNA) stability. In both transcripts, AU-rich sequence elements have been identified within the 3′ untranslated region, which regulate mRNA stability and translation.18Dixon D.A. Tolley N.D. King P.H. et al.Altered expression of the mRNA stability factor HuR promotes cyclooxygenase-2 expression in colon cancer cells.J Clin Invest. 2001; 108: 1657-1665Crossref PubMed Scopus (376) Google Scholar, 19Cok S.J. Morrison A.R. The 3′-untranslated region of murine cyclooxygenase-2 contains multiple regulatory elements that alter message stability and translational efficiency.J Biol Chem. 2001; 276: 23179-23185Crossref PubMed Scopus (191) Google Scholar, 20Yu Y. Chadee K. The 3′-untranslated region of human interleukin-8 mRNA suppresses IL-8 gene expression.Immunology. 2001; 102: 498-505Crossref PubMed Scopus (27) Google Scholar RNA-binding protein HuR is implicated in regulating COX-2 and IL-8 mRNA stability by binding to the AU-rich sequence element.21Brennan C.M. Steitz J.A. HuR and mRNA stability.Cell Mol Life Sci. 2001; 58: 266-277Crossref PubMed Scopus (879) Google Scholar HuR is predominantly nuclear, but upon binding to target mRNAs in the nucleus, it transports them to the cytoplasm and enhances their stability and translation.22Erkinheimo T.L. Lassus H. Sivula A. et al.Cytoplasmic HuR expression correlates with poor outcome and with cyclooxygenase 2 expression in serous ovarian carcinoma.Cancer Res. 2003; 63: 7591-7594PubMed Google Scholar, 23Gallouzi I.E. Steitz J.A. Delineation of mRNA export pathways by the use of cell-permeable peptides.Science. 2001; 294: 1895-1901Crossref PubMed Scopus (234) Google Scholar p38 regulates AU-rich sequence element–mediated mRNA decay.24Lasa M. Mahtani K.R. Finch A. et al.Regulation of cyclooxygenase 2 mRNA stability by the mitogen-activated protein kinase p38 signaling cascade.Mol Cell Biol. 2000; 20: 4265-4274Crossref PubMed Scopus (370) Google Scholar Here, we have determined that differential signaling pathways regulate transcription and mRNA stability of the 2 genes. In addition, although both COX-2 and IL-8 promoters encode functionally active NF-κB and AP-1 binding sites, gastrin-mediated induction of COX-2 and IL-8 gene transcription is exclusively by activator protein-1 (AP-1) and NF-κB, respectively. In contrast, gastrin-mediated stability of the 2 transcripts occurs through a p38-mediated regulation of HuR translocation to the cytoplasm. AGS-E gastric adenocarcinoma cells (stably expressing the cholecystokinin [CCK]-2 receptor) was grown in RPMI 1640 containing 10% heat-inactivated fetal bovine serum (Sigma Chemical Co, St. Louis, MO), antibiotics, and puromycin at 37°C in a humidified atmosphere at 5% CO2. Cells were treated with the indicated concentrations of gastrin (Sigma Chemical Co) in serum-free medium. Total RNA isolated using TRIzol reagent was reverse transcribed with Superscript II reverse transcriptase and random hexanucleotide primers (Invitrogen, Carlsbad, CA). Complementary DNA then was used for real-time reverse-transcription polymerase chain reaction (RT-PCR) using Jumpstart Taq DNA polymerase (Sigma Chemical Co) and SYBR Green nucleic acid stain (Molecular Probes, Eugene, OR). Crossing threshold values were normalized to β-2 microglobulin. mRNA expression was expressed as fold change relative to control. The primers used in this study were as follows: β-2 microglobulin, 5′-GAGTGCTGTCTCCATGTTTGATG-3′ and 5′-CTCTAAGTTGCCAGCCCTCCT-3′; IL-8, 5′-CTCTTGGCAGCCTTCCTGATT-3′ and 5′-TATGCACTGACATCTAAGTTCTTTAGCA-3′; COX-2, 5′-GAATCATTCACCAGGCAAATTG-3′ and 5′-TCTGTACTGCGGGTGGAACA-3′. Cell lysates were subjected to polyacrylamide gel electrophoresis and blotted onto Immobilon membranes (Millipore, Bedford, MA). Antibodies were purchased from Cell Signaling Technology (Beverly, MA) and Santa Cruz Biotechnology (Santa Cruz, CA). Specific proteins were detected by the enhanced chemiluminescence system (Amersham Pharmacia Biotech, Piscataway, NJ). For IL-8 protein, media was collected and levels were determined by using the Pierce enzyme-linked immunosorbent assay kit according to the manufacturer’s instructions (Pierce Biotechnology, Rockford, IL). For immunoprecipitation, the cells were fixed with 1% formalin.25Mukhopadhyay D. Houchen C.W. Kennedy S. et al.Coupled mRNA stabilization and translational silencing of cyclooxygenase-2 by a novel RNA binding protein, CUGBP2.Mol Cell. 2003; 11: 113-126Abstract Full Text Full Text PDF PubMed Scopus (190) Google Scholar Lysates were prepared and immunoprecipitated with anti-HuR antibody. The pellet and supernatant subsequently were incubated at 70°C for 1 hour to reverse the cross-links, and RNA was purified for RT-PCR analyses. Cells were transfected with 100 nmol/L RelA targeting si(silencer)RNA (cat #M-003533-01; Dharmacon, Lafayette, CO) using siPORT transfection agent (Ambion, Austin, TX). After 48 hours, the cells were incubated with gastrin for 2 hours. Media (for enzyme-linked immunosorbent assays), and nuclear and cytoplasmic extracts (for Western blot analyses), were prepared for further analyses. Cells were transfected with plasmids pIL8-Luc or pCOX2-Luc, which encode the firefly luciferase gene under the control of the IL-8 or COX-2 promoter using FuGENE 6 (Roche, Indianapolis, IN). Cells were pretreated with LY294002 (15 μmol/L), SB203580 (10 μmol/L), or PD98059 (10 μmol/L) for 2 hours; subsequently, these were treated with 10 nmol/L gastrin for 4 hours. For transfection control, cells were cotransfected with the plasmid pRL-TK (Clontech, Mountain View, CA), which expresses Renilla luciferase under the control of the thymidine kinase promoter. Luciferase levels in cell lysates were determined by using the Dual-Luciferase Reporter Assay System (Promega Corp, Madison, WI). Cells were treated with 10 nmol/L gastrin for 0–4 hours. Where indicated, the cells were pretreated with 5 μmol/L proteosomal inhibitor MG132 for 2 hours. Nuclear extracts were prepared using the NE-PER kit, and protein concentrations were determined by bicinchonic acid (all from Pierce Biotechnology). Electrophoretic mobility shift assay (EMSA) was performed with 5 μg nuclear extracts and γ 32P-labeled double-stranded oligonucleotide probes containing a consensus NF-κB (5′AGTTGAGGGACTTTCCCAGGC 3′) or AP-1 (5′CGCTTGATGACTCAGCCGGA-3′) site. To identify the components of the NF-κB complex, antibodies to p50 subunits (NFκB1 and NFκB2) and p65 subunits (c-Rel, Rel A, and Rel B) (all from Santa Cruz Biotechnology) were added to the reaction mixture and protein; DNA complexes resolved on 5% native polyacrylamide gel in 0.5× Tris-borate–ethylenediaminetetraacetic acid buffer and autoradiographed. Cells were pretreated either in the presence or absence of inhibitors (for 2 h) and/or gastrin (for 2 h) before the addition of actinomycin-D (10 μg/mL final concentration), a potent inhibitor of mRNA synthesis. Total mRNA then was extracted at 0–8 hours and measured by real-time RT-PCR. Data are presented as relative to control cells, at the time of addition of actinomycin D. Cells expressing N-terminal FLAG-tagged HuR after overnight transient transfection were pretreated with SB203580 followed by 10 nmol/L gastrin. The cells were fixed with 10% formaldehyde for 10 minutes at room temperature and permeabilized with phosphate-buffered saline containing 0.5% Triton X-100 for 10 minutes at room temperature and incubated with rabbit anti-FLAG (Affinity Bioreagents, Inc, Golden, CO) followed by fluorescein isothiocyanate–conjugated anti-rabbit immunoglobulin G. The slides were mounted and examined using Zeiss Axioskop 2 MOT plus microscope (Carl Zeiss, Inc, Thornwood, NY). All values are expressed as the mean ± SEM. Data were analyzed using an unpaired Student t test. We considered a P value of less than .05 to be statistically significant. First, we determined the effect of 10 nmol/L gastrin on COX-2 and IL-8 expression in AGS-E cells. COX-2 mRNA and protein expression increased to 4-fold at 2 hours (P < .05) (Figure 1A and C). IL-8 mRNA and protein expression increased to 600-fold at 2 hours (P < .001) (Figure 1B and D). We next determined whether there is a dose-dependent effect on gastrin-mediated induction of COX-2 and IL-8 gene expression. Cells were treated with increasing doses of gastrin (0–100 nmol/L) for 2 hours. Gastrin at 10 nmol/L concentration was sufficient to significantly up-regulate expression of the 2 genes when compared with controls (data not shown). Prostaglandin E2 (PGE2), the product of arachidonic acid metabolism, induces IL-8 expression.26Takehara H. Iwamoto J. Mizokami Y. et al.Involvement of cyclooxygenase-2–prostaglandin E2 pathway in interleukin-8 production in gastric cancer cells.Dig Dis Sci. 2006; 51: 2188-2197Crossref PubMed Scopus (17) Google Scholar To determine whether IL-8 expression is related to COX-2 expression, cells were treated with NS398, a selective COX-2 inhibitor. Pretreatment with NS398 resulted in decreased IL-8 mRNA and protein expression (Figure 1E and F). However, addition of exogenous PGE2 partially restored IL-8 gene expression, suggesting that gastrin-mediated IL-8 expression in AGS-E cells is mediated in part by the actions of COX-2–derived PGE2. Previous studies have shown that gastrin activates PI3K/Akt and Erk and treatment with specific inhibitors decreased heparin binding epidermal growth factor-like growth promoter activity.11Hocker M. Henihan R.J. Rosewicz S. et al.Gastrin and phorbol 12-myristate 13-acetate regulate the human histidine decarboxylase promoter through Raf-dependent activation of extracellular signal-regulated kinase-related signaling pathways in gastric cancer cells.J Biol Chem. 1997; 272: 27015-27024Crossref PubMed Scopus (75) Google Scholar, 27Hocker M. Zhang Z. Merchant J.L. et al.Gastrin regulates the human histidine decarboxylase promoter through an AP-1-dependent mechanism.Am J Physiol. 1997; 272: G822-G830PubMed Google Scholar In addition, gastrin induced DNA synthesis in a p38-dependent manner in Chinese hamster ovary cells stably expressing the CCK-2R.12Dehez S. Daulhac L. Kowalski-Chauvel A. et al.Gastrin-induced DNA synthesis requires p38-MAPK activation via PKC/Ca(2+) and Src-dependent mechanisms.FEBS Lett. 2001; 496: 25-30Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar, 28Cheng Z.J. Harikumar K.G. Ding W.Q. et al.Analysis of the cellular and molecular mechanisms of trophic action of a misspliced form of the type B cholecystokinin receptor present in colon and pancreatic cancer.Cancer Lett. 2005; 222: 95-105Abstract Full Text Full Text PDF PubMed Scopus (13) Google Scholar We investigated the effect of gastrin on PI3K/Akt, Erk, and p38 in the AGS-E cells. Akt was activated only 10 minutes after gastrin treatment (Figure 2A). In contrast, both Erk and p38 were activated within 1 minute of treatment. We next determined the effect of inhibiting Akt, Erk, or p38 on gastrin-mediated activation of each other. Pretreatment with LY294002, PD98059, or SB203580 resulted in the specific inhibition of Akt, Erk, or p38, respectively (Figure 2B–D). Furthermore, both Akt and Erk inhibitors suppressed activation of their respective proteins. However, they did not affect the other 2 proteins (Figure 2B and C). In contrast, inhibition of p38 activation also resulted in a significant reduction in Akt activation (Figure 2D). These data suggest that Akt is downstream of p38 in the gastrin stimulation pathway in gastric epithelial cells. We next determined the signaling pathways that regulate gastrin-mediated induction of COX-2 and IL-8 expression. Pretreatment with either the PI3K/Akt or p38 inhibitors, but not the Erk inhibitor, resulted in a significant reduction in COX-2 mRNA and protein expression (Figure 3A and B). To determine whether the inhibition was at the level of transcription, we transiently transfected a plasmid expressing firefly luciferase under the control of the 2-kb human COX-2 promoter. Again, the PI3K/Akt and p38 inhibitors, but not the Erk inhibitor, reduced gastrin-mediated luciferase activity by approximately 45%, suggesting that Akt and p38 regulate gastrin-mediated COX-2 transcription (Figure 3C). Similar results were obtained for IL-8. Treatment with either PI3K/Akt or p38 inhibitors resulted in approximately a 2.5-fold reduction in IL-8 mRNA and protein expression (Figure 3D and E). In addition, these compounds inhibited IL-8 promoter–driven luciferase expression (Figure 3F). Both COX-2 and IL-8 are regulated by transcription factor NF-κB.29Dubois R.N. Abramson S.B. Crofford L. et al.Cyclooxygenase in biology and disease.FASEB J. 1998; 12: 1063-1073Crossref PubMed Scopus (2225) Google Scholar, 30Hiraoka S. Miyazaki Y. Kitamura S. et al.Gastrin induces CXC chemokine expression in gastric epithelial cells through activation of NF-kappaB.Am J Physiol. 2001; 281: G735-G742PubMed Google Scholar To determine whether gastrin affected NF-κB activity, nuclear extracts from gastrin-treated cells were used in gel shift assays. There was an increase in nuclear NF-κB within 30 minutes of gastrin treatment, which remained high up to 4 hours (Figure 4A). NF-κB is composed of dimers of NFkB1, NFkB2, c-Rel, Rel A, and Rel B.16Karin M. NF-kappaB and cancer: mechanisms and targets.Mol Carcinog. 2006; 45: 355-361Crossref PubMed Scopus (263) Google Scholar To determine the composition of the NF-κB in the cells, a supershift assay was performed. Addition of specific antibodies to either the p50 NFkB1 or p65 RelA subunits resulted in a further shift of the NF-κB/DNA complex, suggesting that gastrin induces NFkB1 and RelA (Figure 4B). Another transcription factor that regulates COX-2 gene expression is AP-1. To determine whether gastrin affects AP-1 expression, EMSA assays were performed. Similar to the NF-κB described earlier, AP-1 expression was up-regulated significantly within 30 minutes and continued to remain high until 4 hours (Figure 4C). These data taken together suggest that gastrin induces both NF-κB and AP-1. To further investigate whether gastrin-mediated induction of COX-2 and IL-8 expression occurs through the NF-κB pathway, we next pretreated cells with proteosomal inhibitor MG132, which is a known NF-κB inhibitor. In EMSA assays, MG132 inhibited the nuclear activation of NF-κB (Figure 4D). Furthermore, Western blot analyses showed that gastrin-mediated increased nuclear RelA and NFkB1 was inhibited in the presence of MG132 (Figure 4E). In contrast, MG132 treatment resulted in an increase in AP-1 activity, which was confirmed by Western blot analysis to contain c-Fos and c-Jun (Figure 4D and F). Next, we tested the effect of MG132 on gastrin-mediated induction of COX-2 and IL-8 expression. Real-time PCR and Western blot analyses showed that MG132 treatment does not affect gastrin-mediated induction of COX-2 expression (Figure 5A and B). On the other hand, MG132 significantly suppressed gastrin-mediated IL-8 expression at both the mRNA and protein levels (Figure 5C and D). To confirm that NF-κB regulates only IL-8 and not COX-2, we down-regulated the p65 RelA subunit with a specific siRNA (Figure 5E). Although gastrin-mediated induction of IL-8 was suppressed in cells lacking RelA, COX-2 expression was not affected (Figure 5F and G). These data show that differential pathways regulate gastrin-mediated induction of gene expression. Although IL-8 gene transcription is regulated by NF-κB, that of COX-2 occurs in a NF-κB–independent, AP-1–mediated pathway. Both COX-2 and IL-8 are regulated at the posttranscriptional level of mRNA stability by AU-rich sequences in the 3′ untranslated region.18Dixon D.A. Tolley N.D. King P.H. et al.Altered expression of the mRNA stability factor HuR promotes cyclooxygenase-2 expression in colon cancer cells.J Clin Invest. 2001; 108: 1657-1665Crossref PubMed Scopus (376) Google Scholar, 19Cok S.J. Morrison A.R. The 3′-untranslated region of murine cyclooxygenase-2 contains multiple regulatory elements that alter message stability and translational efficiency.J Biol Chem. 2001; 276: 23179-23185Crossref PubMed Scopus (191) Google Scholar, 31Hla T. Bishop-Bailey D. Liu C.H. et al.Cyclooxygenase-1 and -2 isoenzymes.Int J Biochem Cell Biol. 1999; 31: 551-557Crossref PubMed Scopus (190) Google Scholar We first tested whether gastrin affects COX-2 mRNA stability. Gastrin treatment resulted in significantly higher stability of COX-2 mRNA, the half-life changing from 31 minutes to 8 hours after gastrin treatment (Figure 6A–C and G). To determine the signal pathway regulating the COX-2 mRNA stability, cells were pretreated with PI3K/Akt (LY240092), Erk (PD98059), and p38 (SB203580) inhibitors. Pretreatment with LY249002 or PD98059 did not affect gastrin-mediated COX-2 mRNA stability (Figure 6A, B and G). However, SB203580 significantly decreased COX-2 mRNA stability, the half-life decreasing to 92 minutes (Figure 6C). Similar results were observed with IL-8 (Figure 6D–F and H). Although the half-life of IL-8 mRNA increased from 45 minutes to approximately 4 hours in gastrin-treated cells, SB203580 decreased it to 90 minutes (Figure 6B and C). Again, addition of LY249002 or PD98059 did not affect gastrin-mediated stability of IL-8 mRNA (Figure 6D, E and H). These data suggest that gastrin regulates stability of both COX-2 and IL-8 mRNAs through the p38 MAPK pathway. We next determined the effect of gastrin on the expression of RNA stabilizing protein HuR. Western blot analysis showed that gastrin treatment led to increased HuR expression, in both a time- and dose-dependent manner (Figure 7A and B). In addition, immunoprecipitation-coupled RT-PCR assay showed higher levels of HuR binding to COX-2 mRNA in gastrin-treated cells (Figure 7C). To determine whether gastrin-mediated HuR expression is regulated by the p38 pathway, we added SB203580 to the cells. Western blot analyses of extracts from cells that had been pretreated with p38 MAPK inhibitor SB203580 showed that gastrin-mediated HuR expression was inhibited significantly (Figure 7D). We also examined whether localization of HuR was regulated by p38 pathway. The cells were transfected transiently with a plasmid encoding FLAG epitope–tagged HuR and subsequently treated with gastrin in the presence or absence of SB203580. In control untreated cells, HuR predominantly was nuclear. However, upon gastrin treatment HuR translocated to the cytoplasm, which was abolished in the presence of SB203580 (Figure 7E). These data suggest that gastrin induces RNA binding protein HuR to translocate to the cytoplasm to enhance COX-2 and IL-8 mRNA stability in a p38-dependent manner. Here, we investigated the mechanisms by which gastrin regulates COX-2 and IL-8 gene expression in gastric epithelial cells because of a dose- and time-dependent increase in both genes in response to this peptide hormone. COX-2 and IL-8 are up-regulated in gastritis and gastric cancer induced by Helicobacter pylori and in hypergastrinemia.5Hartwich A. Konturek S.J. Pierzchalski P. et al.Helicobacter pylori infection, gastrin, cyclooxygenase-2, and apoptosis in colorectal cancer.Int J Colorectal Dis. 2001; 16: 202-210Crossref PubMed Scopus (77) Google Scholar, 32Konturek S.J. Konturek P.C. Plonka A. et al.Implication of gastrin in cyclooxygenase-2 expression in Helicobacter pylori infected gastric ulceration.Prostaglandins Other Lipid Mediat. 2001; 66: 39-51Crossref PubMed Scopus (24) Google Scholar, 33Guo Y.S. Cheng J.Z. Jin G.F. et al.Gastrin stimulates cyclooxygenase-2 expression in intestinal epithelial cells through multiple signaling pathways Evidence for involvement of ERK5 kinase and transactivation of the epidermal growth factor receptor.J Biol Chem. 2002; 277: 48755-48763Crossref PubMed Scopus (92) Google Scholar, 34Shimoyama T. Everett S.M. Dixon M.F. et al.Chemokine mRNA expression in gastric mucosa is associated with Helicobacter pylori cagA positivity and severity of gastritis.J Clin Pathol. 1998; 51: 765-770Crossref PubMed Scopus (134) Google Scholar Prolonged production of IL-8 by gastric epithelial cells possibly may result in recruiting leukocytes.35Crabtree J.E. Gastric mucosal inflammatory responses to Helicobacter pylori.Aliment Pharmacol Ther. 1996; 10: 29-37Crossref PubMed Scopus (173) Google Scholar, 36Singer M. Sansonetti P.J. IL-8 is a key chemokine regulating neut" @default.
• W2153113090 created "2016-06-24" @default.
• W2153113090 creator A5005339910 @default.
• W2153113090 creator A5005402687 @default.
• W2153113090 creator A5014760553 @default.
• W2153113090 creator A5029226618 @default.
• W2153113090 creator A5034242696 @default.
• W2153113090 creator A5035668092 @default.
• W2153113090 creator A5064340210 @default.
• W2153113090 creator A5076749462 @default.
• W2153113090 creator A5081853369 @default.
• W2153113090 date "2008-04-01" @default.
• W2153113090 modified "2023-09-25" @default.
• W2153113090 title "Gastrin-Mediated Interleukin-8 and Cyclooxygenase-2 Gene Expression: Differential Transcriptional and Posttranscriptional Mechanisms" @default.
• W2153113090 cites W1497553226 @default.
• W2153113090 cites W1752465711 @default.
• W2153113090 cites W1963549994 @default.
• W2153113090 cites W1965314708 @default.
• W2153113090 cites W1971039830 @default.
• W2153113090 cites W1971463295 @default.
• W2153113090 cites W1976372129 @default.
• W2153113090 cites W1976384844 @default.
• W2153113090 cites W1977659216 @default.
• W2153113090 cites W1982173676 @default.
• W2153113090 cites W1986117681 @default.
• W2153113090 cites W1989804578 @default.
• W2153113090 cites W1990758633 @default.
• W2153113090 cites W1992913315 @default.
• W2153113090 cites W1997191108 @default.
• W2153113090 cites W1998530387 @default.
• W2153113090 cites W2005558505 @default.
• W2153113090 cites W2007539100 @default.
• W2153113090 cites W2013443154 @default.
• W2153113090 cites W2014209078 @default.
• W2153113090 cites W2014348586 @default.
• W2153113090 cites W2016904472 @default.
• W2153113090 cites W2026255725 @default.
• W2153113090 cites W2029648514 @default.
• W2153113090 cites W2029989332 @default.
• W2153113090 cites W2041299013 @default.
• W2153113090 cites W2052908553 @default.
• W2153113090 cites W2054791134 @default.
• W2153113090 cites W2059339710 @default.
• W2153113090 cites W2067427748 @default.
• W2153113090 cites W2069539829 @default.
• W2153113090 cites W2070732456 @default.
• W2153113090 cites W2070905430 @default.
• W2153113090 cites W2073788452 @default.
• W2153113090 cites W2078463939 @default.
• W2153113090 cites W2090501972 @default.
• W2153113090 cites W2090655917 @default.
• W2153113090 cites W2091545748 @default.
• W2153113090 cites W2097017740 @default.
• W2153113090 cites W2099261530 @default.
• W2153113090 cites W2102642039 @default.
• W2153113090 cites W2104203899 @default.
• W2153113090 cites W2116202796 @default.
• W2153113090 cites W2117512973 @default.
• W2153113090 cites W2121140284 @default.
• W2153113090 cites W2124624578 @default.
• W2153113090 cites W2127650074 @default.
• W2153113090 cites W2129377911 @default.
• W2153113090 cites W2140025704 @default.
• W2153113090 cites W2148844283 @default.
• W2153113090 cites W2149233326 @default.
• W2153113090 cites W2149395040 @default.
• W2153113090 cites W2152314991 @default.
• W2153113090 cites W2154036780 @default.
• W2153113090 cites W2154458783 @default.
• W2153113090 cites W2170839629 @default.
• W2153113090 cites W2328962208 @default.
• W2153113090 cites W85869317 @default.
• W2153113090 doi "https://doi.org/10.1053/j.gastro.2008.01.040" @default.
• W2153113090 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/18395088" @default.
• W2153113090 hasPublicationYear "2008" @default.
• W2153113090 type Work @default.
• W2153113090 sameAs 2153113090 @default.
• W2153113090 citedByCount "60" @default.
• W2153113090 countsByYear W21531130902012 @default.
• W2153113090 countsByYear W21531130902013 @default.
• W2153113090 countsByYear W21531130902014 @default.
• W2153113090 countsByYear W21531130902015 @default.
• W2153113090 countsByYear W21531130902016 @default.
• W2153113090 countsByYear W21531130902017 @default.
• W2153113090 countsByYear W21531130902018 @default.
• W2153113090 countsByYear W21531130902019 @default.
• W2153113090 countsByYear W21531130902020 @default.
• W2153113090 countsByYear W21531130902021 @default.
• W2153113090 countsByYear W21531130902022 @default.
• W2153113090 countsByYear W21531130902023 @default.
• W2153113090 crossrefType "journal-article" @default.
• W2153113090 hasAuthorship W2153113090A5005339910 @default.
• W2153113090 hasAuthorship W2153113090A5005402687 @default.
• W2153113090 hasAuthorship W2153113090A5014760553 @default.
• W2153113090 hasAuthorship W2153113090A5029226618 @default.
• W2153113090 hasAuthorship W2153113090A5034242696 @default.
• W2153113090 hasAuthorship W2153113090A5035668092 @default.
• W2153113090 hasAuthorship W2153113090A5064340210 @default.

• next