FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2158049177> ?p ?o ?g. }

• W2158049177 endingPage "13972" @default.
• W2158049177 startingPage "13962" @default.
• W2158049177 abstract "Arabidopsis thaliana contains a large number of genes that encode carboxylic acid-activating enzymes, including nine long-chain fatty acyl-CoA synthetases, four 4-coumarate:CoA ligases (4CL), and 25 4CL-like proteins of unknown biochemical function. Because of their high structural and sequence similarity with bona fide 4CLs and their highly hydrophobic putative substrate-binding pockets, the 4CL-like proteins At4g05160 and At5g63380 were selected for detailed analysis. Following heterologous expression, the purified proteins were subjected to a large scale screen to identify their preferred in vitro substrates. This study uncovered a significant activity of At4g05160 with medium-chain fatty acids, medium-chain fatty acids carrying a phenyl substitution, long-chain fatty acids, as well as the jasmonic acid precursors 12-oxo-phytodienoic acid and 3-oxo-2-(2′-pentenyl)-cyclopentane-1-hexanoic acid. The closest homolog of At4g05160, namely At5g63380, showed high activity with long-chain fatty acids and 12-oxo-phytodienoic acid, the latter representing the most efficiently converted substrate. By using fluorescent-tagged variants, we demonstrated that both 4CL-like proteins are targeted to leaf peroxisomes. Collectively, these data demonstrate that At4g05160 and At5g63380 have the capacity to contribute to jasmonic acid biosynthesis by initiating the β-oxidative chain shortening of its precursors. Arabidopsis thaliana contains a large number of genes that encode carboxylic acid-activating enzymes, including nine long-chain fatty acyl-CoA synthetases, four 4-coumarate:CoA ligases (4CL), and 25 4CL-like proteins of unknown biochemical function. Because of their high structural and sequence similarity with bona fide 4CLs and their highly hydrophobic putative substrate-binding pockets, the 4CL-like proteins At4g05160 and At5g63380 were selected for detailed analysis. Following heterologous expression, the purified proteins were subjected to a large scale screen to identify their preferred in vitro substrates. This study uncovered a significant activity of At4g05160 with medium-chain fatty acids, medium-chain fatty acids carrying a phenyl substitution, long-chain fatty acids, as well as the jasmonic acid precursors 12-oxo-phytodienoic acid and 3-oxo-2-(2′-pentenyl)-cyclopentane-1-hexanoic acid. The closest homolog of At4g05160, namely At5g63380, showed high activity with long-chain fatty acids and 12-oxo-phytodienoic acid, the latter representing the most efficiently converted substrate. By using fluorescent-tagged variants, we demonstrated that both 4CL-like proteins are targeted to leaf peroxisomes. Collectively, these data demonstrate that At4g05160 and At5g63380 have the capacity to contribute to jasmonic acid biosynthesis by initiating the β-oxidative chain shortening of its precursors. The activation of carboxylic acids is required in numerous metabolic pathways of all organisms and contributes to the biosynthesis or degradation of diverse compounds such as fatty acids, amino acids, and a variety of secondary metabolites. Despite the structural diversity of their substrates, many enzymes acting on carboxylic acids utilize the same ATP-dependent two-step mechanism. The first step is characterized by the formation of an acyl-AMP intermediate, the so-called adenylate, with concomitant release of pyrophosphate (Reaction 1). Acid+ATP→acyl−AMP+PPi (Eq. 1) In the second step, the acyl group is transferred to an ultimate acceptor, which in most cases is CoA, and AMP is released (Reaction 2). Acyl−AMP+CoA→acyl−CoA+AMP (Eq. 2) A large number of enzymes catalyzing the above reaction sequence are characterized by the presence of a highly conserved putative AMP-binding domain (PROSITE PS00455), and in fact, this sequence motif has been used to group diverse proteins such as fatty acyl-CoA synthetases, acetyl-CoA synthetases, 4-coumarate:CoA ligases, chlorobenzoate:CoA ligase, nonribosomal polypeptide synthetases, and firefly luciferases in one superfamily of adenylate-forming enzymes (1.Fulda M. Heinz E. Wolter F.P. Mol. Gen. Genet. 1994; 242: 241-249Crossref PubMed Scopus (70) Google Scholar, 2.Stuible H.-P. Büttner D. Ehlting J. Hahlbrock K. Kombrink E. FEBS Lett. 2000; 467: 117-122Crossref PubMed Scopus (93) Google Scholar). In Arabidopsis thaliana 44 genes have been identified that encode proteins containing the consensus AMP-binding domain signature, whereas 19 additional genes contain a more distantly related sequence motif (3.Staswick P.E. Tiryaki I. Rowe M.L. Plant Cell. 2002; 14: 1405-1415Crossref PubMed Scopus (521) Google Scholar, 4.Shockey J.M. Fulda M.S. Browse J. Plant Physiol. 2003; 132: 1065-1076Crossref PubMed Scopus (130) Google Scholar). For some members of the latter group, the ATP-dependent in vitro adenylation of the plant hormones jasmonic acid (JA), 1The abbreviations used are: JA, jasmonic acid; IAA, indole-3-acetic acid; MeJA, methyl jasmonate; 4CL, 4-coumarate:CoA ligase; LACS, long-chain fatty acyl-CoA synthetase; OPDA, 12-oxo-phytodienoic acid; OPC-8:0, 3-oxo-2-(2′-pentenyl)-cyclopentane-1-octanoic acid; OPC-6:0, 3-oxo-2-(2′-pentenyl)-cyclopentane-1-hexanoic acid; OPR-3, OPDA reductase-3; SBP, substrate-binding pocket; PTS1, peroxisomal targeting signal type 1; IBA, indole-butyric acid; RFP, red fluorescent protein; YFP, yellow fluorescent protein; MS, mass spectrometry; WT, wild type; RT, reverse transcriptase. 1The abbreviations used are: JA, jasmonic acid; IAA, indole-3-acetic acid; MeJA, methyl jasmonate; 4CL, 4-coumarate:CoA ligase; LACS, long-chain fatty acyl-CoA synthetase; OPDA, 12-oxo-phytodienoic acid; OPC-8:0, 3-oxo-2-(2′-pentenyl)-cyclopentane-1-octanoic acid; OPC-6:0, 3-oxo-2-(2′-pentenyl)-cyclopentane-1-hexanoic acid; OPR-3, OPDA reductase-3; SBP, substrate-binding pocket; PTS1, peroxisomal targeting signal type 1; IBA, indole-butyric acid; RFP, red fluorescent protein; YFP, yellow fluorescent protein; MS, mass spectrometry; WT, wild type; RT, reverse transcriptase. salicylic acid, or indole-3-acetic acid (IAA) has been demonstrated, and hence a function in hormone signaling was inferred (3.Staswick P.E. Tiryaki I. Rowe M.L. Plant Cell. 2002; 14: 1405-1415Crossref PubMed Scopus (521) Google Scholar). Recently, it was shown that one enzyme of this group, called JAR1, functions as a JA-amino acid synthetase conjugating activated JA with isoleucine, and genetic evidence supports the notion that JA-Ile is indeed an essential component of jasmonate signaling in Arabidopsis (5.Staswick P.E. Tiryaki I. Plant Cell. 2004; 16: 2117-2127Crossref PubMed Scopus (788) Google Scholar). In contrast to JA, amino acid conjugates of IAA have been known for a long time, but the enzymes responsible for their biosynthesis have not yet been reported. Among the 44 Arabidopsis proteins containing the consensus AMP-binding domain, several fatty acyl-CoA synthetases differing in chain length specificity and cellular localization, four 4-coumarate:CoA ligases (4CLs), and one acetyl-CoA synthetase have been identified, but the function of the remaining enzymes is still unknown (4.Shockey J.M. Fulda M.S. Browse J. Plant Physiol. 2003; 132: 1065-1076Crossref PubMed Scopus (130) Google Scholar, 6.Ehlting J. Büttner D. Wang Q. Douglas C.J. Somssich I.E. Kombrink E. Plant J. 1999; 19: 9-20Crossref PubMed Scopus (329) Google Scholar, 7.Shockey J.M. Fulda M.S. Browse J.A. Plant Physiol. 2002; 129: 1710-1722Crossref PubMed Scopus (218) Google Scholar, 8.Ke J. Behal R.H. Back S.L. Nikolau B.J. Wurtele E.S. Oliver D.J. Plant Physiol. 2000; 123: 497-508Crossref PubMed Scopus (116) Google Scholar, 9.Hamberger B. Hahlbrock K. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 2209-2214Crossref PubMed Scopus (183) Google Scholar, 10.Schnurr J.A. Shockey J.M. de Boer G.-J. Browse J.A. Plant Physiol. 2002; 129: 1700-1709Crossref PubMed Scopus (169) Google Scholar, 11.Schnurr J. Shockey J. Browse J. Plant Cell. 2004; 16: 629-642Crossref PubMed Scopus (266) Google Scholar, 12.Fulda M. Shockey J. Werber M. Wolter F.P. Heinz E. Plant J. 2002; 32: 93-103Crossref PubMed Scopus (134) Google Scholar, 13.Fulda M. Schnurr J. Abbadi A. Heinz E. Browse J. Plant Cell. 2004; 16: 394-405Crossref PubMed Scopus (179) Google Scholar). Two of the nine long-chain fatty acyl-CoA synthetases (LACS) present in Arabidopsis, LACS6 and LACS7, represent peroxisomal enzymes that are essential for storage lipid mobilization during germination (12.Fulda M. Shockey J. Werber M. Wolter F.P. Heinz E. Plant J. 2002; 32: 93-103Crossref PubMed Scopus (134) Google Scholar, 13.Fulda M. Schnurr J. Abbadi A. Heinz E. Browse J. Plant Cell. 2004; 16: 394-405Crossref PubMed Scopus (179) Google Scholar). Hence a lacs6 lacs7 double mutant requires exogenous sucrose for germination and seedling development (13.Fulda M. Schnurr J. Abbadi A. Heinz E. Browse J. Plant Cell. 2004; 16: 394-405Crossref PubMed Scopus (179) Google Scholar), a phenotype also described for the Arabidopsis pxa1 mutant and other mutants defective in β-oxidation (14.Zolman B.K. Silva I.D. Bartel B. Plant Physiol. 2001; 127: 1266-1278Crossref PubMed Scopus (262) Google Scholar, 15.Hayashi M. Toriyama K. Kondo M. Nishimura M. Plant Cell. 1998; 10: 183-196PubMed Google Scholar, 16.Germain V. Plant J. 2001; 28: 1-12Crossref PubMed Scopus (178) Google Scholar). The PXA1 protein is an ATP-binding cassette transporter located in the peroxisomal membrane and considered to import long-chain fatty acid CoA esters for β-oxidation from the cytosol (14.Zolman B.K. Silva I.D. Bartel B. Plant Physiol. 2001; 127: 1266-1278Crossref PubMed Scopus (262) Google Scholar). The observation that the pxa1 mutant and the lacs6 lacs7 double mutant are compromised in the mobilization of storage lipids indicates that both activated and free fatty acids are imported into peroxisomes and that peroxisomal LACS activity is essential for plant β-oxidation to support early seedling growth (13.Fulda M. Schnurr J. Abbadi A. Heinz E. Browse J. Plant Cell. 2004; 16: 394-405Crossref PubMed Scopus (179) Google Scholar). Plant peroxisomes are involved in a variety of oxidative processes such as the β-oxidation of fatty acids to produce acetyl-CoA, the metabolism of glycolate formed during photorespiration, and the catabolism of aliphatic amino acids (17.Graham I.A. Eastmond P.J. Prog. Lipid Res. 2002; 41: 156-181Crossref PubMed Scopus (180) Google Scholar, 18.Lange P.R. Eastmond P.J. Madagan K. Graham I.A. FEBS Lett. 2004; 571: 147-153Crossref PubMed Scopus (36) Google Scholar, 19.Zolman B.K. Monroe-Augustus M. Thompson B. Hawes J.W. Krukenberg K.A. Matsuda S.P.T. Bartel B. J. Biol. Chem. 2001; 276: 31037-31046Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar). In addition, peroxisomal enzymes contribute to the formation and turnover of signaling molecules such as nitric oxide and H2O2 (20.Corpas F.J. Barroso J.B. del Rio L.A. Trends Plant Sci. 2001; 6: 145-150Abstract Full Text Full Text PDF PubMed Scopus (390) Google Scholar) and to the biosynthesis of the plant hormones IAA and JA (21.Zolman B.K. Yoder A. Bartel B. Genetics. 2000; 156: 1323-1337Crossref PubMed Google Scholar, 22.Stintzi A. Browse J. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 10625-10630Crossref PubMed Scopus (608) Google Scholar, 23.Bartel B. LeClere S. Magidin M. Zolman B.K. J. Plant Growth Regul. 2001; 20: 198-216Crossref Scopus (159) Google Scholar, 24.Hayashi M. Nishimura M. Curr. Opin. Plant Biol. 2003; 6: 577-582Crossref PubMed Scopus (68) Google Scholar). Analogous to the mammalian eicosanoid pathway, the biosynthesis of JA in Arabidopsis occurs via the octadecanoic pathway starting from linolenic acid (18:3) or, alternatively, via the hexadecanoid pathway starting from hexadecatrienoic acid (16:3) (25.Weber H. Trends Plant Sci. 2002; 7: 217-224Abstract Full Text Full Text PDF PubMed Scopus (353) Google Scholar, 26.Turner J.G. Ellis C. Devoto A. Plant Cell. 2002; 14: S153-S164Crossref PubMed Scopus (846) Google Scholar). In leaves, these polyunsaturated fatty acids may be released from the membrane lipids of the chloroplast by phospholipases functionally related to DAD1 (27.Ishiguro S. Kawai-Oda A. Ueda J. Nishida I. Okada K. Plant Cell. 2001; 13: 2191-2209Crossref PubMed Scopus (676) Google Scholar), and in subsequent steps, they are converted to the cyclopentenones 12-oxo-phytodienoic acid (OPDA) or dinor-OPDA, respectively, by the enzymes lipoxygenase, allene oxide synthase, and allene-oxide cyclase (25.Weber H. Trends Plant Sci. 2002; 7: 217-224Abstract Full Text Full Text PDF PubMed Scopus (353) Google Scholar, 28.Stenzel I. Hause B. Miersch O. Kurz T. Maucher H. Weichert H. Ziegler J. Feussner I. Wasternack C. Plant Mol. Biol. 2003; 51: 895-911Crossref PubMed Scopus (218) Google Scholar, 29.Howe G.A. Schilmiller A.L. Curr. Opin. Plant Biol. 2002; 5: 230-236Crossref PubMed Scopus (392) Google Scholar). OPDA may then be re-esterified to plastid-specific galactolipids (30.Stelmach B.A. Müller A. Hennig P. Gebhardt S. Schubert-Zsilavecz M. Weiler E.W. J. Biol. Chem. 2001; 276: 12832-12838Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar) or may be released from the chloroplast and function as a signal molecule mediating mechanotransductory processes or plant defense responses (30.Stelmach B.A. Müller A. Hennig P. Gebhardt S. Schubert-Zsilavecz M. Weiler E.W. J. Biol. Chem. 2001; 276: 12832-12838Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar, 31.Stintzi A. Weber H. Reymond P. Browse J. Farmer E.E. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 12837-12842Crossref PubMed Scopus (503) Google Scholar). For conversion to JA, OPDA or an OPDA derivative has to be translocated into peroxisomes where it is reduced to 3-oxo-2-(2′-pentenyl)-cyclopentane-1-octanoic acid (OPC-8:0) by OPDA reductase-3 (OPR-3), the action of which is followed by three rounds of β-oxidation (22.Stintzi A. Browse J. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 10625-10630Crossref PubMed Scopus (608) Google Scholar, 25.Weber H. Trends Plant Sci. 2002; 7: 217-224Abstract Full Text Full Text PDF PubMed Scopus (353) Google Scholar, 32.Schaller F. J. Exp. Bot. 2001; 52: 11-23Crossref PubMed Google Scholar, 33.Sanders P.M. Lee P.Y. Biesgen C. Boone J.D. Beals T.P. Weiler E.W. Goldberg R.B. Plant Cell. 2000; 12: 1041-1062Crossref PubMed Scopus (404) Google Scholar). This sequence of β-oxidative steps is indicated by the fact that only even-numbered carboxylic acid side chains of OPC derivatives led to JA biosynthesis (34.Miersch O. Wasternack C. Biol. Chem. 2000; 381: 715-722Crossref PubMed Scopus (55) Google Scholar). In contrast to all other steps of JA biosynthesis, enzymes participating in these β-oxidative reactions of JA precursors have not yet been identified or characterized. Four isoforms of 4-coumarate:CoA ligase (4CL) have been identified in Arabidopsis, which presumably constitute the complete enzyme family (6.Ehlting J. Büttner D. Wang Q. Douglas C.J. Somssich I.E. Kombrink E. Plant J. 1999; 19: 9-20Crossref PubMed Scopus (329) Google Scholar, 9.Hamberger B. Hahlbrock K. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 2209-2214Crossref PubMed Scopus (183) Google Scholar). Typically, 4CLs activate 4-coumaric, caffeic, and ferulic acid to the corresponding CoA esters. These activated cinnamic acid derivatives serve as precursors for the biosynthesis of numerous plant secondary compounds such as flavonoids, isoflavonoids, coumarins, lignin, suberin, anthocyanins, and wall-bound phenolics, which have essential functions in plant development and environmental interactions (35.Douglas C.J. Trends Plant Sci. 1996; 1: 171-178Abstract Full Text PDF Scopus (259) Google Scholar, 36.Weisshaar B. Jenkins G.I. Curr. Opin. Plant Biol. 1998; 1: 251-257Crossref PubMed Scopus (395) Google Scholar). We have shown previously that the four Arabidopsis 4CL isoforms exhibit distinct substrate utilization profiles that may be related to specific metabolic functions (6.Ehlting J. Büttner D. Wang Q. Douglas C.J. Somssich I.E. Kombrink E. Plant J. 1999; 19: 9-20Crossref PubMed Scopus (329) Google Scholar). By detailed biochemical characterization of At4CL2, a naturally occurring loss-of-function mutant that is incapable of converting ferulic acid, and homology modeling of its substrate-binding pocket (SBP), we uncovered the substrate specificity-determining amino acid code of 4CLs (37.Schneider K. Hövel K. Witzel K. Hamberger B. Schomburg D. Kombrink E. Stuible H.-P. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 8601-8606Crossref PubMed Scopus (125) Google Scholar). This specificity code allowed the rational design of At4CL2 variants with new catalytic properties, including the capacity to activate ferulic, sinapic, and cinnamic acid, substrates not normally converted by the At4CL2 wild-type enzyme (37.Schneider K. Hövel K. Witzel K. Hamberger B. Schomburg D. Kombrink E. Stuible H.-P. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 8601-8606Crossref PubMed Scopus (125) Google Scholar). In extension of this work, we are now exploring the structure-function relationship of 4CL-like proteins that are amply encoded by the Arabidopsis genome (4.Shockey J.M. Fulda M.S. Browse J. Plant Physiol. 2003; 132: 1065-1076Crossref PubMed Scopus (130) Google Scholar, 37.Schneider K. Hövel K. Witzel K. Hamberger B. Schomburg D. Kombrink E. Stuible H.-P. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 8601-8606Crossref PubMed Scopus (125) Google Scholar). It has been suggested that 4CL-like proteins may activate cinnamic, benzoic, or fatty acid derivatives, including precursors of plant hormones, but no such enzymatic function has yet been demonstrated for any of these proteins (4.Shockey J.M. Fulda M.S. Browse J. Plant Physiol. 2003; 132: 1065-1076Crossref PubMed Scopus (130) Google Scholar, 37.Schneider K. Hövel K. Witzel K. Hamberger B. Schomburg D. Kombrink E. Stuible H.-P. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 8601-8606Crossref PubMed Scopus (125) Google Scholar, 38.Reumann S. Ma C. Lemke S. Babujee L. Plant Physiol. 2004; 136: 2587-2608Crossref PubMed Scopus (185) Google Scholar). Ideally, direct transfer of structural information from the 4CL system to 4CL-like proteins would lead to a defined arrangement of amino acid residues forming the putative SBP, thereby delimiting the space and chemical environment for a potential substrate. However, structure prediction is still a challenging task, and in case of the 4CL-like proteins further hampered by the occurrence of insertions and deletions in the region comprising the putative SBP-forming amino acid residues. Therefore, we developed a luciferase-based assay that is generally applicable to adenylate-forming enzymes and allows the semi-quantitative analysis of their in vitro substrate utilization at a large scale. By applying this screen to two 4CL-like proteins from Arabidopsis, At4g05160 and At5g63380, we uncovered that both enzymes have the capacity to activate different fatty acid derivatives, including the JA precursors OPDA and 3-oxo-2-(2′-pentenyl)-cyclopentane-1-hexanoic acid (OPC-6:0). Together with their demonstrated localization in peroxisomes, these catalytic activities suggest that both enzymes have a function in JA biosynthesis. Isolation and Cloning of At4g05160 and At5g63380 cDNAs—The cDNAs of At4g05160 and At5g63380 were amplified by RT-PCR from A. thaliana (Col-0) total RNA. Synthesis of the cDNAs and subsequent PCR amplification of the full-length reading frames was performed with the Titan® one tube RT-PCR kit (Roche Diagnostics) according to the manufacturer's instructions with the primer pair At4g05160-FI and -RI (ATGGAGAAATCCGGCTACGGCAGAGACG and TCACATCTTGGATCTTACTTGCTGAACAAG) and the primer pair At5g63380-FI and -RI (ATGCTGACGAAAACCAACGACAGC and TCAAAGTTTTGATGCATTGCCATCCAC), respectively. The resulting cDNAs were used as templates for a second round of PCR amplification using the primer pair At4g05160-FII and -RII (ATCTTAACAAGCATGCCGAAATCCGGCTACGGCAGAGACGGAATTTAC and TATTAATTAGTCGACTCACATCTTGGATCTTACTTGCTGAACAAGTTC) and the primer pair At5g63380-FII and -RII (TTAAATGGATCCATGCTGACGAAAACCAACGACAGCCG and AATTAAGTCGACTCAAAGTTTTGATGCATTGCCATCCACAGC), respectively. In the case of At4g05160, this second PCR amplification was used to introduce the SphI and SalI sites required for cloning into the expression vector pQE32 (Qiagen, Hilden, Germany). In case of At5g63380, BamHI and SalI sites were introduced in the second round of PCR amplification, and the resulting product was cloned into the expression plasmid pQE30 (Qiagen, Hilden, Germany). The DNA sequences of all isolated clones were determined by the ADIS service unit (Max Planck Institute for Plant Breeding Research, Köln, Germany) on ABI PRISM377 DNA sequencers (PE Applied Biosystems, Foster City) by using BigDye Terminator chemistry and were found to be identical with the sequences available from the MIPS data base (Munich Information Center for Protein Sequences, Neuherberg, Germany). Heterologous Expression and Purification of At4g05160 and At5g63380 —Expression and purification of At4g05160 and At5g63380 were essentially carried out as described previously for At4CL2 (2.Stuible H.-P. Büttner D. Ehlting J. Hahlbrock K. Kombrink E. FEBS Lett. 2000; 467: 117-122Crossref PubMed Scopus (93) Google Scholar), with the exception that the expression plasmids were introduced into the Escherichia coli strain DH5α carrying the repressor plasmid pREP4 (Qiagen, Hilden, Germany) and that the growth temperature was reduced to 25 °C. The purity of the enzymes was inspected by SDS gel electrophoresis. Protein concentrations were determined according to Bradford (39.Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (214351) Google Scholar) with bovine serum albumin as standard. 4CL-catalyzed Synthesis of CoA Esters—4CL activity was determined by the spectrophotometric assay described previously (6.Ehlting J. Büttner D. Wang Q. Douglas C.J. Somssich I.E. Kombrink E. Plant J. 1999; 19: 9-20Crossref PubMed Scopus (329) Google Scholar) with standard concentrations of the cinnamic acid derivative (0.2 mm), ATP (5.5 mm), and CoA (0.3 mm). The specific increase of absorbance during CoA ester formation was monitored at wavelengths of 311, 333, 363, 345, and 352 nm for cinnamoyl-CoA, 4-coumaroyl-CoA, caffeoyl-CoA, feruloyl-CoA, and sinapoyl-CoA, respectively, and the appropriate molar extinction coefficients were used for calculating activity (40.Gross G.G. Zenk M.H. Z. Naturforsch. 1966; 21: 683-690Google Scholar, 41.Stöckigt J. Zenk M.H. Z. Naturforsch. 1975; 30: 352-358Crossref PubMed Scopus (281) Google Scholar). Luciferase-based Assay of Adenylate-forming Enzymes—To screen a large number of carboxylic acids for activation by 4CL and 4CL-like proteins, the decrease in ATP concentration was determined by a luciferase-coupled assay. The standard reaction mixture contained 2 μg of purified protein, 200 μm carboxylic acid substrate, 50 μm ATP, 250 μm MgCl2, 100 μm CoA, 1 mm dithioerythritol, and 0.1 m Tris-HCl (pH 7.5) in a total volume of 200 μl. Highly lipophilic substrates, such as long-chain fatty acids, were dissolved in buffer containing 2% Triton X-100, leading to a final concentration of 0.1% Triton X-100 in the assay. Jasmonic acid precursors were first dissolved in EtOH and subsequently diluted with detergent-containing buffer, leading to final concentrations of 0.1% EtOH and 0.1% Triton X-100 in the assay. The reaction mixtures were incubated at room temperature, and for ATP determination, 2-μl samples were withdrawn at various time points and added to a reaction mixture containing 1 μg of firefly luciferase (Roche Diagnostics), 4.6 μg of luciferin (Roche Diagnostics), and 0.1 m Tris-HCl (pH 7.8) in total volume of 200 μl. Photon emission was measured for 10 s with a Lumat LB 9501 luminometer (Berthold Technologies, Bad Wildbad, Germany) and expressed as relative luciferase activity, which is directly proportional to ATP concentration. To minimize the variability of the assay, all ATP determinations were normalized to a reaction containing At4CL2 and sinapic acid, in which no ATP depletion occurred and correspondingly was set to 100%. Time course experiments using At4CL2 showed that good substrates resulted in significant ATP depletion within 1–4 h (not shown). Therefore, an incubation period of 2 h was chosen for the large scale screen. Coupled Enzyme Assay of Acyl-CoA Synthetases—For detailed kinetic analyses, the activation of selected substrates to the corresponding CoA esters by At4g05160 and At5g63380 was followed by measuring AMP formation in a coupled spectrophotometric assay with myokinase, pyruvate kinase, and lactate dehydrogenase adapted from Ziegler et al. (42.Ziegler K. Braun K. Böckler A. Fuchs G. Arch. Microbiol. 1987; 149: 62-69Crossref Scopus (70) Google Scholar). The reaction mixture (1 ml) contained 0.1 m Tris-HCl (pH 7.5), 2 mm dithioerythritol, 5 mm ATP, 10 mm MgCl2, 0.5 m CoA, 0.1 mm NADH, 1 mm phosphoenolpyruvate, 12 nanokatal of myokinase, 7 nanokatal of pyruvate kinase, 9 nanokatal of lactate dehydrogenase, and 4–1600 μm carboxylic acid substrate. For highly lipophilic substrates 0.1% Triton X-100 was added. The reaction was started by addition of 2–8 μg of purified enzyme and the oxidation of 2 mol of NADH per mol of substrate activated was followed at 340 nm (ϵNADH = 6.22 cm2 μmol−1). Km and Vmax values were obtained by linear regression of V/s against s (Hanes plots) from at least three independent experiments. Transient Expression and Subcellular Localization of At4g05160 and At5g63380 in Planta—At4g05160 and At5g63380 cDNAs were PCR-amplified using the primer pair attB1-05160 and attB2-05160 (attB1-TCATGGAGAAATCCGGCTACGG and attB2-CTCACATCTTGGATCTTAGTTGC) and the primer pair attB1-63380 and attB2-63380 (attB1-TCATGCTGACGAAAACCAACG and attB2-CTCAAAGTTTTGATGCATTGCC), respectively, thereby making the PCR products compatible with the Gateway® cloning system (Invitrogen). Both modified cDNAs were inserted into the Gateway donor vector pDONR201 by homologous recombination according to the manufacturer's instructions. The resulting plasmids were used to transfer both coding sequences into the expression vector pENSGYFP, which is based on pXCS (GenBank™ accession number AY457636) and was kindly provided by Dr. N. Medina-Escobar (Max Planck Institute for Plant Breeding Research, Köln, Germany), leading to N-terminal fusions of YFP to At4g05160 and At5g63380. To serve as peroxisomal marker, the red fluorescent protein, dsRED (FP583 from Discosoma sp.), with the peroxisomal import sequence -SRL fused to its C terminus (kindly provided by M. Miklis, Max Planck Institute for Plant Breeding Research, Köln, Germany) was cloned via HindIII and EcoRI restriction sites into the plant binary expression vector pAMPAT-MCS (GenBank™ accession number AY436765). All newly designed vectors allowed the in planta expression of proteins under the control of the constitutive cauliflower mosaic virus double 35S promoter. For transient in planta expression, detached leaves of 4-week-old A. thaliana (Col-0) plants were placed on 1% agar plates containing 85 μm benzimidazole and bombarded with 1 μm gold particles coated with vector DNA using the Biolistic® PDS-1000/He Particle Delivery System (Bio-Rad). Preparation of the DNA-coated gold beads was performed as suggested by the manufacturer. Each macrocarrier was loaded with 6 μl of the gold particle suspension, and the transformation was carried out as described previously (43.Ancillo G. Hoegen E. Kombrink E. Planta. 2003; 217: 566-576Crossref PubMed Scopus (9) Google Scholar). Bombarded leaves were placed in a growth chamber for 36 h, and subsequent fluorescence microscopy was carried out by using an LSM 510 Meta confocal laser microscope (Carl Zeiss, Jena, Germany). An argon laser was used as excitation source (514 nm), and light emission was detected in the range of 570–634 nm for RFP constructs and 535–545 nm for YFP constructs. Images were recorded and processed by using LSM 510 3.2 software (Carl Zeiss, Jena, Germany). Mass Spectrometric Analysis—For the identification of the CoA ester products formed from various substrates, the reaction mixture contained 2 μg of purified enzyme, 1 mm carboxylic acid substrate, 1 mm ATP, 1 mm CoA, 30 mm NH4HCO3, and 0.1% Triton X-100. After an incubation period of 60 min, the samples were diluted with equal volumes of acetonitrile, and 2-μl aliquots were applied to Au/Pd-coated borosilicate glass capillary type medium (Proxeon Biosystems, Odense, Denmark). Mass spectra were recorded with a Micromass Q-TOF 2™ spectrometer (Waters) equipped with a nanoelectrospray ionization source and operating in negative ion mode. Capillary voltage was set at 800 V and cone voltage at 40 V. Full-scan mass spectra were obtained by scanning from m/z 0 to 1500. Putative product peaks were further characterized by MS/MS analysis using argon as collision gas and a collision voltage of 30 V. Data processing was carried out using the MassLynx software (version 3.5) from Micromass (Waters). RNA Preparation and Collection of Gene Expression Data—A. thaliana plants were grown in soil in a growth chamber under controlled conditions with the photoperiod set to 10 h of light (180 μEm−2 s−1) and 14 h of dark, a temperature of 22–23 °C, and a relative humidity of 65%. Total RNA was extracted from fully developed leaves of 4-week-old plants using RNAwiz (Ambion, Austin, Texas) according to the manufacturer's instructions. cRNA labeling, hybridization to the GeneChip ATH-1 (Affymetrix, Santa Clara, CA), and collection of fluorescence data were performed as recommended by the manufacturer. The expression value of the gene chip was scaled globally to the value of 500 arbitrary florescence units and the background set to 46.65 arbitrary florescence units. The Arabidopsis cell culture At7 (derived from ecotype Columb" @default.
• W2158049177 created "2016-06-24" @default.
• W2158049177 creator A5005311844 @default.
• W2158049177 creator A5017702630 @default.
• W2158049177 creator A5041152630 @default.
• W2158049177 creator A5052108838 @default.
• W2158049177 creator A5054910142 @default.
• W2158049177 creator A5062512304 @default.
• W2158049177 creator A5062564804 @default.
• W2158049177 creator A5062691528 @default.
• W2158049177 creator A5070516437 @default.
• W2158049177 date "2005-04-01" @default.
• W2158049177 modified "2023-10-10" @default.
• W2158049177 title "A New Type of Peroxisomal Acyl-Coenzyme A Synthetase from Arabidopsis thaliana Has the Catalytic Capacity to Activate Biosynthetic Precursors of Jasmonic Acid" @default.
• W2158049177 cites W119772400 @default.
• W2158049177 cites W1226797564 @default.
• W2158049177 cites W1511797067 @default.
• W2158049177 cites W1935512182 @default.
• W2158049177 cites W1964835198 @default.
• W2158049177 cites W1964950555 @default.
• W2158049177 cites W1969119721 @default.
• W2158049177 cites W1978174627 @default.
• W2158049177 cites W1979697790 @default.
• W2158049177 cites W1980205119 @default.
• W2158049177 cites W1986327432 @default.
• W2158049177 cites W1992537292 @default.
• W2158049177 cites W1994079191 @default.
• W2158049177 cites W1994194264 @default.
• W2158049177 cites W1995444885 @default.
• W2158049177 cites W1996385741 @default.
• W2158049177 cites W2010091872 @default.
• W2158049177 cites W2014199872 @default.
• W2158049177 cites W2017472057 @default.
• W2158049177 cites W2022416387 @default.
• W2158049177 cites W2025287321 @default.
• W2158049177 cites W2027589728 @default.
• W2158049177 cites W2034111644 @default.
• W2158049177 cites W2036116795 @default.
• W2158049177 cites W2040517551 @default.
• W2158049177 cites W2043400011 @default.
• W2158049177 cites W2046308415 @default.
• W2158049177 cites W2050125483 @default.
• W2158049177 cites W2057318150 @default.
• W2158049177 cites W2057597172 @default.
• W2158049177 cites W2058442404 @default.
• W2158049177 cites W2058498817 @default.
• W2158049177 cites W2058994459 @default.
• W2158049177 cites W2061712981 @default.
• W2158049177 cites W2063725418 @default.
• W2158049177 cites W2064948539 @default.
• W2158049177 cites W2067438873 @default.
• W2158049177 cites W2070412082 @default.
• W2158049177 cites W2071157072 @default.
• W2158049177 cites W2074743394 @default.
• W2158049177 cites W2083639045 @default.
• W2158049177 cites W2095507914 @default.
• W2158049177 cites W2104859889 @default.
• W2158049177 cites W2110591857 @default.
• W2158049177 cites W2111926354 @default.
• W2158049177 cites W2114973337 @default.
• W2158049177 cites W2116767244 @default.
• W2158049177 cites W2122941138 @default.
• W2158049177 cites W2127924626 @default.
• W2158049177 cites W2133922407 @default.
• W2158049177 cites W2138309115 @default.
• W2158049177 cites W2142294740 @default.
• W2158049177 cites W2143569885 @default.
• W2158049177 cites W2144462468 @default.
• W2158049177 cites W2145637864 @default.
• W2158049177 cites W2145695894 @default.
• W2158049177 cites W2145784139 @default.
• W2158049177 cites W2154582742 @default.
• W2158049177 cites W2155388814 @default.
• W2158049177 cites W2157841878 @default.
• W2158049177 cites W2162605176 @default.
• W2158049177 cites W2163581172 @default.
• W2158049177 cites W2164564215 @default.
• W2158049177 cites W2169900719 @default.
• W2158049177 cites W4235953242 @default.
• W2158049177 cites W4241689729 @default.
• W2158049177 cites W4293247451 @default.
• W2158049177 cites W4320301264 @default.
• W2158049177 cites W6715106 @default.
• W2158049177 doi "https://doi.org/10.1074/jbc.m413578200" @default.
• W2158049177 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15677481" @default.
• W2158049177 hasPublicationYear "2005" @default.
• W2158049177 type Work @default.
• W2158049177 sameAs 2158049177 @default.
• W2158049177 citedByCount "131" @default.
• W2158049177 countsByYear W21580491772012 @default.
• W2158049177 countsByYear W21580491772013 @default.
• W2158049177 countsByYear W21580491772014 @default.
• W2158049177 countsByYear W21580491772015 @default.
• W2158049177 countsByYear W21580491772016 @default.
• W2158049177 countsByYear W21580491772017 @default.
• W2158049177 countsByYear W21580491772018 @default.
• W2158049177 countsByYear W21580491772019 @default.
• W2158049177 countsByYear W21580491772020 @default.

• next