FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2155628721> ?p ?o ?g. }

• W2155628721 endingPage "24742" @default.
• W2155628721 startingPage "24736" @default.
• W2155628721 abstract "FKBP12 is a ubiquitous and a highly conserved prolyl isomerase that binds the immunosuppressive drugs FK506 and rapamycin. Members of the FKBP12 family have been implicated in many processes that include intracellular protein folding, transport, and assembly. In the budding yeast Saccharomyces cerevisiae and in human T cells, rapamycin forms a complex with FKBP12 that inhibits cell cycle progression by inhibition of the TOR kinases. We reported previously that rapamycin does not inhibit the vegetative growth of the fission yeast Schizosaccharomyces pombe; however, it specifically inhibits its sexual development. Here we show that disruption of the S. pombe FKBP12 homolog,fkh1 +, at its chromosomal locus results in a mating-deficient phenotype that is highly similar to that obtained by treatment of wild type cells with rapamycin. A screen forfkh1 mutants that can confer rapamycin resistance identified five amino acids in Fkh1 that are critical for the effect of rapamycin in S. pombe. All five amino acids are located in the putative rapamycin binding pocket. Together, our findings indicate that Fkh1 has an important role in sexual development and serves as the target for rapamycin action in S. pombe. FKBP12 is a ubiquitous and a highly conserved prolyl isomerase that binds the immunosuppressive drugs FK506 and rapamycin. Members of the FKBP12 family have been implicated in many processes that include intracellular protein folding, transport, and assembly. In the budding yeast Saccharomyces cerevisiae and in human T cells, rapamycin forms a complex with FKBP12 that inhibits cell cycle progression by inhibition of the TOR kinases. We reported previously that rapamycin does not inhibit the vegetative growth of the fission yeast Schizosaccharomyces pombe; however, it specifically inhibits its sexual development. Here we show that disruption of the S. pombe FKBP12 homolog,fkh1 +, at its chromosomal locus results in a mating-deficient phenotype that is highly similar to that obtained by treatment of wild type cells with rapamycin. A screen forfkh1 mutants that can confer rapamycin resistance identified five amino acids in Fkh1 that are critical for the effect of rapamycin in S. pombe. All five amino acids are located in the putative rapamycin binding pocket. Together, our findings indicate that Fkh1 has an important role in sexual development and serves as the target for rapamycin action in S. pombe. cyclosporin A peptidylprolyl-cis/trans-isomerization polymerase chain reaction base pair fluorescence-activated cell sorter Cyclosporin A (CsA),1FK506, and rapamycin are microbial products that exhibit immunosuppressive activity (1Cardenas M.E. Sanfridson A. Cutler N.S. Heitman J. Trends Biotechnol. 1998; 16: 427-433Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar). These three compounds bind with high affinity to cytoplasmic proteins termed immunophilins (2Galat A. Eur. J. Biochem. 1993; 216: 689-707Crossref PubMed Scopus (313) Google Scholar, 3Ivery M.T. Med. Res. Rev. 2000; 20: 452-484Crossref PubMed Scopus (115) Google Scholar). CsA binds an immunophilin called cyclophilin-18, whereas FK506 and rapamycin, which are structurally related, bind a different immunophilin called FKBP12. The immunosuppressive drugs form a drug-immunophilin complex, which binds and inhibits a third component. The complexes CsA-cyclophilin-18 and FK506-FKBP12 bind and inhibit the activity of the Ca2+-dependent protein phosphatase, calcineurin (4Clipstone N.A. Crabtree G.R. Ann. N. Y. Acad. Sci. 1993; 696: 20-30Crossref PubMed Scopus (111) Google Scholar, 5Liu J. Farmer Jr., J.D. Lane W.S. Friedman J. Weissman I. Schreiber S.L. Cell. 1991; 66: 807-815Abstract Full Text PDF PubMed Scopus (3543) Google Scholar, 6O'Keefe S.J. Tamura J. Kincaid R.L. Tocci M.J. O'Neill E.A. Nature. 1992; 357: 692-694Crossref PubMed Scopus (779) Google Scholar). The rapamycin-FKBP12 complex binds and inhibits the activity of the phosphatidylinositol-like kinase, TOR (7Brown E.J. Albers M.W. Shin T.B. Ichikawa K. Keith C.T. Lane W.S. Schreiber S.L. Nature. 1994; 369: 756-758Crossref PubMed Scopus (1624) Google Scholar, 8Chiu M.I. Katz H. Berlin V. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 12574-12578Crossref PubMed Scopus (402) Google Scholar, 9Sabatini D.M. Erdjument-Bromage H. Lui M. Tempst P. Snyder S.H. Cell. 1994; 78: 35-43Abstract Full Text PDF PubMed Scopus (1192) Google Scholar, 10Sabers C.J. Martin M.M. Brunn G.J. Williams J.M. Dumont F.J. Wiederrecht G. Abraham R.T. J. Biol. Chem. 1995; 270: 815-822Abstract Full Text Full Text PDF PubMed Scopus (687) Google Scholar, 36Cafferkey R. Young P.R. McLaughlin M.M. Bergsma D.J. Koltin Y. Sathe G.M. Faucette L. Eng W.K. Johnson R.K. Livi G.P. Mol. Cell. Biol. 1993; 13: 6012-6023Crossref PubMed Scopus (252) Google Scholar,37Kunz J. Henriquez R. Schneider U. Deuter-Reinhard M. Movva N.R. Hall M.N. Cell. 1993; 73: 585-596Abstract Full Text PDF PubMed Scopus (713) Google Scholar). In addition to their immunosuppressive activity, CsA, FK506, and rapamycin have side effects that may stem, at least in part, from inhibition of the physiological function of the immunophilins. For example, in mammals, FKBP12 functions as a subunit of ryanodine calcium release channels and is thought to modulate intracellular Ca2+ levels in the heart (11Jayaraman T. Brillantes A.M. Timerman A.P. Fleischer S. Erdjument-Bromage H. Tempst P. Marks A.R. J. Biol. Chem. 1992; 267: 9474-9477Abstract Full Text PDF PubMed Google Scholar, 12Timerman A.P. Ogunbumni E. Freund E. Wiederrecht G. Marks A.R. Fleischer S. J. Biol. Chem. 1993; 268: 22992-22999Abstract Full Text PDF PubMed Google Scholar, 13Brillantes A.B. Ondrias K. Scott A. Kobrinsky E. Ondriasova E. Moschella M.C. Jayaraman T. Landers M. Ehrlich B.E. Marks A.R. Cell. 1994; 77: 513-523Abstract Full Text PDF PubMed Scopus (696) Google Scholar). Mice deficient in FKBP12 show severe heart defects associated with loss of function of cardiac ryanodine receptors (14Shou W. Aghdasi B. Armstrong D.L. Guo Q. Bao S. Charng M.J. Mathews L.M. Schneider M.D. Hamilton S.L. Matzuk M.M. Nature. 1998; 391: 489-492Crossref PubMed Scopus (346) Google Scholar). Similarly, treatment with high doses of FK506 can lead to severe heart failure (15Atkison P. Joubert G. Barron A. Grant D. Paradis K. Seidman E. Wall W. Rosenberg H. Howard J. Williams S. Lancet. 1995; 345: 894-896Abstract PubMed Scopus (141) Google Scholar). Although FKBP12 and cyclophilin-18 are unrelated in primary sequence, both classes of immunophilins exhibit a peptidyl prolyl-cis/trans-isomerization (PPIase) activity that accelerates a rate-limiting step in the folding of peptide and protein substrates in vitro (3Ivery M.T. Med. Res. Rev. 2000; 20: 452-484Crossref PubMed Scopus (115) Google Scholar, 16Lang K. Schmid F.X. Fischer G. Nature. 1987; 329: 268-270Crossref PubMed Scopus (410) Google Scholar, 17Tropschug M. Wachter E. Mayer S. Schonbrunner E.R. Schmid F.X. Nature. 1990; 346: 674-677Crossref PubMed Scopus (117) Google Scholar, 18Schonbrunner E.R. Mayer S. Tropschug M. Fischer G. Takahashi N. Schmid F.X. J. Biol. Chem. 1991; 266: 3630-3635Abstract Full Text PDF PubMed Google Scholar). The PPIase activity of the immunophilins is inhibited upon binding to their specific immunosuppressive drugs, suggesting an overlap between the PPIase-active site and the drug-binding site. According to atomic structure analyses of human cyclophilin-18 and FKBP12, both proteins contain a deep hydrophobic binding pocket (19Ke H.M. Zydowsky L.D. Liu J. Walsh C.T. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 9483-9487Crossref PubMed Scopus (166) Google Scholar, 20Ke H. J. Mol. Biol. 1992; 228: 539-550Crossref PubMed Scopus (109) Google Scholar, 21Van Duyne G.D. Standaert R.F. Karplus P.A. Schreiber S.L. Clardy J. J. Mol. Biol. 1993; 229: 105-124Crossref PubMed Scopus (1073) Google Scholar). These pocket structures accommodate the specific immunosuppressive-acting ligands and model tetrapeptides used as pseudosubstrates. The cellular functions of the immunophilins, as well as the relevance of the PPIase activity within the cellular environment, is not well understood. However, some of the important natural substrates of the immunophilins are now known (reviewed in Ref. 22Gothel S.F. Marahiel M.A. Cell. Mol. Life Sci. 1999; 55: 423-436Crossref PubMed Scopus (512) Google Scholar). For example, the human cyclophilin-18, CyPA, binds the Gag polyprotein of the human immunodeficiency virus, type 1, virion (23Thali M. Bukovsky A. Kondo E. Rosenwirth B. Walsh C.T. Sodroski J. Gottlinger H.G. Nature. 1994; 372: 363-365Crossref PubMed Scopus (559) Google Scholar, 24Franke E.K. Yuan H.E. Luban J. Nature. 1994; 372: 359-362Crossref PubMed Scopus (645) Google Scholar, 25Luban J. Bossolt K.L. Franke E.K. Kalpana G.V. Goff S.P. Cell. 1993; 73: 1067-1078Abstract Full Text PDF PubMed Scopus (697) Google Scholar). The human FKBP12 protein is physically associated with calcium release channels (11Jayaraman T. Brillantes A.M. Timerman A.P. Fleischer S. Erdjument-Bromage H. Tempst P. Marks A.R. J. Biol. Chem. 1992; 267: 9474-9477Abstract Full Text PDF PubMed Google Scholar, 12Timerman A.P. Ogunbumni E. Freund E. Wiederrecht G. Marks A.R. Fleischer S. J. Biol. Chem. 1993; 268: 22992-22999Abstract Full Text PDF PubMed Google Scholar, 13Brillantes A.B. Ondrias K. Scott A. Kobrinsky E. Ondriasova E. Moschella M.C. Jayaraman T. Landers M. Ehrlich B.E. Marks A.R. Cell. 1994; 77: 513-523Abstract Full Text PDF PubMed Scopus (696) Google Scholar,26Cameron A.M. Steiner J.P. Roskams A.J. Ali S.M. Ronnett G.V. Snyder S.H. Cell. 1995; 83: 463-472Abstract Full Text PDF PubMed Scopus (446) Google Scholar), the type I tumor growth factor, transforming growth factor-β, receptor (27Wang T. Donahoe P.K. Zervos A.S. Science. 1994; 265: 674-676Crossref PubMed Scopus (310) Google Scholar, 28Wang T. Li B.Y. Danielson P.D. Shah P.C. Rockwell S. Lechleider R.J. Martin J. Manganaro T. Donahoe P.K. Cell. 1996; 86: 435-444Abstract Full Text Full Text PDF PubMed Scopus (307) Google Scholar, 29Huse M. Chen Y.G. Massague J. Kuriyan J. Cell. 1999; 96: 425-436Abstract Full Text Full Text PDF PubMed Scopus (358) Google Scholar, 30Yao D. Dore Jr., J.J. Leof E.B. J. Biol. Chem. 2000; 275: 13149-13154Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar), and the transcription factor YY1 (31Yang W.M. Inouye C.J. Seto E. J. Biol. Chem. 1995; 270: 15187-15193Crossref PubMed Scopus (89) Google Scholar). Genetic studies in the budding yeast Saccharomyces cerevisiae have played a critical role in elucidating the mode of action of the immunosuppressive drugs in higher eukaryotes (reviewed in Refs. 32Hall M.N. Biochem. Soc. Trans. 1996; 24: 234-239Crossref PubMed Scopus (45) Google Scholar and 33Cardenas M.E. Cruz M.C. Del Poeta M. Chung N. Perfect J.R. Heitman J. Clin. Microbiol. Rev. 1999; 12: 583-611Crossref PubMed Google Scholar). Similar to the effect of rapamycin in T cells and certain non-lymphoid cells, rapamycin treatment of S. cerevisiae cells results in a G1 cell cycle arrest (34Heitman J. Movva N.R. Hall M.N. Science. 1991; 253: 905-909Crossref PubMed Scopus (1503) Google Scholar). S. cerevisiae cells contain one FKBP12 homolog, namedFPR1 (34Heitman J. Movva N.R. Hall M.N. Science. 1991; 253: 905-909Crossref PubMed Scopus (1503) Google Scholar), also known as RBP1 (35Koltin Y. Faucette L. Bergsma D.J. Levy M.A. Cafferkey R. Koser P.L. Johnson R.K. Livi G.P. Mol. Cell. Biol. 1991; 11: 1718-1723Crossref PubMed Scopus (190) Google Scholar). Disruption ofFPR1 results in slightly slowly growing but viable cells that are completely resistant to rapamycin. This phenotype indicated that FPR1 is a nonessential gene and is the main mediator of the effect of rapamycin (34Heitman J. Movva N.R. Hall M.N. Science. 1991; 253: 905-909Crossref PubMed Scopus (1503) Google Scholar, 35Koltin Y. Faucette L. Bergsma D.J. Levy M.A. Cafferkey R. Koser P.L. Johnson R.K. Livi G.P. Mol. Cell. Biol. 1991; 11: 1718-1723Crossref PubMed Scopus (190) Google Scholar). Later it was shown that Fpr1p forms a complex with rapamycin that binds and inhibits the functions of theTOR1 and TOR2 gene products in cell cycle progression (34Heitman J. Movva N.R. Hall M.N. Science. 1991; 253: 905-909Crossref PubMed Scopus (1503) Google Scholar, 36Cafferkey R. Young P.R. McLaughlin M.M. Bergsma D.J. Koltin Y. Sathe G.M. Faucette L. Eng W.K. Johnson R.K. Livi G.P. Mol. Cell. Biol. 1993; 13: 6012-6023Crossref PubMed Scopus (252) Google Scholar, 37Kunz J. Henriquez R. Schneider U. Deuter-Reinhard M. Movva N.R. Hall M.N. Cell. 1993; 73: 585-596Abstract Full Text PDF PubMed Scopus (713) Google Scholar, 38Zheng X.F. Florentino D. Chen J. Crabtree G.R. Schreiber S.L. Cell. 1995; 82: 121-130Abstract Full Text PDF PubMed Scopus (244) Google Scholar, 39Barbet N.C. Schneider U. Helliwell S.B. Stansfield I. Tuite M.F. Hall M.N. Mol. Biol. Cell. 1996; 7: 25-42Crossref PubMed Scopus (590) Google Scholar). Several proteins that interact physically with Fpr1p in the absence of rapamycin have been identified, and it has been suggested that their activity may be regulated by the interaction with Fpr1p. These include calcineurin (40Cardenas M.E. Hemenway C. Muir R.S. Ye R. Fiorentino D. Heitman J. EMBO J. 1994; 13: 5944-5957Crossref PubMed Scopus (135) Google Scholar), the biosynthetic enzyme aspartokinase (41Alarcon C.M. Heitman J. Mol. Cell. Biol. 1997; 17: 5968-5975Crossref PubMed Scopus (30) Google Scholar), the high mobility group HMG 1/2 proteins (42Dolinski K.J. Heitman J. Genetics. 1999; 151: 935-944PubMed Google Scholar), and the transcription factor homolog FAP1 (43Kunz J. Loeschmann A. Deuter-Reinhard M. Hall M.N. Mol. Microbiol. 2000; 37: 1480-1493Crossref PubMed Scopus (16) Google Scholar). We reported previously (44Weisman R. Choder M. Koltin Y. J. Bacteriol. 1997; 179: 6325-6334Crossref PubMed Google Scholar) that rapamycin does not affect vegetative growth in the fission yeast, Schizosaccharomyces pombe, but severely inhibits its sexual development pathway. S. pombecells are induced to enter the sexual development pathway under starvation conditions (45Davey J. Yeast. 1998; 14: 1529-1566Crossref PubMed Scopus (84) Google Scholar). If the sexual development pathway is chosen, cells of opposite mating type conjugate to form diploid zygotes that immediately undergo meiosis and sporulation (45Davey J. Yeast. 1998; 14: 1529-1566Crossref PubMed Scopus (84) Google Scholar). Rapamycin strongly inhibited sexual development at an early stage, before mating had occurred, but did not affect entrance into stationary phase (44Weisman R. Choder M. Koltin Y. J. Bacteriol. 1997; 179: 6325-6334Crossref PubMed Google Scholar). More recently, we reported that S. pombe contains two TOR homologs, tor1 + and tor2 +(46Weisman R. Choder M. J. Biol. Chem. 2001; 267: 7027-7032Abstract Full Text Full Text PDF Scopus (158) Google Scholar). tor2 + is an essential gene of as yet unknown function. tor1 + is required under starvation and a variety of other stress conditions that include osmotic and oxidative stresses. Interestingly, none of the studied functions of the S. pombe TOR homologs appear to be inhibited by rapamycin (46Weisman R. Choder M. J. Biol. Chem. 2001; 267: 7027-7032Abstract Full Text Full Text PDF Scopus (158) Google Scholar). To understand further the response of S. pombe to rapamycin, we isolated and characterized the S. pombe FKBP12 homolog. We found one FKBP12 homolog and named it fkh1 +. Disruption of fkh1 + results in a mating deficient phenotype that is highly similar to that of rapamycin-treated cells. We identified, using a genetic screen, amino acid substitutions in Fkh1 that confer rapamycin resistance. These substitutions occur in conserved residues of FKBP12 and are potentially involved in rapamycin binding. Our analyses of the fkh1 null and rapamycin-resistant mutants suggest that rapamycin exerts its effect on sexual development in S. pombe by inhibiting the function of Fkh1. Yeast strains used in this paper are described in TableI. Media used are based on those described (47Moreno S. Klar A. Nurse P. Methods Enzymol. 1991; 194: 795-823Crossref PubMed Scopus (3102) Google Scholar). EMM-N contains no nitrogen; EMM lowG contains 0.1% glucose. Transformation of S. pombe cells was performed by electroporation (48Prentice H.L. Nucleic Acids Res. 1992; 20: 621Crossref PubMed Scopus (213) Google Scholar). Rapamycin was added to a final concentration of 0.2 μg/ml in liquid or agar-containing media, unless otherwise indicated. An equal volume of the drug vehicle solution (1:1 Me2SO:methanol) was used as a control in all experiments. Assays for mating or sporulation efficiency were carried out as follows. Cells were grown at 30 °C in EMM medium to the density of ∼5 × 106–1 × 107cell/ml. The cultures were then washed three times with double distilled water and 5 μl containing 5 × 106 cells were spotted on EMM, EMM-N, EMM-lowG, or ME medium (see Ref. 44Weisman R. Choder M. Koltin Y. J. Bacteriol. 1997; 179: 6325-6334Crossref PubMed Google Scholar for detailed description of medium composition). After 3 days of incubation at 30 °C, a toothpick was used to pick some of the cells from the center of each patch, and the cells were briefly sonicated and examined microscopically. The percentage of mating was calculated by dividing the number of zygotes, asci, and free spores by the number of total cells. The percentage of sporulation was calculated by dividing the number of asci and free spores by the number of total cells. One zygote or one ascus was counted as two cells and one spore was counted as half-cell. In each experiment 500–1000 cells were counted. Cell viability after entry into stationary phase was determined as follows. Cells were grown in minimal medium (EMM) or rich medium (YE) at 30 °C to confluence, and aliquots were sampled every 24 h. Cell viability was determined by the capacity of cells to form colonies.Table IS. pombe strains used in this studyStrainGenotypeSourceTA07leu1–32/leu1–32 ura4-D18/ura4-D18 ade6-M216/ade6-M210 h+/h−Lab stockTA06leu1–32 h−Lab stockTA16leu1–32 ura4-D18 ade6-M216 h90Lab stockTA58leu1–32 ura4-D18 h90Lab stockTA59leu1–32 ura4-D18 ade6-M216 fkh1∷ura4+ h90This studyTA77leu1–32 ura4-D18 fkh1∷ura4+ h90This studyTA94fkh1∷ura4+/fkh1∷ura4+leu1–32/leu1–32 ura4-D18/ura4-D18 ade6M-210/ade6M216 h+/h−This studyTA96fkh1∷ura4+leu1–32 h−This study Open table in a new tab Cells were stained with the DNA fluorochrome propidium iodide and analyzed by a Becton Dickinson FACSort as described (49Snaith H.A. Forsburg S.L. Genetics. 1999; 152: 839-851PubMed Google Scholar). Data were analyzed by Cell Quest software for Macintosh. A 1.7-kilobase pair fragment containing the entire fkh1 + gene was amplified by PCR using a genomic S. pombe DNA preparation as a template and primers 101 (5′-GCTCAGAATGATCGACATATACAAC) and 102 (5′- CAAACCAGCTACATAGCACAG). The resulting PCR fragment was cloned into a pGEM-T vector (Promega) to give pGEMT-fkh1. This plasmid was cut withHindIII, within the fourth exon offkh1 +. The HindIII restriction site lies within the predicted active site and rapamycin binding pocket. TheHindIII cut plasmid was ligated with a HindIII fragment containing ura4 +, resulting in the plasmid pfkh1::ura4 +.NotI and SacI were used to release the 3.5-kilobase pairfkh1::ura4 + disruption fragments that were gel-purified and transformed into the homothallic strain TA16. Stable Ura4+ haploids were selected and subjected to PCR analysis with primer 135 (5′-GTTATAAACATTGGTGTTGGAACAG) that is complementary to sequences within the ura4 + gene and primer 136 (5′-GTTCGAATATAT TCGGTGCGCC) that is complementary to sequences of thefkh1 + locus that are 100 bp downstream of the 3′ end of the disruption construct. The resultant PCR fragment of 1200 bp confirmed that the disruption cassette integrated into thefkh1 + locus. In addition, we used primer 136 in combination with primer 103 that is complementary to sequences that are 100 bp upstream of the 5′ end of the disruption construct. The amplification of a single PCR product of the size of 3700 bp is consistent with a single site insertion of the disruption cassette. We analyzed the phenotype of two independently isolated Δfkh1clones and demonstrated that re-introduction of the wild typefkh1 + gene rescued the defects observed in these clones. The cDNA offkh1 + was isolated by PCR amplification from anS. pombe cDNA library (50Maundrell K. Gene ( Amst. ). 1993; 123: 127-130Crossref PubMed Scopus (922) Google Scholar) with the primers 92 (5′-GGAATTCCATATGGGTGTCGAAAAGCAAGTTATTTC; underlined is the NdeI restriction site) and 81 (5′-TGACCAATGGCGAAGAAGTCC). The PCR product of 486 bp was cloned under the control of the thiamine-repressible nmt1 promoter in pREP1 (50Maundrell K. Gene ( Amst. ). 1993; 123: 127-130Crossref PubMed Scopus (922) Google Scholar). In all experiments cells were grown under derepression conditions (in the absence of thiamine) for full activity of thenmt1 promoter. The cDNA of fkh1 +was also cloned into the S. cerevisiae expression vector pCM189 (51Gari E. Piedrafita L. Aldea M. Herrero E. Yeast. 1997; 13: 837-848Crossref PubMed Scopus (500) Google Scholar) using primers 92 and 81. In addition, the S. cerevisiae FKBP12 homolog, FPR1, was cloned into the pCM189 vector and pCM189′ (a vector that differs from pCM189 only in that it contains LEU2 as a selective marker and notURA3) using primers 106 (5′-ATAAGAATGCGGCCGCCGGATCCCGCTCGAGGTCG) and 110 (5′-ATAAGAATGCGGCCGCCAATTAAGGCTCAGATACTTACC). TheNotI sites in both primers are underlined. pCM189-fkh1 + and pCM189-FPR1 were transformed into the S. cerevisiae strains JK9-3d (MATα leu2-3,2-112 trp1-1 ura3-52 his4 rme1 HMLa) and JK9-3dα ade2 fpr1::ADE2 (52Heitman J. Movva N.R. Hiestand P.C. Hall M.N. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 1948-1952Crossref PubMed Scopus (242) Google Scholar), the kind gift of J. Heitman, Duke University Medical Center. fkh1 + cDNA was also isolated during a screen for S. pombe genes that could suppress the rapamycin-sensitive phenotype in S. cerevisiae. The S. cerevisiae strain, RS188N (MAT a leu2-3,2-112 trp1-1 ura3-1 ade2-1 his3-11, 15 can1-100), was transformed with a S. pombe cDNA library constructed using a S. cerevisiae high copy number expression vector in which expression of inserts is regulated by the strong ADH1promoter (53Fikes J.D. Becker D.M. Winston F. Guarente L. Nature. 1990; 346: 291-294Crossref PubMed Scopus (127) Google Scholar). Transformants were plated onto minimal medium plates containing 0.1 μg/ml rapamycin at 30 °C. 25 rapamycin-resistant colonies were isolated from over 105 transformants. Of these, 8 exhibited rapamycin resistance upon re-streak on rapamycin-containing plates, and in 4 the rapamycin resistance phenotype was dependent on the presence of the plasmid. 2R. Weisman, S. Finkelstein, and M. Choder, manuscript in preparation. Sequence analysis revealed that one of these, pR22, encodes forfkh1 +. This clone contained the entire open reading frame of fkh1 + flanked by 22 and 150 bp at 5′ and 3′ ends of the open reading frame, respectively. Total protein extracts were prepared from mid-log wild type (TA16), Δfkh1 (TA59), and wild type (TA16) cells transformed with pREP1-fkh1 +, following the method described (47Moreno S. Klar A. Nurse P. Methods Enzymol. 1991; 194: 795-823Crossref PubMed Scopus (3102) Google Scholar). Aliquots of whole cell extracts containing 40 μg of protein were fractionated by SDS-polyacrylamide gels and transferred to membrane filters. The immobilized proteins were detected using the PerkinElmer Life Sciences ECL system. The Fkh1 proteins were detected with polyclonal antibodies raised against S. cerevisiaeFKBP12, the kind gift of J. Heitman, Duke University Medical Center. fkh1 mutants were obtained by PCR-based mutagenesis. Conditions for PCR-based random mutagenesis offkh1 + were essentially as described (54Fromant M. Blanquet S. Plateau P. Anal. Biochem. 1995; 224: 347-353Crossref PubMed Scopus (233) Google Scholar). Briefly, 5 ng of plasmid pR22 were taken for PCR amplification offkh1 + cDNA with 0.2 μg of primers 92 (5′-GGAATTCCATATGGGTGTCGAAAA GCAAGTTATTTC, NdeI site is underlined) and 81 (5′-TGACCAATGGCGAAGAAGTCC). The PCR buffer contained 10 mm Tris-HCl (pH 8.7), 50 mm KCl, 5 μg/ml bovine serum albumin, 0.5 mm MnCl2, 4.2 mm MgCl2, 5 units of Taq polymerase, 250 μm each of dNTP, and an excess of 1.5 mmof one dNTP nucleotide concentration over the others. Four separate PCRs were performed, and in each reaction a different dNTP was present in excess. 25 cycles of PCR were performed with the following temperature profile: 94 °C, 30 s; 55 °C, 30 s; 72 °C, 30 s. The four PCRs were pooled and fractionated in a 1.5% agarose gel and eluted. The resultant 550-bp DNA fragments were digested with NdeI and ligated with aNdeI-SmaI digested pREP1 S. pombevector. The ligation product was used for PCR amplification with primers 189 (5′-GAATAAGTCATCAGCGGTTGTTTC) and 190 (5′-TCATCCATGCGGCCAATCTTGTCG). These DNA fragments containing the mutated fkh1 + cDNA flanked by pREP1 sequences were co-transformed with pREP1 into the S. pombe strain TA77 (leu1-32 ura4-D18 fkh1::ura4 + h90). Transformants were plated on minimal medium and after 4 days of incubation at 30 °C replica-plated to minimal medium with or without 0.2 μg/ml rapamycin. After an additional 5 days of incubation at 30 °C, the plates were exposed to iodine vapor. Iodine vapor is routinely used to detect sporulating colonies. Spores are darkly stained by iodine vapor, whereas vegetative cells remain unstained. In the presence of rapamycin (44Weisman R. Choder M. Koltin Y. J. Bacteriol. 1997; 179: 6325-6334Crossref PubMed Google Scholar) or in Δfkh1 colonies (this study), no dark staining is observed since the sexual development pathway is blocked prior to conjugation. Plasmid DNA was isolated from Δfkh1 transformants that stained dark in the presence of rapamycin and used for re-transformation of TA77 and transformation of bacterial cells for plasmid amplification. Plasmids that conferred rapamycin resistance phenotype upon re-transformation were further subjected to DNA sequence analysis. Most of the S. pombe genome has been sequenced through the coordination of the Sanger Center, UK. Based on sequence comparisons, we identified one S. pombe FKBP12 homolog on chromosome II and named it fkh1 + (forFKBP12 homolog). The open reading frame offkh1 + is interrupted by 4 introns of 182, 128, 105, and 48 base pairs. fkh1 + encodes a putative 112-amino acid protein with a predicted mass of 12 kDa. We cloned thefkh1 + cDNA by PCR amplification using a fission yeast cDNA library as a template (see “Experimental Procedures”). Sequence analysis confirmed that the 4 introns predicted in the genomic sequence are spliced out in the cDNA clone. Analysis of the predicted amino acid sequence encoded byfkh1 + reveals that this gene is very similar to its S. cerevisiae homolog, FPR1 (72% overall identity). The similarity between fkh1 + and the human FKBP12 homolog is comparable to the similarity betweenFPR1 and the human FKBP12 (55% overall identity).fkh1 + encodes all the amino acids required for rapamycin binding as predicted by the high resolution structure of the human FKBP12-rapamycin complex (Ref. 21Van Duyne G.D. Standaert R.F. Karplus P.A. Schreiber S.L. Clardy J. J. Mol. Biol. 1993; 229: 105-124Crossref PubMed Scopus (1073) Google Scholar and see Fig. 5). The S. cerevisiae FKBP12 protein, Fpr1p, binds to rapamycin. FKBP12-rapamycin complexes bind the TOR proteins and thus inhibit some of their functions (see Introduction). Since the S. pombe fkh1 + gene shows a significant level of homology with FPR1, we examined whether fkh1 +can replace FPR1 in mediating the effect of rapamycin inS. cerevisiae. To this goal, we expressedfkh1 + cDNA in S. cerevisiae usingADH1 promoter-driven vector, pCM189 (51Gari E. Piedrafita L. Aldea M. Herrero E. Yeast. 1997; 13: 837-848Crossref PubMed Scopus (500) Google Scholar). Wild type and Δfpr1 S. cerevisiae cells were transformed with pCM189-fkh1 +, and the transformants were streaked onto plates containing 0.08 μg/ml rapamycin (Fig.1). As described previously, the wild type S. cerevisiae cells did not form colonies in the presence of rapamycin, whereas Δfpr1 cells were completely resistant to the lethal effect of the drug (34Heitman J. Movva N.R. Hall M.N. Science. 1991; 253: 905-909Crossref PubMed Scopus (1503) Google Scholar) (Fig. 1). Expression offkh1 + in Δfpr1 cells restored rapamycin sensitivity (Fig. 1, plate 2), indicating thatfkh1 +, like FPR1, is capable of mediating the effect of rapamycin in S. cerevisiae cells. It is therefore most likely that the gene product offkh1 + forms a toxic complex with rapamycin that binds and inhibits the S. cerevisiae TOR proteins. Unexpectedly, following a prolonged incubation, cells expressing pCM189-fkh1 + exhibited slow growth in the presence of rapamycin, either in the genetic background of wild type or Δfpr1 cells (Fig. 1, plates 3 and4). Thus, the expression of fkh1 +under the strong ADH1 promoter can slightly increase rapamycin resistance in S. cerevisiae cells. Overexpression of FPR1 from the same expression vector did not exhibit such an effect (see Fig. 2 A), consistent with previous findings (55Lorenz M.C. Heitman J. J. Biol. Chem. 1995; 270: 27531-27537Abstract Full Text Full Text PDF PubMed Scopus (198) Google Scholar). We also screened an S. pombe cDNA library for genes that can confer rapamycin resistance in S. cerevisiae cells (see “Experimental Procedures”). Wild type S. cerevisiae was transformed with the S. pombe cDNA library, and the transformants were plated on rapamycin-containing plates. Sequence analysis of one of the isolated cDNA clones revealed that it encoded fkh1 +. The" @default.
• W2155628721 created "2016-06-24" @default.
• W2155628721 creator A5075884564 @default.
• W2155628721 creator A5080113337 @default.
• W2155628721 creator A5082437532 @default.
• W2155628721 date "2001-01-01" @default.
• W2155628721 modified "2023-09-27" @default.
• W2155628721 title "Rapamycin Blocks Sexual Development in Fission Yeast through Inhibition of the Cellular Function of an FKBP12 Homolog" @default.
• W2155628721 cites W1518065087 @default.
• W2155628721 cites W1522775437 @default.
• W2155628721 cites W1549665441 @default.
• W2155628721 cites W1554245708 @default.
• W2155628721 cites W1590961416 @default.
• W2155628721 cites W17144041 @default.
• W2155628721 cites W1877280917 @default.
• W2155628721 cites W1968232511 @default.
• W2155628721 cites W1970734629 @default.
• W2155628721 cites W1972047989 @default.
• W2155628721 cites W1974022382 @default.
• W2155628721 cites W1976144713 @default.
• W2155628721 cites W1976582108 @default.
• W2155628721 cites W1982100899 @default.
• W2155628721 cites W1984754431 @default.
• W2155628721 cites W1984789406 @default.
• W2155628721 cites W1985046929 @default.
• W2155628721 cites W1991691392 @default.
• W2155628721 cites W1992418864 @default.
• W2155628721 cites W1993870517 @default.
• W2155628721 cites W1998363299 @default.
• W2155628721 cites W2001849808 @default.
• W2155628721 cites W2012600705 @default.
• W2155628721 cites W2013296976 @default.
• W2155628721 cites W2015670559 @default.
• W2155628721 cites W2019308686 @default.
• W2155628721 cites W2020597127 @default.
• W2155628721 cites W2021384992 @default.
• W2155628721 cites W2023411627 @default.
• W2155628721 cites W2024060688 @default.
• W2155628721 cites W2024431372 @default.
• W2155628721 cites W2030875376 @default.
• W2155628721 cites W2032241710 @default.
• W2155628721 cites W2040830056 @default.
• W2155628721 cites W2041512157 @default.
• W2155628721 cites W2042446618 @default.
• W2155628721 cites W2047106546 @default.
• W2155628721 cites W2057106513 @default.
• W2155628721 cites W2060760111 @default.
• W2155628721 cites W2061038863 @default.
• W2155628721 cites W2062639699 @default.
• W2155628721 cites W2063013559 @default.
• W2155628721 cites W2063826622 @default.
• W2155628721 cites W2068413127 @default.
• W2155628721 cites W2076811542 @default.
• W2155628721 cites W2087136249 @default.
• W2155628721 cites W2087576311 @default.
• W2155628721 cites W2091900624 @default.
• W2155628721 cites W2104368376 @default.
• W2155628721 cites W2110715762 @default.
• W2155628721 cites W2114859236 @default.
• W2155628721 cites W2120356140 @default.
• W2155628721 cites W2122282500 @default.
• W2155628721 cites W2128401987 @default.
• W2155628721 cites W2141385342 @default.
• W2155628721 cites W2144460397 @default.
• W2155628721 cites W2158196711 @default.
• W2155628721 cites W2158612356 @default.
• W2155628721 cites W2160090073 @default.
• W2155628721 cites W2161825617 @default.
• W2155628721 cites W2162431562 @default.
• W2155628721 cites W2194986544 @default.
• W2155628721 cites W2289619544 @default.
• W2155628721 cites W56813229 @default.
• W2155628721 cites W62803312 @default.
• W2155628721 cites W79957767 @default.
• W2155628721 doi "https://doi.org/10.1074/jbc.m102090200" @default.
• W2155628721 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11335722" @default.
• W2155628721 hasPublicationYear "2001" @default.
• W2155628721 type Work @default.
• W2155628721 sameAs 2155628721 @default.
• W2155628721 citedByCount "46" @default.
• W2155628721 countsByYear W21556287212012 @default.
• W2155628721 countsByYear W21556287212013 @default.
• W2155628721 countsByYear W21556287212014 @default.
• W2155628721 countsByYear W21556287212015 @default.
• W2155628721 countsByYear W21556287212016 @default.
• W2155628721 countsByYear W21556287212018 @default.
• W2155628721 countsByYear W21556287212021 @default.
• W2155628721 countsByYear W21556287212022 @default.
• W2155628721 countsByYear W21556287212023 @default.
• W2155628721 crossrefType "journal-article" @default.
• W2155628721 hasAuthorship W2155628721A5075884564 @default.
• W2155628721 hasAuthorship W2155628721A5080113337 @default.
• W2155628721 hasAuthorship W2155628721A5082437532 @default.
• W2155628721 hasBestOaLocation W21556287211 @default.
• W2155628721 hasConcept C121332964 @default.
• W2155628721 hasConcept C12294094 @default.
• W2155628721 hasConcept C133956753 @default.
• W2155628721 hasConcept C14036430 @default.

• next