FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2154093655> ?p ?o ?g. }

• W2154093655 endingPage "16446" @default.
• W2154093655 startingPage "16439" @default.
• W2154093655 abstract "Werner syndrome (WS) is an inherited disorder characterized by premature aging and genomic instability. The protein encoded by the WS gene, WRN, possesses intrinsic 3′ → 5′ DNA helicase and 3′ → 5′ DNA exonuclease activities. WRN helicase resolves alternate DNA structures including tetraplex and triplex DNA, and Holliday junctions. Thus, one function of WRN may be to unwind secondary structures that impede cellular DNA transactions. We report here that hairpin and G′2 bimolecular tetraplex structures of the fragile X expanded sequence, d(CGG)n, effectively impede synthesis by three eukaryotic replicative DNA polymerases (pol): pol α, pol δ, and pol ε. The constraints imposed on pol δ-catalyzed synthesis are relieved, however, by WRN; WRN facilitates pol δ to traverse these template secondary structures to synthesize full-length DNA products. The alleviatory effect of WRN is limited to pol δ; neither pol α nor pol ε can traverse template d(CGG)n hairpin and tetraplex structures in the presence of WRN. Alleviation of pausing by pol δ is observed with Escherichia coli RecQ but not with UvrD helicase, suggesting a concerted action of RecQ helicases and pol δ. Our findings suggest a possible role of WRN in rescuing pol δ-mediated replication at forks stalled by unusual DNA secondary structures. Werner syndrome (WS) is an inherited disorder characterized by premature aging and genomic instability. The protein encoded by the WS gene, WRN, possesses intrinsic 3′ → 5′ DNA helicase and 3′ → 5′ DNA exonuclease activities. WRN helicase resolves alternate DNA structures including tetraplex and triplex DNA, and Holliday junctions. Thus, one function of WRN may be to unwind secondary structures that impede cellular DNA transactions. We report here that hairpin and G′2 bimolecular tetraplex structures of the fragile X expanded sequence, d(CGG)n, effectively impede synthesis by three eukaryotic replicative DNA polymerases (pol): pol α, pol δ, and pol ε. The constraints imposed on pol δ-catalyzed synthesis are relieved, however, by WRN; WRN facilitates pol δ to traverse these template secondary structures to synthesize full-length DNA products. The alleviatory effect of WRN is limited to pol δ; neither pol α nor pol ε can traverse template d(CGG)n hairpin and tetraplex structures in the presence of WRN. Alleviation of pausing by pol δ is observed with Escherichia coli RecQ but not with UvrD helicase, suggesting a concerted action of RecQ helicases and pol δ. Our findings suggest a possible role of WRN in rescuing pol δ-mediated replication at forks stalled by unusual DNA secondary structures. Werner syndrome Werner syndrome protein DNA polymerase δ DNA polymerase α DNA polymerase ε nucleotide(s) Werner Syndrome (WS),1characterized by premature aging and genomic instability (1Epstein C.J. Martin G.M. Schultz A.L. Motulsky A.G. Medicine. 1966; 45: 177-221Crossref PubMed Scopus (735) Google Scholar), is a result of mutations in the WS gene. The polypeptide encoded by the WS gene, WRN, contains a central seven-motif domain shared by DNA helicases of the RecQ family (2Yu C.-E. Oshima J. Fu Y.-H. Wijsman E.M. Hisama F. Alisch R. Matthews S. Nakura J. Miki T. Ouais S. Martin G.M. Mulligan J. Schellenberg G.D. Science. 1996; 272: 258-262Crossref PubMed Scopus (1479) Google Scholar). This family of DNA helicases is represented by Escherichia coli RecQ (3Nakayama H. Nakayama K. Nakayama R. Irino N. Nakayama Y. Hanawalt P.C. Mol. Gen. Genet. 1984; 195: 474-480Crossref PubMed Scopus (206) Google Scholar),Saccharomyces cerevisiae Sgs-1 (4Watt P.M. Hickson I.D. Borts R.H. Louis E.J. Genetics. 1996; 144: 935-945Crossref PubMed Google Scholar),Schizosaccharomyces pombe Rqh1 (5Stewart E. Chapman C.R. Al-Khodairy F. Carr A.M. Enoch T. EMBO J. 1997; 16: 2682-2692Crossref PubMed Scopus (326) Google Scholar), Xenopus laevis FFA-1 (6Yan H. Chen C.Y. Kobayashi R. Newport J. Nat. Genet. 1998; 19: 375-378Crossref PubMed Scopus (129) Google Scholar), and human RecQL (7Puranam K.L. Blackshear P.J. J. Biol. Chem. 1994; 269: 29838-29845Abstract Full Text PDF PubMed Google Scholar), BLM (8Ellis N.A. Groden J. Ye T.-Z. Straughen J. Lennon D.J. Ciocci S. Proytcheva M. German J. Cell. 1995; 83: 655-666Abstract Full Text PDF PubMed Scopus (1204) Google Scholar), and RecQ4 and RecQ5 proteins (9Kitao S. Ohsugi I. Ichikawa K. Goto M. Furuichi Y. Shimamoto A. Genomics. 1998; 54: 443-452Crossref PubMed Scopus (235) Google Scholar). Multiple RecQ DNA helicases have also been identified in Drosophila melanogaster (10Kusano K. Berres M.E. Engels W.R. Genetics. 1999; 151: 1027-1039PubMed Google Scholar) andArabidopsis thaliana (11Hartung F. Plchova H. Puchta H. Nucleic Acids Res. 2000; 28: 4275-4282Crossref PubMed Scopus (70) Google Scholar). WRN is distinct from other members of the RecQ helicase family in that it also includes an N-terminal exonuclease domain (12Morozov V. Mushegian A.R. Koonin E.V. Boork P. Trends Biochem. Sci. 1997; 22: 417-418Abstract Full Text PDF PubMed Scopus (138) Google Scholar, 13Mushegian A.R. Bassett Jr., D.E. Boguski M.S. Bork P. Koonin E.V. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 5831-5836Crossref PubMed Scopus (214) Google Scholar, 14Mian I.S. Nucleic Acids Res. 1997; 25: 3187-3195Crossref PubMed Scopus (180) Google Scholar). Indeed, recombinant WRN protein has been shown to possess, in addition to an ATP-dependent 3′ → 5′ DNA helicase activity, an intrinsic 3′ → 5′ DNA exonuclease activity (15Huang S. Li B. Gray M.D. Oshima J. Mian I.S. Campisi J. Nat. Genet. 1998; 20: 114-116Crossref PubMed Scopus (374) Google Scholar, 16Shen J.-C. Gray M.D. Oshima J. Kamath-Loeb A.S. Fry M. Loeb L.A. J. Biol. Chem. 1998; 273: 34139-34144Abstract Full Text Full Text PDF PubMed Scopus (221) Google Scholar).WRN helicase exhibits several characteristic features. 1) Unwinding of double-stranded DNA requires a 3′ single-stranded DNA tail, which presumably serves as a helicase loading DNA stretch (17Gray M.D. Shen J.-C. Kamath-Loeb A.S. Blank A. Martin G.M. Oshima J. Loeb L.A. Nat. Genet. 1997; 17: 100-103Crossref PubMed Scopus (516) Google Scholar, 18Suzuki N. Shimamoto A. Imamura O. Kuromitsu J. Kitao S. Goto M. Furuichi Y. Nucleic Acids Res. 1997; 25: 2973-2978Crossref PubMed Scopus (194) Google Scholar). 2) WRN exhibits low processivity such that the enzyme is capable of unwinding only short duplex regions <25 nt in length. 3) The processivity of WRN can be increased by the single-stranded DNA-binding protein, human replication protein A (19Shen J.-C. Gray M.D. Oshima J. Loeb L.A. Nucleic Acids Res. 1998; 26: 2879-2885Crossref PubMed Scopus (181) Google Scholar); in its presence, WRN unwinds duplex DNA tracts as long as 800 nt (20Brosh Jr., R.M. Orren D.K. Nehlin J.O. Ravn P.H. Kenny M.K. Machwe A. Bohr V.A. J. Biol. Chem. 1999; 274: 18341-18350Abstract Full Text Full Text PDF PubMed Scopus (255) Google Scholar). 4) WRN can unwind alternate DNA structures, including DNA tetraplexes (21Fry M. Loeb L.A. J. Biol. Chem. 1999; 274: 12797-12802Abstract Full Text Full Text PDF PubMed Scopus (313) Google Scholar), four-way Holliday junctions (22Constantinou A. Tarsounas M. Karow J.K. Brosh R.M. Bohr V.A. Hickson I.D. West S.C. EMBO Rep. 2000; 1: 80-84Crossref PubMed Scopus (336) Google Scholar), and triplex DNA (23Brosh Jr., R.M. Majumdar A. Desai S. Hickson I.D. Bohr V.A. Seidman M.M. J. Biol. Chem. 2001; 276: 3024-3030Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar).A large body of evidence implicates WRN and its family members in replication. The prolonged S-phase of WS cells (24Fujiwara Y. Higashikawa T. Tatsumi M. J. Cell. Physiol. 1977; 92: 365-374Crossref PubMed Scopus (130) Google Scholar, 25Takeuchi F. Hanaoka F. Goto M. Yamada M. Miyamoto T. Exp. Gerontol. 1982; 17: 473-480Crossref PubMed Scopus (56) Google Scholar), their sensitivity to the S-phase-specific topoisomerase I inhibitor camptothecin (26Poot M. Gollahon K.A. Rabinovitch P.S. Hum. Genet. 1999; 104: 10-14Crossref PubMed Scopus (152) Google Scholar), and the more recent demonstrations of a physical and functional interaction between WRN and the major replicative DNA polymerase, pol δ (27Szekely A.M. Chen Y.H. Zhang C. Oshima J. Weissman S.M. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 11365-11370Crossref PubMed Scopus (102) Google Scholar, 28Kamath-Loeb A.S. Johansson E. Burgers P.M. Loeb L.A. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 4308-4603Crossref Scopus (156) Google Scholar), all support the notion that WRN is involved in some aspects of DNA replication. If this is the case, a principle function of WRN helicase may be to resolve alternate DNA structures ahead of the replication fork that would normally impede the progression of DNA polymerases, analogous to the function of the dda helicase in bacteriophage T4 (29Barry J. Alberts B. J. Biol. Chem. 1994; 269: 33063-33068Abstract Full Text PDF PubMed Google Scholar).Guanine-rich DNA sequences readily form tetraplex structures in vitro under physiological-like conditions (30Sen D. Gilbert W. Nature. 1988; 334: 364-366Crossref PubMed Scopus (1446) Google Scholar, 31Sen D. Gilbert W. Nature. 1990; 344: 410-414Crossref PubMed Scopus (680) Google Scholar, 32Williamson J.R. Raghuraman M.K. Cech T.R. Cell. 1989; 59: 871-880Abstract Full Text PDF PubMed Scopus (1012) Google Scholar). Tetraplex formations of DNA are maintained by guanine quartets that are held together by Hoogsteen hydrogen bonds and stabilized by monovalent alkali cations. A direct demonstration for the existence of tetraplex DNA structures in cells is still lacking. However, their formationin vitro by biologically important G-rich sequences, such as telomeric DNA and the immunoglobulin class switch region, has led to speculations on their involvement in telomere transactions (32Williamson J.R. Raghuraman M.K. Cech T.R. Cell. 1989; 59: 871-880Abstract Full Text PDF PubMed Scopus (1012) Google Scholar, 33Henderson E. Blackburn E.H. Greider C.W. Telomeres. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1995: 11-34Google Scholar) and in homologous recombination (30Sen D. Gilbert W. Nature. 1988; 334: 364-366Crossref PubMed Scopus (1446) Google Scholar, 31Sen D. Gilbert W. Nature. 1990; 344: 410-414Crossref PubMed Scopus (680) Google Scholar) in vivo. Of interest is the formation of hairpin (34Chen X. Mariappan S.V. Catasti P. Ratliff R. Moyzis R.K. Laayoun A. Smith S.S. Bradbury E.M. Gupta G. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 5199-5203Crossref PubMed Scopus (227) Google Scholar, 35Gacy A.M. Goellner G. Juranic N. Macura S. McMurray C.T. Cell. 1995; 81: 533-540Abstract Full Text PDF PubMed Scopus (515) Google Scholar, 36Mitas M., Yu, A. Dill J. Haworth I.S. Biochemistry. 1995; 34: 12803-12811Crossref PubMed Scopus (112) Google Scholar, 37Nadel Y. Weisman-Shomer P. Fry M. J. Biol. Chem. 1995; 270: 28970-28977Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar) and tetraplex structures (38Fry M. Loeb L.A. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 4950-4954Crossref PubMed Scopus (311) Google Scholar, 39Kettani A. Kumar R.A. Patel D.J. J. Mol. Biol. 1995; 254: 638-656Crossref PubMed Scopus (184) Google Scholar, 40Chen F.-M. J. Biol. Chem. 1995; 270: 23090-23096Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar) by the d(CGG) trinucleotide repeat sequence whose expansion in theFMR1 gene leads to fragile X syndrome. Hairpin and tetraplex structures of this sequence have been shown to perturb movement of DNA polymerases during in vitro DNA synthesis (40Chen F.-M. J. Biol. Chem. 1995; 270: 23090-23096Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar, 41Usdin K. Woodford K.J. Nucleic Acids Res. 1995; 23: 4202-4209Crossref PubMed Scopus (224) Google Scholar, 42Kang S. Ohshima K. Shimizu M. Amirhaeri S. Wells R.D. J. Biol. Chem. 1995; 270: 27014-27021Abstract Full Text Full Text PDF PubMed Scopus (167) Google Scholar, 43Wells R.D. J. Biol. Chem. 1996; 271: 2875-2878Abstract Full Text Full Text PDF PubMed Scopus (284) Google Scholar). Stalling of replicative DNA polymerases could result in polymerase slippage and expansion of the repeat sequence.Here we report that DNA synthesis by several eukaryotic DNA polymerases is blocked by hairpin and bimolecular G′2 tetraplex structures of a d(CGG)7 tract in template DNA. Addition of WRN helicase, however, allows pol δ to traverse these template secondary structures and to synthesize full-length DNA. Further, we demonstrate that the ability of WRN to alleviate polymerase stalling at these secondary structures is specific and limited to pol δ.EXPERIMENTAL PROCEDURESMaterials and Enzymes[γ-32P]ATP (∼3000 Ci/mmol) was purchased from PerkinElmer Life Sciences. High performance liquid chromatography-purified and crude oligodeoxynucleotide primer and template, respectively, were synthesized by Operon Technologies. Ultrapure deoxyribonucleoside triphosphates (dNTPs) were purchased fromPromega Corp. Bacteriophage T4 polynucleotide kinase was supplied by New England Biolabs.Recombinant hexa-His-tagged WRN protein was purified to >90% homogeneity by the protocol published by Shen et al. (16Shen J.-C. Gray M.D. Oshima J. Kamath-Loeb A.S. Fry M. Loeb L.A. J. Biol. Chem. 1998; 273: 34139-34144Abstract Full Text Full Text PDF PubMed Scopus (221) Google Scholar). Approximate concentrations of WRN protein were determined from Coomassie-stained SDS-polyacrylamide gels using bovine serum albumin as a standard. Molar amounts of WRN were calculated based on its being a monomer (∼165 kDa). RecQ helicase was kindly provided by Dr. Stephen Kowalczykowski (University of California, Davis, CA), and UvrD helicase was a gift from Dr. Lawrence Grossman (Johns Hopkins University, Baltimore, MD). S. cerevisiae DNA pol δ and pol δ* were purified to homogeneity as described (44Burgers P.M. Gerik K.J. J. Biol. Chem. 1998; 273: 19756-19762Abstract Full Text Full Text PDF PubMed Scopus (162) Google Scholar); concentrations of pol δ and pol δ* were determined spectrophotometrically atA280. Human DNA polymerase α-primase complex (pol α) and human DNA polymerase ε (pol ε) were the generous gifts of Dr. Teresa Wang (Stanford University, Stanford, CA) and Dr. Stuart Linn (University of California, Berkeley, CA), respectively.Preparation of Tetraplex DNAHigh performance liquid chromatography-purified 18-mer primer (5′-d(GCCGGGGCCGGCCGCCGC)-3′) was 5′-end-labeled with [γ-32P]ATP by T4 polynucleotide kinase as described (45Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar) and boiled to inactivate the kinase. Unincorporated [γ-32P]ATP was removed from the reaction mixture by precipitating the labeled primer DNA with ethanol. Complementary 61-mer template (5′-d(TATGCCGGCGGCGGCGGCGGCGGCGGATGTAATGCCTCGTCTTGCGGCGGCCGGCCCCGGC)-3′) was purified by electrophoresis through a denaturing 7m urea, 8% polyacrylamide gel (45Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar).The labeled primer (500 pmol) was mixed with an equivalent amount of unlabeled template DNA in 50 mm Tris-HCl buffer, pH 8.0, 10 mm MgCl2. The mixture was boiled for 5 min at 100 °C, and the denatured oligomers were allowed to anneal by slow cooling to room temperature. Unlabeled primer was hybridized in parallel to unlabeled template DNA in an identical manner. The labeled primer-template was mixed with unlabeled primer-template to a final DNA concentration of 60 μm in the presence of 300 mm KCl in a volume of 16 μl. The mixture was incubated at 4 °C for 15–18 h to allow formation of tetraplex DNA. Thereafter, the concentration of KCl was lowered to 30 mm by the addition of 25 mm Tris-HCl, pH 8.0, 20% glycerol.Approximately 30-μl aliquots of the DNA mixture were loaded in individual lanes of a non-denaturing 6% polyacrylamide gel in TBE buffer (45 mm Tris borate buffer, pH 8.3, 1.25 mm EDTA) containing 30 mm KCl. The samples were electrophoresed at 4 °C at a constant current of 35 mA to resolve tetraplex forms of the oligomer from residual duplex and single-stranded DNA. Electrophoretically retarded tetraplex DNA was visualized by autoradiography and cut out from the gel. The excised gel slices were suspended in cold TE buffer (10 mm Tris-HCl, pH 8.0, 1 mm EDTA) containing 100 mm KCl and vortexed at 4 °C overnight. Following separation of gel residue by centrifugation, the extracted DNA was precipitated with ethanol and resuspended in TE buffer, 20 mm KCl. Aliquots of the recovered DNA were stored frozen at −80 °C until use. Concentrations of the isolated tetraplex DNA were estimated from the amount of radioactivity recovered.Preparation of Duplex Hairpin-containing DNA32P-5′-End-labeled 18-mer primer was hybridized to a 2-fold molar excess of gel-purified, unlabeled 61-mer template, as described above. The primed hairpin template was used without further purification in primer extension assays.AssaysDNA Polymerase-catalyzed Primer ExtensionHairpin or tetraplex-containing DNA template (0.5 pmol) was copied by indicated concentrations of DNA polymerases in the absence or presence of known amounts of DNA helicases. DNA synthesis was carried out in reaction mixtures that contained, in a final volume of 10 μl: 40 mm Tris-HCl buffer, pH 7.5, 20 mm KCl, 5 mm MgCl2, 5 mm dithiothreitol, 0.1 mg/ml bovine serum albumin, and 0.2 mm each of dATP, dGTP, dCTP, and dTTP. Reaction mixtures for the extension of primed hairpin-containing template did not include KCl. Following incubation at 37 °C for 15 min, the primer extension reactions were terminated by rapid cooling on ice and addition of denaturing loading buffer (45Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). The samples were boiled for 5 min, and aliquots were electrophoresed through 14% polyacrylamide-urea gels. The gels were dried and primer extension products were visualized by autoradiography or quantitated by PhosphorImager analysis (Molecular Dynamics).DNA Helicase ActivityHelicase activity was measured in primer extension reaction mixtures except that 1 mm ATP was present in place of the four dNTP substrates. Radiolabeled tetraplex DNA substrate (0.3–0.5 pmol) was incubated with known amounts of WRN,E. coli RecQ, or E. coli UvrD at 37 °C for 15 min. The unwinding reaction was terminated by the addition of 2.5 μl of a solution containing 40% glycerol, 50 mm EDTA, 2% SDS, and 3% each bromphenol blue and xylene cyanol. Unwinding of tetraplex DNA was monitored by electrophoresis of reaction aliquots through a non-denaturing 12% polyacrylamide gel in 0.5× TBE, 20 mm KCl at 4 °C under a constant current of 35 mA, followed by autoradiography, as described (21Fry M. Loeb L.A. J. Biol. Chem. 1999; 274: 12797-12802Abstract Full Text Full Text PDF PubMed Scopus (313) Google Scholar).DISCUSSIONThe DNA metabolic processes that WRN participates in are still not clear. However, several lines of evidence point to its involvement in DNA replication. In particular, WS cells exhibit S-phase defects, including a decreased frequency of DNA initiations and a reduced rate of chain elongation (24Fujiwara Y. Higashikawa T. Tatsumi M. J. Cell. Physiol. 1977; 92: 365-374Crossref PubMed Scopus (130) Google Scholar, 49Takeuchi F. Hanaoka F. Goto M. Akaoka I. Hori T. Yamada M. Miyamoto T. Hum. Genet. 1982; 60: 365-368Crossref PubMed Scopus (69) Google Scholar). Furthermore, these cells are sensitive to the S-phase-specific topoisomerase I inhibitor, camptothecin (26Poot M. Gollahon K.A. Rabinovitch P.S. Hum. Genet. 1999; 104: 10-14Crossref PubMed Scopus (152) Google Scholar). The functional and physical interaction of WRN with a major replicative DNA polymerase, pol δ (27Szekely A.M. Chen Y.H. Zhang C. Oshima J. Weissman S.M. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 11365-11370Crossref PubMed Scopus (102) Google Scholar, 28Kamath-Loeb A.S. Johansson E. Burgers P.M. Loeb L.A. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 4308-4603Crossref Scopus (156) Google Scholar) lends additional support for a role of WRN in replication. However, the finding that stimulation of pol δ activity by WRN occurs in the absence of the pol δ accessory factor, proliferating cell nuclear antigen (28Kamath-Loeb A.S. Johansson E. Burgers P.M. Loeb L.A. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 4308-4603Crossref Scopus (156) Google Scholar), suggested that WRN may not participate in processive DNA replication. This observation, together with the finding that WRN can unwind alternate DNA structures (21Fry M. Loeb L.A. J. Biol. Chem. 1999; 274: 12797-12802Abstract Full Text Full Text PDF PubMed Scopus (313) Google Scholar, 22Constantinou A. Tarsounas M. Karow J.K. Brosh R.M. Bohr V.A. Hickson I.D. West S.C. EMBO Rep. 2000; 1: 80-84Crossref PubMed Scopus (336) Google Scholar, 23Brosh Jr., R.M. Majumdar A. Desai S. Hickson I.D. Bohr V.A. Seidman M.M. J. Biol. Chem. 2001; 276: 3024-3030Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar), has led us to hypothesize that WRN may be involved in proliferating cell nuclear antigen-independent replication restart at forks blocked by DNA damage or stalled by DNA secondary structures. In this report we tested this hypothesis in part, by monitoring the effect of WRN on the progression of synthesis by pol δ through replication-impeding hairpin and tetraplex DNA structures.We used bimolecular tetraplex or hairpin formations of the trinucleotide repeat sequence d(CGG)n as model template secondary structures. A d(CGG)ntrinucleotide was first identified in the 5′-untranslated region of theFMR1 gene (50Oberlé I. Rousseau F. Heitz D. Kretz C. Devys D. Hanauer A. Boue J. Bertheas M.F. Mandel J.L. Science. 1991; 252: 1097-1102Crossref PubMed Scopus (1290) Google Scholar, 51Fu Y.H. Kuhl D.P. Pizzuti A. Pieretti M. Sutcliffe J.S. Richards S. Verkerk A.J. Holden J.J. Fenwick Jr., R.G. Warren S.T. Oostra B.A. Nelson D.L. Caskey C.T. Cell. 1991; 67: 1047-1058Abstract Full Text PDF PubMed Scopus (1747) Google Scholar, 52Verkerk A.J.M.H. Pieretti M. Sutcliffe J.S. Fu Y.-H. Kuhl D.P.A. Pizzuti A. Reiner O. Richards S. Victoria M.F. Zhang F. Eussen B.E. van Ommen G.-J.B. Blonden L.A.J. Riggins G.J. Chastain J.L. Kunst C.B. Galjaard H. Caskey C.T. Nelson D.L. Oostra B.A. Warren S.T. Cell. 1991; 65: 905-914Abstract Full Text PDF PubMed Scopus (2863) Google Scholar). The ability of d(CGG)n tracts to fold into hairpins (34Chen X. Mariappan S.V. Catasti P. Ratliff R. Moyzis R.K. Laayoun A. Smith S.S. Bradbury E.M. Gupta G. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 5199-5203Crossref PubMed Scopus (227) Google Scholar, 35Gacy A.M. Goellner G. Juranic N. Macura S. McMurray C.T. Cell. 1995; 81: 533-540Abstract Full Text PDF PubMed Scopus (515) Google Scholar, 36Mitas M., Yu, A. Dill J. Haworth I.S. Biochemistry. 1995; 34: 12803-12811Crossref PubMed Scopus (112) Google Scholar, 37Nadel Y. Weisman-Shomer P. Fry M. J. Biol. Chem. 1995; 270: 28970-28977Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar) and to assemble into quadruplex structures (38Fry M. Loeb L.A. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 4950-4954Crossref PubMed Scopus (311) Google Scholar, 39Kettani A. Kumar R.A. Patel D.J. J. Mol. Biol. 1995; 254: 638-656Crossref PubMed Scopus (184) Google Scholar, 40Chen F.-M. J. Biol. Chem. 1995; 270: 23090-23096Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar) was implicated in the expansion of this sequence that leads to fragile X syndrome. Hairpin and tetraplex structures of d(CGG)n have also been shown to block the progression of several DNA polymerases both in vitro (41Usdin K. Woodford K.J. Nucleic Acids Res. 1995; 23: 4202-4209Crossref PubMed Scopus (224) Google Scholar, 42Kang S. Ohshima K. Shimizu M. Amirhaeri S. Wells R.D. J. Biol. Chem. 1995; 270: 27014-27021Abstract Full Text Full Text PDF PubMed Scopus (167) Google Scholar, 43Wells R.D. J. Biol. Chem. 1996; 271: 2875-2878Abstract Full Text Full Text PDF PubMed Scopus (284) Google Scholar) and in vivo (46Samadashwily G.M. Raca G. Mirkin S.M. Nat. Genet. 1997; 17: 298-304Crossref PubMed Scopus (284) Google Scholar).We constructed a synthetic d(CGG)7-containing primed DNA template that folds spontaneously into a hairpin structure, or forms a bimolecular G′2 tetraplex structure in the presence of K+ions (Fig. 1). In line with previous reports, we too demonstrate that the template G′2 d(CGG)7 hairpin and tetraplex structures impose a strong barrier to DNA synthesis by three eukaryotic replicative DNA polymerases: α, δ, and ε (Figs. 3 and 4). Extension of a primer by all three DNA polymerases stalls either just before or within the first repeat of the trinucleotide sequence with no product DNA chains discernible beyond this point. Even when the concentration of polymerase is increased such that >90% of the primer is utilized, the initiated DNA chains pause near the start of the tetraplex region (data not shown).Addition of WRN markedly alleviates pausing by pol δ at the tetraplex domain (Fig. 3); a significant fraction of the product constitutes 61-nt-long full-length DNA chains. Several lines of evidence indicate that alleviation of pol δ pausing is a result of the tetraplex d(CGG)n unwinding activity of WRN. First, WRN is able to efficiently unwind the template d(CGG)7 G′2 tetraplex in the presence of dNTPs under conditions employed in primer extension reactions (data not shown). This is consistent with our previous results demonstrating that dNTPs can substitute for ATP in WRN-catalyzed unwinding reactions (19Shen J.-C. Gray M.D. Oshima J. Loeb L.A. Nucleic Acids Res. 1998; 26: 2879-2885Crossref PubMed Scopus (181) Google Scholar). Second, the helicase deficient K577M mutant WRN protein that is unable to unwind DNA (16Shen J.-C. Gray M.D. Oshima J. Kamath-Loeb A.S. Fry M. Loeb L.A. J. Biol. Chem. 1998; 273: 34139-34144Abstract Full Text Full Text PDF PubMed Scopus (221) Google Scholar, 17Gray M.D. Shen J.-C. Kamath-Loeb A.S. Blank A. Martin G.M. Oshima J. Loeb L.A. Nat. Genet. 1997; 17: 100-103Crossref PubMed Scopus (516) Google Scholar), also fails to relieve tetraplex-induced stalling of pol δ (Fig. 4). Third, by changing the order of addition of WRN and pol δ, we demonstrate that alleviation of polymerase pausing requires that unwinding of the tetraplex precedes synthesis or occurs simultaneously with DNA synthesis by pol δ (Fig. 3).The ability to complete synthesis past the G′2 tetraplex d(CGG)7 replicative barrier and to generate full-length product DNA chains in the presence of WRN appears, by far, to be limited to pol δ. WRN does not allow pol α or the two-subunit pol δ enzyme, pol δ*, to traverse the template tetraplex structure (Figs. 3 and 5), and only a trace amount of full-length DNA products is observed in reactions containing WRN and pol ε (Fig. 5).The specificity of alleviating tetraplex DNA-induced stalling of DNA polymerase is not only limited to the polymerase used, but also to the helicase utilized for unwinding. Our data show that, similarly to WRN,E. coli RecQ can unwind G′2 d(CGG)7 and allow pol δ to synthesize past the tetraplex, albeit less efficiently than WRN (Fig. 6). This is not totally unexpected since RecQ and WRN belong to the same family of DNA helicases (2Yu C.-E. Oshima J. Fu Y.-H. Wijsman E.M. Hisama F. Alisch R. Matthews S. Nakura J. Miki T. Ouais S. Martin G.M. Mulligan J. Schellenberg G.D. Science. 1996; 272: 258-262Crossref PubMed Scopus (1479) Google Scholar). Further, these results are consistent with the finding that replicative bypass of hairpin structures in E. coli can occur via a RecQ helicase-dependent pathway (53Cromie G.A. Millar C.B. Schmidt K.H. Leach D.R. Genetics. 2000; 154: 513-522Crossref PubMed Google Scholar). In contrast to RecQ and WRN, E. coli UvrD that can also unwind the d(CGG)7 tetraplex does not alleviate pol δ stalling at this secondary structure. Based on these results, we propose that DNA helicases of the RecQ family may serve to resolve tetraplex secondary structures in DNA templates copied by pol δ.Data presented in Figs. 5 and 6 indicate that unwinding of the tetraplex structure by itself is not sufficient to allow traversal of the tetraplex domain by DNA polymerases. Instead, the results suggest a requirement for a concerted action of DNA unwinding by WRN and DNA synthesis by polymerase. The two processes may be coupled through a direct interaction of these proteins. Indeed, a physical interaction between WRN and human pol δ has been reported recently (27Szekely A.M. Chen Y.H. Zhang C. Oshima J. Weissman S.M. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 11365-11370Crossref PubMed Scopus (102) Google Scholar). The lack of a permissive effect of WRN on replication of tetraplex DNA template by pol δ* indicates that the Pol32p subunit of pol δ is required to couple synthesis with unwinding. These results extend our previous work that implicated Pol32p as an essential component in the functional interaction between WRN and pol δ (28Kamath-Loeb A.S. Johansson E. Burgers P.M. Loeb L.A. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 4308-4603Crossref Scopus (156) Google Scholar). It should be noted that the human pol δ subunit (p50) that has been shown to interact physically with WRN (27Szekely A.M. Chen Y.H. Zhang C. Oshima J. Weissman S.M. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 11365-11370Crossref PubMed Scopus (102) Google Scholar) is not the same subunit that is required for stimulation of pol δ activity by WRN. Although seemingly discrepant, these findings are not mutually exclusive. It is conceivable that WRN physically associates with the p50 subunit of human pol δ but requires the p66 subunit (homologue of S. cerevisiae Pol32p) (54Hu" @default.
• W2154093655 created "2016-06-24" @default.
• W2154093655 creator A5022458127 @default.
• W2154093655 creator A5071181577 @default.
• W2154093655 creator A5071638186 @default.
• W2154093655 creator A5079598741 @default.
• W2154093655 creator A5088789180 @default.
• W2154093655 date "2001-05-01" @default.
• W2154093655 modified "2023-10-07" @default.
• W2154093655 title "Interactions between the Werner Syndrome Helicase and DNA Polymerase δ Specifically Facilitate Copying of Tetraplex and Hairpin Structures of the d(CGG) Trinucleotide Repeat Sequence" @default.
• W2154093655 cites W1501269279 @default.
• W2154093655 cites W1538603370 @default.
• W2154093655 cites W1545526472 @default.
• W2154093655 cites W1600484978 @default.
• W2154093655 cites W1926322311 @default.
• W2154093655 cites W1966347623 @default.
• W2154093655 cites W1970898019 @default.
• W2154093655 cites W1975817860 @default.
• W2154093655 cites W1976194927 @default.
• W2154093655 cites W1977518145 @default.
• W2154093655 cites W1980083127 @default.
• W2154093655 cites W1983715985 @default.
• W2154093655 cites W1984580584 @default.
• W2154093655 cites W1986071629 @default.
• W2154093655 cites W1987246047 @default.
• W2154093655 cites W1991070590 @default.
• W2154093655 cites W1993489030 @default.
• W2154093655 cites W1995702418 @default.
• W2154093655 cites W2003992275 @default.
• W2154093655 cites W2008669260 @default.
• W2154093655 cites W2015133519 @default.
• W2154093655 cites W2019043328 @default.
• W2154093655 cites W2025133427 @default.
• W2154093655 cites W2025997331 @default.
• W2154093655 cites W2026766143 @default.
• W2154093655 cites W2033364696 @default.
• W2154093655 cites W2035306523 @default.
• W2154093655 cites W2046386929 @default.
• W2154093655 cites W2050717008 @default.
• W2154093655 cites W2051013729 @default.
• W2154093655 cites W2052442164 @default.
• W2154093655 cites W2053233610 @default.
• W2154093655 cites W2058204977 @default.
• W2154093655 cites W2059501883 @default.
• W2154093655 cites W2064310741 @default.
• W2154093655 cites W2073722866 @default.
• W2154093655 cites W2076335297 @default.
• W2154093655 cites W2076732045 @default.
• W2154093655 cites W2084712319 @default.
• W2154093655 cites W2085617522 @default.
• W2154093655 cites W2091876286 @default.
• W2154093655 cites W2095344231 @default.
• W2154093655 cites W2105778779 @default.
• W2154093655 cites W2116217779 @default.
• W2154093655 cites W2125553838 @default.
• W2154093655 cites W2125636072 @default.
• W2154093655 cites W2132070326 @default.
• W2154093655 cites W2138524348 @default.
• W2154093655 cites W2144164911 @default.
• W2154093655 cites W2144969895 @default.
• W2154093655 cites W2149919973 @default.
• W2154093655 cites W2152472623 @default.
• W2154093655 cites W2153043528 @default.
• W2154093655 cites W2153262927 @default.
• W2154093655 cites W2167119720 @default.
• W2154093655 cites W2169185139 @default.
• W2154093655 doi "https://doi.org/10.1074/jbc.m100253200" @default.
• W2154093655 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11279038" @default.
• W2154093655 hasPublicationYear "2001" @default.
• W2154093655 type Work @default.
• W2154093655 sameAs 2154093655 @default.
• W2154093655 citedByCount "194" @default.
• W2154093655 countsByYear W21540936552012 @default.
• W2154093655 countsByYear W21540936552013 @default.
• W2154093655 countsByYear W21540936552014 @default.
• W2154093655 countsByYear W21540936552015 @default.
• W2154093655 countsByYear W21540936552016 @default.
• W2154093655 countsByYear W21540936552017 @default.
• W2154093655 countsByYear W21540936552018 @default.
• W2154093655 countsByYear W21540936552019 @default.
• W2154093655 countsByYear W21540936552020 @default.
• W2154093655 countsByYear W21540936552021 @default.
• W2154093655 countsByYear W21540936552022 @default.
• W2154093655 countsByYear W21540936552023 @default.
• W2154093655 crossrefType "journal-article" @default.
• W2154093655 hasAuthorship W2154093655A5022458127 @default.
• W2154093655 hasAuthorship W2154093655A5071181577 @default.
• W2154093655 hasAuthorship W2154093655A5071638186 @default.
• W2154093655 hasAuthorship W2154093655A5079598741 @default.
• W2154093655 hasAuthorship W2154093655A5088789180 @default.
• W2154093655 hasBestOaLocation W21540936551 @default.
• W2154093655 hasConcept C104317684 @default.
• W2154093655 hasConcept C141231307 @default.
• W2154093655 hasConcept C153911025 @default.
• W2154093655 hasConcept C161223559 @default.
• W2154093655 hasConcept C169802333 @default.
• W2154093655 hasConcept C2778090637 @default.
• W2154093655 hasConcept C2778112365 @default.

• next