FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2155790711> ?p ?o ?g. }

• W2155790711 endingPage "5144" @default.
• W2155790711 startingPage "5134" @default.
• W2155790711 abstract "Secreted Frizzled-related protein-1 (sFRP-1), a soluble protein that binds to Wnts and modulates Wnt signaling, contains an N-terminal domain homologous to the putative Wnt-binding site of Frizzled (Fz domain) and a C-terminal heparin-binding domain with weak homology to netrin. Both domains are cysteine-rich, having 10 and 6 cysteines in the Fz and heparin-binding domains, respectively. In this study, the disulfide linkages of recombinant sFRP-1 were determined. Numbering sFRP-1 cysteines sequentially from the N terminus, the five disulfide linkages in the Fz domain are 1–5, 2–4, 3–8, 6–10, and 7–9, consistent with the disulfide pattern determined for homologous domains of several other proteins. The disulfide linkages of the heparin-binding domain are 11–14, 12–15, and 13–16. This latter set of assignments provides experimental verification of one of the disulfide patterns proposed for netrin (NTR) modules and thereby supports the prediction that the C-terminal heparin-binding domain of sFRP-1 is an NTR-type domain. Interestingly, two subsets of sFRPs appear to have alternate disulfide linkage patterns compared with sFRP-1, one of which involves the loss of a disulfide due to deletion of a single cysteine from the NTR module, whereas the remaining cysteine may pair with a new cysteine introduced in the Fz domain of the protein. Analysis of glycosylation sites showed that sFRP-1 contains a relatively large carbohydrate moiety on Asn172 (∼2.8 kDa), whereas Asn262, the second potential N-linked glycosylation site, is not modified. No O-linked carbohydrate groups were detected. There was evidence of heterogeneous proteolytic processing at both the N and C termini of the recombinant protein. The predominant N terminus was Ser31, although minor amounts of the protein with Asp41 and Phe50 as the N termini were observed. The major C-terminal processing event was removal of the terminal amino acid (Lys313) with only a trace amount of unprocessed protein detected. Secreted Frizzled-related protein-1 (sFRP-1), a soluble protein that binds to Wnts and modulates Wnt signaling, contains an N-terminal domain homologous to the putative Wnt-binding site of Frizzled (Fz domain) and a C-terminal heparin-binding domain with weak homology to netrin. Both domains are cysteine-rich, having 10 and 6 cysteines in the Fz and heparin-binding domains, respectively. In this study, the disulfide linkages of recombinant sFRP-1 were determined. Numbering sFRP-1 cysteines sequentially from the N terminus, the five disulfide linkages in the Fz domain are 1–5, 2–4, 3–8, 6–10, and 7–9, consistent with the disulfide pattern determined for homologous domains of several other proteins. The disulfide linkages of the heparin-binding domain are 11–14, 12–15, and 13–16. This latter set of assignments provides experimental verification of one of the disulfide patterns proposed for netrin (NTR) modules and thereby supports the prediction that the C-terminal heparin-binding domain of sFRP-1 is an NTR-type domain. Interestingly, two subsets of sFRPs appear to have alternate disulfide linkage patterns compared with sFRP-1, one of which involves the loss of a disulfide due to deletion of a single cysteine from the NTR module, whereas the remaining cysteine may pair with a new cysteine introduced in the Fz domain of the protein. Analysis of glycosylation sites showed that sFRP-1 contains a relatively large carbohydrate moiety on Asn172 (∼2.8 kDa), whereas Asn262, the second potential N-linked glycosylation site, is not modified. No O-linked carbohydrate groups were detected. There was evidence of heterogeneous proteolytic processing at both the N and C termini of the recombinant protein. The predominant N terminus was Ser31, although minor amounts of the protein with Asp41 and Phe50 as the N termini were observed. The major C-terminal processing event was removal of the terminal amino acid (Lys313) with only a trace amount of unprocessed protein detected. Wnt signaling has been implicated in the specification of cell fate, polarity and proliferation, tissue patterning, and the onset of neoplasia (reviewed in Refs. 1Dale T.C. Biochem. J. 1998; 329: 209-223Crossref PubMed Scopus (439) Google Scholar and 2Polakis P. Genes Dev. 2000; 14: 1837-1851Crossref PubMed Google Scholar). Signaling is initiated by the secreted Wnt proteins, which react with proteins on the cell surface to form a receptor complex consisting of a seven-pass transmembrane molecule of the Frizzled (Fz) 1The abbreviations used are:FzFrizzledLRPlow density lipoprotein receptor-related proteinsFRPsecreted Frizzled related proteinCRDcysteine-rich domainMALDImatrix-assisted laser desorption/ionizationMSmass spectrometryTCEPtris-(2-carboxyethyl)-phosphineMDCKMadin-Darby canine kidneyCNBrcyanogen bromideNTRnetrinPCOLCEprocollagen C-proteinase enhancer proteinWFIKKNWAP, Fs, Ig, Ku, and NTR proteinTIMPtissue inhibitors of metalloproteinasesSzlSizzledRP-HPLCreversed phase-high performance liquid chromatographyGSK-3βglycogen synthesis kinase 3βTricineN-tris(hydroxymethyl)methylglycine family (3Wang Y. Macke J.P. Abella B.S. Andreasson K. Worley P. Gilbert D.J. Copeland N.G. Jenkins N.A. Nathans J. J. Biol. Chem. 1996; 271: 4468-4476Abstract Full Text Full Text PDF PubMed Scopus (316) Google Scholar) and either LRP5 or LRP6/Arrow (4Wehrli M. Dougan S.T. Caldwell K. O'Keefe L. Schwartz S. Vaizel-Ohayon D. Schejter E. Tomlinson A. DiNardo S. Nature. 2000; 407: 527-530Crossref PubMed Scopus (726) Google Scholar, 5Tamai K. Semenov M. Kato Y. Spokony R. Liu C. Katsuyama Y. Hess F. Saint-Jeannet J.-P. He X. Nature. 2000; 407: 530-535Crossref PubMed Scopus (1102) Google Scholar, 6Pinson K.I. Brennan J. Monkley S. Avery B.J. Skarnes W.C. Nature. 2000; 407: 535-538Crossref PubMed Scopus (902) Google Scholar), members of the low density lipoprotein receptor-related family (7Brown M.S. Herz J. Goldstein J.L. Nature. 1997; 388: 629-630Crossref PubMed Scopus (149) Google Scholar, 8Brown S.D. Twells R.C.J. Hey P.J. Cox R.D. Levy E.R. Soderman A.R. Metzker M.L. Caskey C.T. Todd J.A. Hess J.F. Biochem. Biophys. Res. Commun. 1998; 248: 879-888Crossref PubMed Scopus (176) Google Scholar). In the absence of Wnt receptor activation, the modular protein Axin provides a scaffold for the binding of glycogen synthesis kinase 3β (GSK-3β), adenomatous polyposis coli (APC) protein, and β-catenin (9Zeng L. Fagotto F. Zhang T. Hsu W. Vasicek T.J. Perry W.L. Lee J.J. Tilghman S.M. Gumbiner B.M. Costantini F. Cell. 1997; 90: 181-192Abstract Full Text Full Text PDF PubMed Scopus (797) Google Scholar, 10Behrens J. Jerchow B.-A. Würtele M. Grimm J. Asbrand C. Wirtz R. Kühl M. Wedlich D. Birchmeier W. Science. 1998; 280: 596-599Crossref PubMed Scopus (1117) Google Scholar, 11Ikeda S. Kishida S. Yamamoto H. Murai H. Koyama S. Kikuchi A. EMBO J. 1998; 17: 1371-1384Crossref PubMed Scopus (1105) Google Scholar, 12Kishida S. Yamamoto H. Ikeda S. Kishida M. Sakamoto I. Koyama S. Kikuchi A. J. Biol. Chem. 1998; 273: 10823-10826Abstract Full Text Full Text PDF PubMed Scopus (443) Google Scholar, 13Sakanaka C. Weiss J.B. Williams L.T. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 3020-3023Crossref PubMed Scopus (283) Google Scholar). This facilitates the phosphorylation of β-catenin by GSK-3β and subsequent rapid degradation of β-catenin by a ubiquitin-dependent process (14Aberle H. Bauer A. Stappert J. Kispert A. Kemler R. EMBO J. 1997; 16: 3797-3804Crossref PubMed Scopus (2170) Google Scholar, 15Orford K. Crockett C. Jensen J.P. Weissman A.M. Byers S.W. J. Biol. Chem. 1997; 272: 24735-24738Abstract Full Text Full Text PDF PubMed Scopus (646) Google Scholar). In response to Wnt binding, the Axin-GSK-3β-APC-β-catenin complex is disrupted by a process that involves the cytoplasmic proteins Dishevelled and Frat (16Kishidi S. Yamamoto H. Hino S.-I. Ikeda S. Kishida M. Kikuchi A. Mol. Cell. Biol. 1999; 19: 4414-4422Crossref PubMed Google Scholar,17Li L. Yuan H. Weaver C.D. Mao J. Farr G.H. Sussman D.J. Jonkers J. Kimmelman D. Wu D. EMBO J. 1999; 18: 4233-4240Crossref PubMed Scopus (359) Google Scholar, 18Smalley M.J. Sara E. Paterson H. Naylor S. Cook D. Jayatilake H. Fryer L.G. Hutchinson L. Fry M.J. Dale T.C. EMBO J. 1999; 10: 2823-2835Crossref Scopus (207) Google Scholar, 19Itoh K. Antipova A. Ratcliffe M.J. Sokol S. Mol. Cell. Biol. 2000; 20: 2228-2238Crossref PubMed Scopus (84) Google Scholar, 20Farr G.H. Ferkey D.M. Yost C. Pierce S.B. Weaver C. Kimelman D. J. Cell Biol. 2000; 148: 691-702Crossref PubMed Scopus (147) Google Scholar), dephosphorylation of Axin (22Yamamoto H. Kishida S. Kishida M. Ikeda S. Takada S. Kikuchi A. J. Biol. Chem. 1999; 274: 10681-10684Abstract Full Text Full Text PDF PubMed Scopus (319) Google Scholar, 23Willert K. Shibamoto S. Nusse R. Genes Dev. 1999; 13: 1768-1773Crossref PubMed Scopus (299) Google Scholar), and recruitment of Axin to LRP5 associated with Axin destabilization (24Mao J. Wang J. Liu B. Pan W. Farr G.H. Flynn C. Yuan H. Takada S. Kimelman D., Li, L. Wu D. Mol. Cell. 2001; 7: 801-809Abstract Full Text Full Text PDF PubMed Scopus (702) Google Scholar). As a result, the phosphorylation and degradation of cytosolic β-catenin are inhibited, leading to its interaction with DNA-binding proteins of the T-cell factor/lymphoid enhancer-binding factor family and accumulation in the nucleus where these complexes activate expression of target genes (25Behrens J. von Kries J.P. Kuhl M. Bruhn L. Wedlich D. Grosschedl R. Birchmeier W. Nature. 1996; 382: 638-642Crossref PubMed Scopus (2604) Google Scholar, 26Molenaar M. van de Wetering M. Oosterwegel M. Peterson-Maduro J. Godsave S. Korinek V. Roose J. Destree O. Clevers H. Cell. 1996; 86: 391-399Abstract Full Text Full Text PDF PubMed Scopus (1624) Google Scholar, 27van de Wetering M. Cavallo R. Dooijes D. van Beest M. van Es J. Loureiro J. Ypma A. Hursh D. Jones T. Bejsovec A. Peifer M. Mortin M. Clevers H. Cell. 1997; 88: 789-799Abstract Full Text Full Text PDF PubMed Scopus (1063) Google Scholar, 28He T.C. Sparks A.B. Rago C. Hermeking H. Zawel L. da Costa L.T. Morin P.J. Vogelstein B. Kinzler K.W. Science. 1998; 281: 1509-1512Crossref PubMed Scopus (4092) Google Scholar, 29Shtutman M. Zhurinsky J. Simcha I. Albanese C. D'Amico M. Pestell R. Ben-Ze'ev A. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 5522-5527Crossref PubMed Scopus (1924) Google Scholar, 30Tetsu O. McCormick F. Nature. 1999; 398: 422-426Crossref PubMed Scopus (3264) Google Scholar). Mutations in APC, β-catenin, and Axin that increase the steady state level of soluble β-catenin create conditions tantamount to a constitutively active canonical Wnt pathway and have been observed in many human cancers (reviewed in Ref. 2Polakis P. Genes Dev. 2000; 14: 1837-1851Crossref PubMed Google Scholar). Frizzled low density lipoprotein receptor-related protein secreted Frizzled related protein cysteine-rich domain matrix-assisted laser desorption/ionization mass spectrometry tris-(2-carboxyethyl)-phosphine Madin-Darby canine kidney cyanogen bromide netrin procollagen C-proteinase enhancer protein WAP, Fs, Ig, Ku, and NTR protein tissue inhibitors of metalloproteinases Sizzled reversed phase-high performance liquid chromatography glycogen synthesis kinase 3β N-tris(hydroxymethyl)methylglycine The Wnt-binding site in Fz proteins consists of ∼120 amino acid residues and has been designated the Fz cysteine-rich domain (CRD) because it contains 10 cysteines that are present in all members of the Fz family (3Wang Y. Macke J.P. Abella B.S. Andreasson K. Worley P. Gilbert D.J. Copeland N.G. Jenkins N.A. Nathans J. J. Biol. Chem. 1996; 271: 4468-4476Abstract Full Text Full Text PDF PubMed Scopus (316) Google Scholar, 31Bhanot P. Brink M. Samos C.H. Hsieh J.C. Wang Y. Macke J.P. Andrew D. Nathans J. Nusse R. Nature. 1996; 382: 225-230Crossref PubMed Scopus (1233) Google Scholar). Several other proteins possessing a Fz CRD have been identified, including tyrosine kinases (32Xu Y.K. Nusse R. Curr. Biol. 1998; 8: R405-R406Abstract Full Text Full Text PDF PubMed Google Scholar, 33Saldanha J. Singh J. Mahadevan D. Protein Sci. 1998; 7: 1632-1635Crossref Scopus (64) Google Scholar), carboxypeptidase Z (34Song L. Fricker L.D. J. Biol. Chem. 1997; 272: 10543-10550Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar), and an isoform of collagen XVIII (35Rehn M. Pihlajaniemi T. J. Biol. Chem. 1995; 270: 4705-4711Abstract Full Text Full Text PDF PubMed Scopus (108) Google Scholar). In addition, a set of secreted Fz-related proteins (sFRPs) have been described that are ∼300 amino acids in length and contain an N-terminal Fz CRD that is typically ∼30–50% identical to the CRDs of Fzs (36Leyns L. Bouwmeester T. Kim S.H. Piccolo S. De Robertis E.M. Cell. 1997; 88: 747-756Abstract Full Text Full Text PDF PubMed Scopus (612) Google Scholar, 37Wang S. Krinks M. Lin K. Luyten F.P. Moos M., Jr. Cell. 1997; 88: 757-766Abstract Full Text Full Text PDF PubMed Scopus (451) Google Scholar, 38Rattner A. Hsieh J.C. Smallwood P.M. Gilbert D.J. Copeland N.G. Jenkins N.A. Nathans J. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 2859-2863Crossref PubMed Scopus (489) Google Scholar, 39Finch P.W., He, X. Kelley M.J. Uren A. Schaudies R.P. Popescu N.C. Rudikoff S. Aaronson S.A. Varmus H.E. Rubin J.S. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 6770-6775Crossref PubMed Scopus (366) Google Scholar, 40Salic A.N. Kroll K.L. Evans L.M. Kirschner M.W. Development. 1997; 124: 4739-4748Crossref PubMed Google Scholar, 41Melkonyan H.S. Chang W.C. Shapiro J.P. Mahadevappa M. Fitzpatrick P.A. Kiefer M.C. Tomei L.D. Umansky S.R. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 13636-13641Crossref PubMed Scopus (291) Google Scholar, 42Pfeffer P.L., De Robertis E.M. Izpisua-Belmonte J.C. Int. J. Dev. Biol. 1997; 41: 449-458PubMed Google Scholar, 43Wolf V., Ke, G. Dharmarajan A.M. Bielke W. Artuso L. Saurer S. Friis R. FEBS Lett. 1997; 417: 385-389Crossref PubMed Scopus (70) Google Scholar, 44Xu Q. D'Amore P.A. Sokol S.Y. Development. 1998; 125: 4767-4776Crossref PubMed Google Scholar, 45Chang J.T. Esumi N. Moore K., Li, Y. Zhang S. Chew C. Goodman B. Rattner A. Moody S. Stetten G. Campochiaro P.A. Zack D.J. Hum. Mol. Genet. 1999; 8: 575-583Crossref PubMed Scopus (96) Google Scholar, 46Bradley L. Sun B. Collins-Racie L. LaVallie E. McCoy J. Sive H. Dev. Biol. 2000; 227: 118-132Crossref PubMed Scopus (55) Google Scholar). These proteins bind Wnts and regulate their activity in a variety of assays. Although the Wnt binding of sFRPs is generally believed to be mediated by the Fz CRD, interaction between Wingless (Drosophilaortholog of mammalian Wnt1) and a sFRP-1 mutant lacking the CRD imply that other mechanisms of direct or indirect interaction also exist (47Uren A. Reichsman F. Anest V. Taylor W.G. Muraiso K. Bottaro D.P. Cumberledge S. Rubin J.S. J. Biol. Chem. 2000; 275: 4374-4382Abstract Full Text Full Text PDF PubMed Scopus (322) Google Scholar). The C-terminal heparin-binding portion of sFRPs bears weak homology with netrins (36Leyns L. Bouwmeester T. Kim S.H. Piccolo S. De Robertis E.M. Cell. 1997; 88: 747-756Abstract Full Text Full Text PDF PubMed Scopus (612) Google Scholar, 37Wang S. Krinks M. Lin K. Luyten F.P. Moos M., Jr. Cell. 1997; 88: 757-766Abstract Full Text Full Text PDF PubMed Scopus (451) Google Scholar), proteins involved in axonal guidance (48Serafini T. Kennedy T.E. Galko M.J. Mirzayan C. Jessell T.M. Tessier-Lavigne M. Cell. 1994; 78: 409-424Abstract Full Text PDF PubMed Scopus (1169) Google Scholar). Originally, this potential relationship was based on the presence of clusters of positively charged residues and a few other conserved amino acids distributed over a span of ∼50 amino acids in FrzB/sFRP-3 (36Leyns L. Bouwmeester T. Kim S.H. Piccolo S. De Robertis E.M. Cell. 1997; 88: 747-756Abstract Full Text Full Text PDF PubMed Scopus (612) Google Scholar). More recently, Bányai and Patthy (49Bányai L. Patthy L. Protein Sci. 1999; 8: 1636-1642Crossref PubMed Scopus (149) Google Scholar) identified a netrin (NTR) module in the C-terminal domains of netrins, sFRPs, type I procollagen C-proteinase enhancer proteins (PCOLCEs), complement proteins C3, C4, and C5, and in the N-terminal domains of tissue inhibitors of metalloproteinases (TIMPs). This homology was based on related patterns of six conserved cysteines, several conserved segments of hydrophobic residues, and a correlation between predicted and known secondary structure in some of the proteins having the domain. However, experimentally determined disulfide bond assignments for the cysteine residues were only available for TIMPs and complement protein C3, the latter being a variant in the group that contains only four of the conserved cysteines. Thus, the validity of the proposed NTR module would be reinforced if the disulfide structure of another protein containing the putative domain conformed to the predicted scheme. In this study, we characterized the post-translational processing of sFRP-1. The linkages of the eight disulfide bonds and the site ofN-linked glycosylation in sFRP-1 were determined using MALDI-MS and N-terminal sequencing of purified peptides. The data show that sFRP-1 has two distinct domains with 10 and 6 cysteines in the N- and C-terminal domains, respectively. The N-terminal domain has a pattern of disulfide linkages identical to that of the Fz CRD recently defined in rat tyrosine kinase Ror-1, mouse sFRP-3, and mouse Fz8 (50Roszmusz E. Patthy A. Trexler M. Patthy L. J. Biol. Chem. 2001; 276: 18485-18490Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar,51Dann C.E. Hsieh J.-C. Rattner A. Sharma D. Nathans J. Leahy D. Nature. 2001; 412: 86-90Crossref PubMed Scopus (376) Google Scholar). The assignment of disulfides in the C-terminal domain experimentally validates the primary disulfide pattern predicted for NTR modules (49Bányai L. Patthy L. Protein Sci. 1999; 8: 1636-1642Crossref PubMed Scopus (149) Google Scholar). In addition, these results provide the first complete experimental assignment of disulfide linkages in an sFRP recombinant protein containing both a CRD and an NTR domain in tandem. An interesting aspect of this assignment is that two other subsets of sFRPs are likely to have different disulfide linkages compared with sFRP-1, suggesting that shuffling of several disulfide bonds may have occurred during evolution of this protein family. Trypsin (sequencing grade) was purchased from Promega (Madison, WI). Subtilisin was obtained from Roche Molecular Biochemicals. Tris-(2-carboxyethyl)-phosphine (TCEP) was obtained from Pierce. Cyanogen bromide (CNBr) was obtained from Aldrich. Reagents for PAGE were obtained from Bio-Rad. All other reagents were either high performance liquid chromatography (HPLC) grade or the highest quality analytical reagent grades available. Recombinant human sFRP-1 was purified from MDCK cell culture supernatants as described previously (47Uren A. Reichsman F. Anest V. Taylor W.G. Muraiso K. Bottaro D.P. Cumberledge S. Rubin J.S. J. Biol. Chem. 2000; 275: 4374-4382Abstract Full Text Full Text PDF PubMed Scopus (322) Google Scholar). CNBr was used for initial fragmentation of sFRP-1 for disulfide assignments because the intact unreduced protein was unusually resistant to cleavage by all proteases tested. Acetic acid (5% final concentration) was added to purified sFRP-1 (1.81 mg/2 ml), and the protein was desalted on an Econo-Pac10DG desalting column (Bio-Rad) using 5% acetic acid to elute the protein. Fractions containing protein were pooled, lyophilized, and reconstituted in 88% formic acid followed by the addition of a 100-fold molar excess of CNBr over the Met content. After overnight incubation in the dark at room temperature under argon, the sample was lyophilized twice and redissolved in 500 μl of 7 m urea, 50 mm NaH2PO4, and 50 mm glycine, pH 6.5. The CNBr fragments were separated by HPLC gel filtration using two TSK columns G3000 SWXL and G2000 SWXL connected in series with a 10 mmsodium phosphate, 150 mm NaCl, 7 m urea, pH 6.5, buffer at a flow rate of 0.6 ml/min. Fractions were analyzed by SDS-PAGE and mass spectrometry. CNBr fragments were further digested with subtilisin in 3 m urea, 50 mmNaH2PO4, 50 mm glycine, and 1 mm CaCl2, pH 6.5 at enzyme:substrate ratios (w/w) of 1:3 (for C2 and C3) or 1:9 (for C1) at 37 °C overnight. The reaction was stopped by adding trifluoroacetic acid to a final concentration of 0.7%, pH ∼2. Peptides were separated by reversed phase (RP) HPLC on a ZORBAX 300SB-C18 column (2.1 × 150 mm, Hewlett-Packard) using a System Gold HPLC (Beckman Instruments, Fullerton, CA) at a flow rate of 0.2 ml/min. A linear gradient was applied using solvent A (0.1% trifluoroacetic acid in water) and solvent B (0.085% trifluoroacetic acid in 95% acetonitrile). Where required, subtilisin digests were reduced prior to RP-HPLC by adding an equal volume of 20 mm TCEP in 200 mm ammonium bicarbonate, pH 8.0. The mixture was incubated at 37 °C for 1 h, and 1.7% trifluoroacetic acid (final concentration) was then added prior to injection onto the HPLC column. TCEP partial reduction of peptide complexes containing multiple disulfides was performed as described previously (52Gray W.R. Protein Sci. 1993; 2: 1732-1748Crossref PubMed Scopus (237) Google Scholar). The purified peptide complex (160 pmol/50 μl in 0.1% trifluoroacetic acid) was mixed with an equal volume of 20 mm TCEP in 50 mm citrate, pH 3.2, and incubated for 3 min at 22 °C. Alkylation of peptides was performed by adding the TCEP-reduced peptide solution into an equal volume of 1 m iodoacetamide in 200 mm HEPES, 2 mm EDTA, pH 8.0, followed by incubation at 37 °C for 30 min. The reaction was stopped by adding 1.3% trifluoroacetic acid (final concentration). Automated Edman sequencing was performed using an Applied Biosystems model 494 protein sequencer as described previously (53Reim D.F. Speicher D.W. Coligan J.E. Dunn B.M. Ploegh H.L. Speicher D.W. Wingfield P.T. Current Protocols in Protein Science. John Wiley & Sons, Inc., New York1997: 11.10.1-11.10.38Google Scholar). Molecular mass analysis was performed by matrix-assisted laser desorption/ionization time-of-flight-mass spectrometry using a Voyager DE-PRO mass spectrometer (Perspective Biosystems, Framingham, MA) with an accelerating voltage of 20 kV. Data were acquired either in linear or reflector mode using either external or internal calibration with protein A (44,614 Da), ubiquitin (8567.49 Da), insulin β chain (3496.96 Da), and bradykinin (1061.24 Da). When necessary, samples were desalted using C18 Ziptips (Millipore, Bedford, MA) followed by elution with a small volume of 50% acetonitrile, 0.1% trifluoroacetic acid. The intact protein and large peptides were mixed 1:1 with a saturated solution of 3,5-dimethoxy-4-hydroxycinnamic acid (sinapinic acid, Sigma) in 33% acetonitrile and 0.1% trifluoroacetic acid for MALDI-MS analysis. Peptides <5-kDa from CNBr fragmentation and subtilisin digestion were applied to MS sample plates precoated with a saturated solution of nitrocellulose and α-cyano-4-hydoxycinnamic acid (1:4 w/w) in 2-propanol and acetone (1:1 v/v) as described previously (54Shevchenko A. Wilm M. Vorm O. Mann M. Anal. Chem. 1996; 68: 850-858Crossref PubMed Scopus (7831) Google Scholar). Where required, CNBr fragments and RP-HPLC samples (20 μl) were reduced in 10 volumes of 2 mm TCEP, 20 mm ammonium bicarbonate, pH 8.0, at 37 °C for 1 h, followed by desalting on ZipTips to remove the TCEP and ammonium bicarbonate. Single amino acid substitutions were introduced with sFRP-1/pcDNA3.1 (47Uren A. Reichsman F. Anest V. Taylor W.G. Muraiso K. Bottaro D.P. Cumberledge S. Rubin J.S. J. Biol. Chem. 2000; 275: 4374-4382Abstract Full Text Full Text PDF PubMed Scopus (322) Google Scholar) as template and the QuikChange XL Site-directed Mutagenesis Kit (Stratagene) following the manufacturer's instructions. N172Q and N262Q were generated, respectively, with the following primer pairs: GCCATGACGCCGCCCCAAGCCACCGAAGCCTCC (forward)/GGAGGCTTCGGTGGCTTGGGGCGGCGTCATGGC (reverse); and CCCTGCCACCAGCTGGACCAACTCAGCCACCACTTCCTC (forward)/GAGGAAGTGGTGGCTGAGTTGGTCCAGCTGGTGGCAGGG (reverse). The underlined letters indicate the location of mutations introduced to modify the sequence. DNA constructs were sequenced to confirm the presence of the intended substitutions and ensure the absence of random mutations at any other sites. Recombinant expression and protein purification were performed as described previously for wild-type sFRP-1 (47Uren A. Reichsman F. Anest V. Taylor W.G. Muraiso K. Bottaro D.P. Cumberledge S. Rubin J.S. J. Biol. Chem. 2000; 275: 4374-4382Abstract Full Text Full Text PDF PubMed Scopus (322) Google Scholar). Recombinant sFRP-1 was purified from MDCK cell culture supernatant by heparin-Sepharose affinity chromatography. The purified protein migrated on SDS-PAGE with an apparent mass of ∼35 kDa (Fig.1 A). MALDI-MS analysis of purified sFRP-1 showed a single broad peak with an average mass (MH+) of 35,452 Da. N-terminal sequence analysis of sFRP-1 indicated that the majority of the polypeptide chains began with Ser31, whereas ∼10% and ∼7% of the sample began with Asp41 and Phe50, respectively (Fig.2). MALDI-MS analyses of tryptic peptides revealed the predominant C terminus of sFRP-1 to be Phe312, although trace amounts of the protein with C termini at Gln309, Ser310, Phe308, Val311, and Lys313 were observed (data not shown). Because the calculated amino acid sequence mass of sFRP-1(Ser31–Phe312) is 32,394 Da, the difference between observed and calculated mass suggested the molecule was glycosylated where the major species had ∼3000 Da of carbohydrate mass. The broad MS peak shape was consistent with heterogeneity of the putative carbohydrate moiety and heterogeneous proteolytic processing of the N and C termini described above.Figure 2Amino acid sequence of sFRP-1 summarizing experimentally determined disulfide linkages,N-glycosylation sites, and proteolysis processing. The predominant N- and C-terminal processing is indicated by solid arrows at Ser31 and Phe312, respectively. Minor alternative heterogeneous N termini resulting from proteolytic processing at Asp41 and Phe50 are indicated by dashed arrows. Bold linesbetween cysteines indicate assigned disulfide bonds. The glycosylatedN-linked site on Asn172 is indicated by asolid underline and the unmodified site at Asn262 is indicated by a dashed underline. The CNBr cleavage sites are indicated by m. The major sites of cleavage by subtilisin to produce peptides used to define disulfide linkages are indicated by open arrowheads.View Large Image Figure ViewerDownload (PPT) Initial fragmentation of sFRP-1 utilized CNBr to cleave peptides on the C-terminal side of methionines, which resulted in conversion of these residues to a mixture of homoserine and homoserine lactone. Masses corresponding to both methionine derivatives were observed for most peptides. For simplicity, only masses corresponding to the predominant homoserine lactone form are reported (residue mass = 83.04 Da), and these residues are indicated as Metxxx when peptide sequences are described. The CNBr fragments were separated by HPLC gel filtration, and major peaks/pools were designated by C1 to C6 as shown in Fig.3 A. The protein bands observed in fractions C1, C2, and C3 on nonreducing gels shifted to lower molecular weight positions on reducing gels, which indicated these fractions contained disulfide linkages (Fig. 3, B andC). MALDI-MS of C1 showed a single broad peak with an average mass of 30,428.7 Da prior to reduction, whereas masses corresponding to Ser31–Met75, Ala87–Met143, and a weak signal for Lys301–Phe312 were observed after reduction (Table I). Comparisons of SDS gel bands and masses of C1, C2, and C3 showed that Met168 had not been cleaved in C1 resulting in isolation of a single large unreduced complex containing all disulfide-linked peptides. This incompletely fragmented CNBr peptide was not directly identified in the MS analysis apparently due to a combination of its large size and the glycosylated moiety on this fragment that interfered with ionization of the peptide after reduction (see below). The C2 peptide complex contained the six cysteines from the heparin-binding (NTR) domain in three polypeptide chains as follows: glycosylated Thr169–Met210, Lys211–Met270, and Lys301–Phe312, which confirmed the major C terminus of the protein was Phe312. The C3 peptide complex contained the 10 cysteines from the Fz CRD domain in three polypeptide chains: Ser31–Met75, Ala87–Met143, and Leu154–Met168. The C4 to C6 peptide fractions did not contain any cysteine residues and were determined to be Gly271–Met297, Gln144–Met153, and Val76–Met86, respectively. Peaks C1 to C3 were further analyzed as described below to determine the disulfide linkages of sFRP-1.Table IMALDI-MS analyses of CNBr-fragmented complexesPeptide fractionAssignmentPeptide mass1-aAverage masses of single-charged molecules (MH)+.CommentsObservedCalculated1-bCalculated mass of each peptide includes mass of homoserine lactone generated by cleavage of C-terminal methionine.C1 complex(Contains all 16 cysteines)Incomplete CNBr fragmentation{31S–M75}–{87A–M143}–{C-terminal fragments}1-cBraces indicate a single peptide and the cysteines in the peptide are indicated with their location in the sequence as superscripts.30,428.7—C1 complex-reduced{31S–M75}5170.85170.9{87A–M143}6377.36377.6{301K–F312}1437.31437.6{C-terminal fragments}——Not observedC2 complex{C185,C188,C202}–{C255,C257}–{C305}C-terminal heparin-binding domain{169T–M210+glycosylation}–{211K–M270}–{301K–F312}15,609.7—C2 complex-reduced{211K–M270}6885.86884.5{301K–F312}1437.81437.6{169T–M210+glycosylation}7266.44454.1Δ = 2812.3 Da1-dMass increment of 2,812.3 Da is presumably due t" @default.
• W2155790711 created "2016-06-24" @default.
• W2155790711 creator A5008552666 @default.
• W2155790711 creator A5034459425 @default.
• W2155790711 creator A5039555481 @default.
• W2155790711 creator A5053364502 @default.
• W2155790711 date "2002-02-01" @default.
• W2155790711 modified "2023-10-18" @default.
• W2155790711 title "Disulfide Bond Assignments of Secreted Frizzled-related Protein-1 Provide Insights about Frizzled Homology and Netrin Modules" @default.
• W2155790711 cites W1504655784 @default.
• W2155790711 cites W152612737 @default.
• W2155790711 cites W1544046482 @default.
• W2155790711 cites W1554815317 @default.
• W2155790711 cites W1611720630 @default.
• W2155790711 cites W1635607892 @default.
• W2155790711 cites W1780615788 @default.
• W2155790711 cites W1905797098 @default.
• W2155790711 cites W1956332901 @default.
• W2155790711 cites W1969910714 @default.
• W2155790711 cites W1982709013 @default.
• W2155790711 cites W1988350691 @default.
• W2155790711 cites W1989215255 @default.
• W2155790711 cites W1991738093 @default.
• W2155790711 cites W2001372468 @default.
• W2155790711 cites W2001809144 @default.
• W2155790711 cites W2002404925 @default.
• W2155790711 cites W2009317254 @default.
• W2155790711 cites W2013460988 @default.
• W2155790711 cites W2014627257 @default.
• W2155790711 cites W2015526402 @default.
• W2155790711 cites W2017668082 @default.
• W2155790711 cites W2021956062 @default.
• W2155790711 cites W2039248606 @default.
• W2155790711 cites W2046968637 @default.
• W2155790711 cites W2046990897 @default.
• W2155790711 cites W2047982560 @default.
• W2155790711 cites W2051032088 @default.
• W2155790711 cites W2052690509 @default.
• W2155790711 cites W2063755332 @default.
• W2155790711 cites W2063894680 @default.
• W2155790711 cites W2075319861 @default.
• W2155790711 cites W2078594804 @default.
• W2155790711 cites W2081985759 @default.
• W2155790711 cites W2084649822 @default.
• W2155790711 cites W2090636859 @default.
• W2155790711 cites W2091092639 @default.
• W2155790711 cites W2092431710 @default.
• W2155790711 cites W2096143207 @default.
• W2155790711 cites W2097098623 @default.
• W2155790711 cites W2100070586 @default.
• W2155790711 cites W2108624125 @default.
• W2155790711 cites W2109069210 @default.
• W2155790711 cites W2118344768 @default.
• W2155790711 cites W2127280898 @default.
• W2155790711 cites W2132475598 @default.
• W2155790711 cites W2133578310 @default.
• W2155790711 cites W2140891001 @default.
• W2155790711 cites W2152769008 @default.
• W2155790711 cites W2153138530 @default.
• W2155790711 cites W2158939849 @default.
• W2155790711 cites W2164692746 @default.
• W2155790711 cites W2168002381 @default.
• W2155790711 cites W2170899721 @default.
• W2155790711 cites W2239090104 @default.
• W2155790711 cites W2395950107 @default.
• W2155790711 cites W2767340343 @default.
• W2155790711 doi "https://doi.org/10.1074/jbc.m108533200" @default.
• W2155790711 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11741940" @default.
• W2155790711 hasPublicationYear "2002" @default.
• W2155790711 type Work @default.
• W2155790711 sameAs 2155790711 @default.
• W2155790711 citedByCount "91" @default.
• W2155790711 countsByYear W21557907112012 @default.
• W2155790711 countsByYear W21557907112013 @default.
• W2155790711 countsByYear W21557907112014 @default.
• W2155790711 countsByYear W21557907112016 @default.
• W2155790711 countsByYear W21557907112017 @default.
• W2155790711 countsByYear W21557907112018 @default.
• W2155790711 countsByYear W21557907112019 @default.
• W2155790711 countsByYear W21557907112020 @default.
• W2155790711 countsByYear W21557907112021 @default.
• W2155790711 countsByYear W21557907112022 @default.
• W2155790711 countsByYear W21557907112023 @default.
• W2155790711 crossrefType "journal-article" @default.
• W2155790711 hasAuthorship W2155790711A5008552666 @default.
• W2155790711 hasAuthorship W2155790711A5034459425 @default.
• W2155790711 hasAuthorship W2155790711A5039555481 @default.
• W2155790711 hasAuthorship W2155790711A5053364502 @default.
• W2155790711 hasBestOaLocation W21557907111 @default.
• W2155790711 hasConcept C104317684 @default.
• W2155790711 hasConcept C107300179 @default.
• W2155790711 hasConcept C127955056 @default.
• W2155790711 hasConcept C137620995 @default.
• W2155790711 hasConcept C165525559 @default.
• W2155790711 hasConcept C169627665 @default.
• W2155790711 hasConcept C181199279 @default.
• W2155790711 hasConcept C185592680 @default.
• W2155790711 hasConcept C27256138 @default.

• next