FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2158067905> ?p ?o ?g. }

• W2158067905 endingPage "27334" @default.
• W2158067905 startingPage "27327" @default.
• W2158067905 abstract "NRL (neural retina leucine zipper) is a key basic motif-leucine zipper (bZIP) transcription factor, which orchestrates rod photoreceptor differentiation by activating the expression of rod-specific genes. The deletion of Nrl in mice results in functional cones that are derived from rod precursors. However, signaling pathways modulating the expression or activity of NRL have not been elucidated. Here, we show that retinoic acid (RA), a diffusible factor implicated in rod development, activates the expression of NRL in serum-deprived Y79 human retinoblastoma cells and in primary cultures of rat and porcine photoreceptors. The effect of RA is mimicked by TTNPB, a RA receptor agonist, and requires new protein synthesis. DNaseI footprinting and electrophoretic mobility shift assays (EMSA) using bovine retinal nuclear extract demonstrate that RA response elements (RAREs) identified within the Nrl promoter bind to RA receptors. Furthermore, in transiently transfected Y79 and HEK293 cells the activity of Nrl-promoter driving a luciferase reporter gene is induced by RA, and this activation is mediated by RAREs. Our data suggest that signaling by RA via RA receptors regulates the expression of NRL, providing a framework for delineating early steps in photoreceptor cell fate determination. NRL (neural retina leucine zipper) is a key basic motif-leucine zipper (bZIP) transcription factor, which orchestrates rod photoreceptor differentiation by activating the expression of rod-specific genes. The deletion of Nrl in mice results in functional cones that are derived from rod precursors. However, signaling pathways modulating the expression or activity of NRL have not been elucidated. Here, we show that retinoic acid (RA), a diffusible factor implicated in rod development, activates the expression of NRL in serum-deprived Y79 human retinoblastoma cells and in primary cultures of rat and porcine photoreceptors. The effect of RA is mimicked by TTNPB, a RA receptor agonist, and requires new protein synthesis. DNaseI footprinting and electrophoretic mobility shift assays (EMSA) using bovine retinal nuclear extract demonstrate that RA response elements (RAREs) identified within the Nrl promoter bind to RA receptors. Furthermore, in transiently transfected Y79 and HEK293 cells the activity of Nrl-promoter driving a luciferase reporter gene is induced by RA, and this activation is mediated by RAREs. Our data suggest that signaling by RA via RA receptors regulates the expression of NRL, providing a framework for delineating early steps in photoreceptor cell fate determination. The vertebrate retina is a convenient and relatively less complex model to investigate gene regulatory networks during development of the central nervous system. It consists of seven major cell types (six neurons and one glia) that are generated in a conserved histogenic order from common pool(s) of retinal progenitors (1Livesey F.J. Cepko C.L. Nat. Rev. Neurosci. 2001; 2: 109-118Crossref PubMed Scopus (779) Google Scholar). Given the multipotency of retinal progenitors, one can predict that differentiation of distinct cell types depends upon precisely timed expression of cell type-specific genes under the coordinated and combinatorial influence of signaling molecules and transcription factors (1Livesey F.J. Cepko C.L. Nat. Rev. Neurosci. 2001; 2: 109-118Crossref PubMed Scopus (779) Google Scholar, 2Levine E.M. Fuhrmann S. Reh T.A. Cell. Mol. Life. Sci. 2000; 57: 224-234Crossref PubMed Scopus (103) Google Scholar, 3Cayouette M. Barres B.A. Raff M. Neuron. 2003; 40: 897-904Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar, 4Roberts M.R. Srinivas M. Forrest D. Morreale de Escobar G. Reh T.A. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 6218-6223Crossref PubMed Scopus (200) Google Scholar). Similar regulatory networks are also responsible for maintaining appropriate expression levels of phototransduction proteins in adult retina (5Chen Y. Ma J.X. Crouch R.K. Mol. Vis. 2003; 9: 345-354PubMed Google Scholar). Photoreceptors (rods and cones) account for over 70% of all cells in the mammalian retina, and in many species rods greatly outnumber cones (6Curcio C.A. Sloan K.R. Kalina R.E. Hendrickson A.E. J. Comp. Neurol. 1990; 292: 497-523Crossref PubMed Scopus (1878) Google Scholar). A number of transcription regulatory factors are implicated during photoreceptor development; these include the homeodomain transcription factors CRX (7Chau K.Y. Chen S. Zack D.J. Ono S.J. J. Biol. Chem. 2000; 275: 37264-37270Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar, 8Furukawa T. Morrow E.M. Li T. Davis F.C. Cepko C.L. Nat. Genet. 1999; 23: 466-470Crossref PubMed Scopus (442) Google Scholar, 9Chen S. Wang Q.L. Nie Z. Sun H. Lennon G. Copeland N.G. Gilbert D.J. Jenkins N.A. Zack D.J. Neuron. 1997; 19: 1017-1030Abstract Full Text Full Text PDF PubMed Scopus (571) Google Scholar) and OTX2 (10Nishida A. Furukawa A. Koike C. Tano Y. Aizawa S. Matsuo I. Furukawa T. Nat. Neurosci. 2003; 6: 1255-1263Crossref PubMed Scopus (445) Google Scholar), the retinoblastoma protein RB (11Zhang J. Gray J. Wu L. Leone G. Rowan S. Cepko C.L. Zhu X. Craft C.M. Dyer M.A. Nat. Genet. 2004; 36: 351-360Crossref PubMed Scopus (172) Google Scholar), thyroid hormone receptor TRβ2 (12Ng L. Hurley J.B. Dierks B. Srinivas M. Salto C. Vennstrom B. Reh T.A. Forrest D. Nat. Genet. 2001; 27: 94-98Crossref PubMed Scopus (422) Google Scholar, 13Forrest D. Reh T.A. Rusch A. Curr. Opin. Neurobiol. 2002; 12: 49-56Crossref PubMed Scopus (112) Google Scholar), and rod-specific orphan nuclear receptor NR2E3 (14Akhmedov N.B. Piriev N.I. Chang B. Rapoport A.L. Hawes N.L. Nishina P.M. Nusinowitz S. Heckenlively J.R. Roderick T.H. Kozak C.A. Danciger M. Davisson M.T. Farber D.B. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 5551-5556Crossref PubMed Scopus (171) Google Scholar, 15Cheng H. Khanna H. Oh E.C. Hicks D. Mitton K.P. Swaroop A. Hum. Mol. Genet. 2004; 13: 1563-1575Crossref PubMed Scopus (190) Google Scholar, 16Peng G.H. Ahmad O. Ahmad F. Liu J. Chen S. Hum. Mol. Genet. 2005; 14: 747-764Crossref PubMed Scopus (190) Google Scholar, 17Chen J. Rattner A. Nathans J. J. Neurosci. 2005; 25: 118-129Crossref PubMed Scopus (209) Google Scholar, 18Haider N.B. Naggert J.K. Nishina P.M. Hum. Mol. Genet. 2001; 10: 1619-1626Crossref PubMed Scopus (155) Google Scholar). Consistent with their roles in photoreceptor gene regulation, mutations in human CRX and NR2E3 result in retinopathies (19Swaroop A. Wang Q.L. Wu W. Cook J. Coats C. Xu S. Chen S. Zack D.J. Sieving P.A. Hum. Mol. Genet. 1999; 8: 299-305Crossref PubMed Scopus (156) Google Scholar, 20Swain P.K. Chen S. Wang Q.L. Affatigato L.M. Coats C.L. Brady K.D. Fishman G.A. Jacobson S.G. Swaroop A. Stone E. Sieving P.A. Zack D.J. Neuron. 1997; 19: 1329-1336Abstract Full Text Full Text PDF PubMed Scopus (220) Google Scholar, 21Haider N.B. Jacobson S.G. Cideciyan A.V. Swiderski R. Streb L.M. Searby C. Beck G. Hockey R. Hanna D.B. Gorman S. Duhl D. Carmi R. Bennett J. Weleber R.G. Fishman G.A. Wright A.F. Stone E.M. Sheffield V.C. Nat. Genet. 2000; 24: 127-131Crossref PubMed Scopus (383) Google Scholar). NRL 3The abbreviations used are: NRL, neural retina leucine zipper; RA, retinoic acid; FBS, fetal bovine serum; CHX, cycloheximide; PBS, phosphate-buffered saline; EMSA, electrophoretic mobility shift assay; DAPI, 4,6-di-amino-phenyl-indolamine; RNE, retinal nuclear extract; HEK, human embryonic kidney; RARE, RA response elements.3The abbreviations used are: NRL, neural retina leucine zipper; RA, retinoic acid; FBS, fetal bovine serum; CHX, cycloheximide; PBS, phosphate-buffered saline; EMSA, electrophoretic mobility shift assay; DAPI, 4,6-di-amino-phenyl-indolamine; RNE, retinal nuclear extract; HEK, human embryonic kidney; RARE, RA response elements. is a bZIP transcription factor of the Maf subfamily (22Swaroop A. Xu J.Z. Pawar H. Jackson A. Skolnick C. Agarwal N. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 266-270Crossref PubMed Scopus (264) Google Scholar). NRL is conserved in vertebrates and is specifically expressed in photoreceptors and pineal gland (23Swain P.K. Hicks D. Mears A.J. Apel I.J. Smith J.E. John S.K. Hendrickson A. Milam A.H. Swaroop A. J. Biol. Chem. 2001; 276: 36824-36830Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar, 24Coolen M. Sii-Felice K. Bronchain O. Mazabraud A. Bourrat F. Retaux S. Felder-Schmittbuhl M.P. Mazan S. Plouhinec J.L. Dev. Genes. Evol. 2005; 215: 327-339Crossref PubMed Scopus (32) Google Scholar, 25Akimoto M. Cheng H. Zhu D. Brzezinski J.A. Khanna R. Filippova E. Oh E.C. Jing Y. Linares J.L. Brooks M. Zareparsi S. Mears A.J. Hero A. Glaser T. Swaroop A. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 3890-3895Crossref PubMed Scopus (237) Google Scholar, 26Whitaker S.L. Knox B.E. J. Biol. Chem. 2004; 279: 49010-49018Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar). Loss of Nrl in mice results in functional S-cones that are derived from post-mitotic precursors normally fated to be rods (25Akimoto M. Cheng H. Zhu D. Brzezinski J.A. Khanna R. Filippova E. Oh E.C. Jing Y. Linares J.L. Brooks M. Zareparsi S. Mears A.J. Hero A. Glaser T. Swaroop A. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 3890-3895Crossref PubMed Scopus (237) Google Scholar, 27Mears A.J. Kondo M. Swain P.K. Takada Y. Bush R.A. Saunders T.L. Sieving P.A. Swaroop A. Nat. Genet. 2001; 29: 447-452Crossref PubMed Scopus (706) Google Scholar). Mutations in NRL are associated with retinal degenerative diseases in humans (28Bessant D.A. Payne A.M. Mitton K.P. Wang Q.L. Swain P.K. Plant C. Bird A.C. Zack D.J. Swaroop A. Bhattacharya S.S. Nat. Genet. 1999; 21: 355-356Crossref PubMed Scopus (149) Google Scholar, 29Nishiguchi K.M. Friedman J.S. Sandberg M.A. Swaroop A. Berson E.L. Dryja T.P. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 17819-17824Crossref PubMed Scopus (71) Google Scholar). NRL acts synergistically (or antagonistically) with CRX, NR2E3, FIZ1, and other transcription factors to regulate the expression of rhodopsin, cGMP-phosphodiesterase-α and -β, and many other rod genes (15Cheng H. Khanna H. Oh E.C. Hicks D. Mitton K.P. Swaroop A. Hum. Mol. Genet. 2004; 13: 1563-1575Crossref PubMed Scopus (190) Google Scholar, 30Rehemtulla A. Warwar R. Kumar R. Ji X. Zack D.J. Swaroop A. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 191-195Crossref PubMed Scopus (183) Google Scholar, 31Kumar R. Chen S. Scheurer D. Wang Q.L. Duh E. Sung C.H. Rehemtulla A. Swaroop A. Adler R. Zack D.J. J. Biol. Chem. 1996; 271: 29612-29618Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar, 32Mitton K.P. Swain P.K. Chen S. Xu S. Zack D.J. Swaroop A. J. Biol. Chem. 2000; 275: 29794-29799Abstract Full Text Full Text PDF PubMed Scopus (172) Google Scholar, 33Lerner L.E. Gribanova Y.E. Whitaker L. Knox B.E. Farber D.B. J. Biol. Chem. 2002; 277: 25877-25883Abstract Full Text Full Text PDF PubMed Scopus (31) Google Scholar, 34Mitton K.P. Swain P.K. Khanna H. Dowd M. Apel I.J. Swaroop A. Hum. Mol. Genet. 2003; 12: 365-373Crossref PubMed Scopus (36) Google Scholar, 35Pittler S.J. Zhang Y. Chen S. Mears A.J. Zack D.J. Ren Z. Swain P.K. Yao S. Swaroop A. White J.B. J. Biol. Chem. 2004; 279: 19800-19807Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar, 36Lerner L.E. Gribanova Y.E. Ji M. Knox B.E. Farber D.B. J. Biol. Chem. 2001; 276: 34999-35007Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar). Hence, NRL is a crucial intrinsic regulator of photoreceptor development and function. Extrinsic factors are thought to influence the timing, ratio, and functioning of different cell types during retinal differentiation (1Livesey F.J. Cepko C.L. Nat. Rev. Neurosci. 2001; 2: 109-118Crossref PubMed Scopus (779) Google Scholar, 2Levine E.M. Fuhrmann S. Reh T.A. Cell. Mol. Life. Sci. 2000; 57: 224-234Crossref PubMed Scopus (103) Google Scholar, 3Cayouette M. Barres B.A. Raff M. Neuron. 2003; 40: 897-904Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar). Soluble factors in the local microenvironment are expected to modify the competence of retinal progenitor cells to generate cone or rod photoreceptors (4Roberts M.R. Srinivas M. Forrest D. Morreale de Escobar G. Reh T.A. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 6218-6223Crossref PubMed Scopus (200) Google Scholar, 37Kelley M.W. Turner J.K. Reh T.A. Development. 1994; 120: 2091-2102Crossref PubMed Google Scholar, 38Young T.L. Cepko C.L. Neuron. 2004; 41: 867-879Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar, 39Roberts M.R. Hendrickson A. McGuire C.R. Reh T.A. Investig. Ophthalmol. Vis. Sci. 2005; 46: 2897-2904Crossref PubMed Scopus (155) Google Scholar). The vitamin A derivative, retinoic acid (RA), is an important morphogen that acts through its receptors (RAR and RXR), which are members of steroid-thyroid hormone nuclear receptor subfamily (2Levine E.M. Fuhrmann S. Reh T.A. Cell. Mol. Life. Sci. 2000; 57: 224-234Crossref PubMed Scopus (103) Google Scholar, 40Evans R.M. Science. 1988; 240: 889-895Crossref PubMed Scopus (6302) Google Scholar). RA is involved in the development of eye as well as other tissues; its deficiency causes microphthalmia and other defects (41Hyatt G.A. Schmitt E.A. Fadool J.M. Dowling J.E. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 13298-13303Crossref PubMed Scopus (148) Google Scholar, 42Kalter H. Warkany J. Physiol. Rev. 1959; 39: 69-115Crossref PubMed Scopus (154) Google Scholar). RA promotes rod differentiation both in vitro and in vivo (2Levine E.M. Fuhrmann S. Reh T.A. Cell. Mol. Life. Sci. 2000; 57: 224-234Crossref PubMed Scopus (103) Google Scholar, 41Hyatt G.A. Schmitt E.A. Fadool J.M. Dowling J.E. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 13298-13303Crossref PubMed Scopus (148) Google Scholar, 43De Leeuw A.M. Gaur V.P. Saari J.C. Milam A.H. J. Neurocytol. 1990; 19: 253-264Crossref PubMed Scopus (63) Google Scholar, 44Kastner P. Mark M. Ghyselinck N. Krezel W. Dupe V. Grondona J.M. Chambon P. Development. 1997; 124: 313-326Crossref PubMed Google Scholar). RA also modulates the expression of several photoreceptor-specific genes, including arrestin and CRX (45Li A. Zhu X. Craft C.M. Investig. Ophthalmol. Vis. Sci. 2002; 43: 1375-1383PubMed Google Scholar, 46Li A. Zhu X. Brown B. Craft C.M. Investig. Ophthalmol. Vis. Sci. 2003; 44: 996-1007Crossref PubMed Scopus (58) Google Scholar, 47Boatright J.H. Stodulkova E. Do V.T. Padove S.A. Nguyen H.T. Borst D.E. Nickerson J.M. Vision. Res. 2002; 42: 933-938Crossref PubMed Scopus (15) Google Scholar). Given the complex networks of gene regulation during photoreceptor differentiation, the mechanism(s) by which extrinsic factors influence cell type-specific gene networks are not completely understood. In this report, we have used the regulation of NRL expression as a paradigm to gain insights into signaling pathways that control photoreceptor development. Using serum-deprived Y79 human retinoblastoma cells and cultured rat and porcine photoreceptors, we show that expression of NRL is induced by serum as well as RA. We demonstrate that RA acts on the RAREs identified within the NRL promoter to induce its expression. Our studies reveal a possible regulatory mechanism by which RA influences photoreceptor differentiation and rod-specific gene expression. Reagents—Tissue culture media and serum were obtained from Invitrogen (Carlsbad, CA). Retinoic acids, growth factors, and other reagents were procured from Sigma. Stock solutions of RA and growth factors were prepared in 1% ethanol and/or dimethyl sulfoxide. Cell Culture—Y79 human retinoblastoma cells (ATCC HTB 18) and HEK293 (ATCC CRL-1573) were maintained in RPMI 1640 and Dulbecco's modified Eagle's medium, respectively, under standard conditions with 15% (v/v) fetal bovine serum (FBS), penicillin G (100 units/ml), and streptomycin (100 μg/ml) at 37 °C and 5% CO2. For serum starvation and RA treatment experiments, Y79 cells (5 × 104) were cultured in the presence or absence of the serum (same batch of serum was used in all the experiments), atRA, 9-cis-RA, cycloheximide (CHX), and 4-(E-2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propenyl) benzoic acid (TTNPB) at indicated concentrations. Me2SO or ethanol was added to Y79 cells in lieu of the soluble factors as negative control. For protein synthesis inhibition experiments, Y79 cells were serum-starved for 24 h, and then simultaneously treated with RA and CHX for 8 or 24 h. NRL expression was analyzed by immunoblotting. In another set of experiments, serum-starved Y79 cells were first incubated with RA alone for 8 or 24 h and then CHX was added. Cell extracts were then analyzed 24 h later for examining NRL expression by immunoblotting. Primary cultures of new-born rat retinal cells and enriched adult porcine photoreceptors were prepared according to published procedures (48Traverso V. Kinkl N. Grimm L. Sahel J. Hicks D. Investig. Ophthalmol. Vis. Sci. 2003; 44: 4550-4558Crossref PubMed Scopus (41) Google Scholar). For newborn rat retinal cultures, rat pups were anesthetized and decapitated, the retinas dissected into CO2-independent Dulbecco's modified Eagle's medium and chopped into small fragments. The fragments were washed twice in Ca/Mg-free PBS and then digested in PBS containing 0.1% papain for 25 min at 37 °C. Tissue was dissociated by repeated passage through flame polished Pasteur pipettes, then seeded into tissue culture plates precoated with laminin, in Neurobasal A medium (Invitrogen) containing 2% FBS. After 48 h, medium was changed to a chemically defined formula (Neurobasal A supplemented with B27) for a further 48 h, and then treated according to the different experiments (below). For pig photoreceptor cultures, eyes were obtained from freshly slaughtered adult pigs, the retinas removed and dissected under sterile conditions. Tissue was minced, digested with papain, and dissociated by mild mechanical trituration. Cells obtained from the first two supernatants were pooled and seeded at 5 × 105/cm2 into 6 × 35 well tissue culture plates as above. Cells were cultured as outlined above (48 h Neurobasal A/2% FBS, then 48 h Neurobasal A with B27). Experimental Treatments and Immunochemistry—After the 4-day culture period, both primary cell models were treated as follows. RA was added to test wells (1, 5, 10, 20, and 40 μm, stock solution prepared in Me2SO, 10 μl/well). Negative control wells received Me2SO alone, and positive control wells were treated with Neurobasal containing 2% FBS. For immunoblotting, the medium was removed after 24 h; cells were rinsed in PBS and processed as indicated. For immunocytochemical studies, medium was removed after 24 h, and cells were fixed in 4% paraformaldehyde in PBS for 15 min. Cells were permeabilized for 5 min using 0.1% Triton X-100, then preincubated in blocking buffer (PBS containing 0.1% bovine serum albumin, 0.1% Tween 20 and 0.1% sodium azide) for 30 min. Cells were incubated overnight in affinity-purified anti-NRL antiserum (1:1000 dilution), and monoclonal anti-rhodopsin antibody rho-4D2 (45Li A. Zhu X. Craft C.M. Investig. Ophthalmol. Vis. Sci. 2002; 43: 1375-1383PubMed Google Scholar), rinsed thoroughly, and incubated with secondary antibodies (anti-rabbit IgG-Alexa594 and anti-mouse IgG-Alexa488) combined with 4,6-di-amino-phenyl-indolamine (DAPI) (all from Molecular Probes Inc., Eugene, OR) for 2 h. Cells were washed, mounted in PBS/glycerol, and examined under a Nikon Optiphot 2 fluorescence microscope. All images were captured using a CCD camera and transferred to a dedicated PC. The same capture parameters were used for each stain, and final panels were made using untreated images for direct comparison of staining intensities. Protein Expression Analysis—Y79 and newborn rat retinal cells were sonicated in PBS and clarified supernatant was used for further analysis. Protein concentration was determined using Bio-Rad protein assay reagent. Equal amounts of proteins were analyzed by SDS-PAGE followed by immunoblotting. Proteins were detected using anti-NRL polyclonal antibody as described (15Cheng H. Khanna H. Oh E.C. Hicks D. Mitton K.P. Swaroop A. Hum. Mol. Genet. 2004; 13: 1563-1575Crossref PubMed Scopus (190) Google Scholar, 23Swain P.K. Hicks D. Mears A.J. Apel I.J. Smith J.E. John S.K. Hendrickson A. Milam A.H. Swaroop A. J. Biol. Chem. 2001; 276: 36824-36830Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). Immunoblots from three independent experiments for rat and pig retinal cultures were analyzed by densitometric scanning, and normalized to serum-supplemented control levels in each case. Statistical analysis of data were performed using the one-tailed Student's t test, with p < 0.05 accepted as level of significance. Plasmid Constructs—DNA fragments of 2.5 kb (Nl), 1.2 kb (Nm), and 200 bp (Ns) from the 5′-flanking region of the mouse Nrl promoter (GenBank™: AY526079; (25Akimoto M. Cheng H. Zhu D. Brzezinski J.A. Khanna R. Filippova E. Oh E.C. Jing Y. Linares J.L. Brooks M. Zareparsi S. Mears A.J. Hero A. Glaser T. Swaroop A. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 3890-3895Crossref PubMed Scopus (237) Google Scholar) were amplified and cloned into pGL3-basic vector (Madison, WI) in-frame with the luciferase reporter gene. The following site-directed mutants of the Nrl promoter were generated from pGL3-Nl using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) and sequence-verified: pGL3-Nl-mutIII-1, pGL3-Nl-mutIII-2, and pGL3-Nl-mutII-1, containing deletion of the putative RAREs at positions -781 to -767, -709 to -700, and -453 to -443, respectively. DNaseI Footprinting and Electrophoretic Mobility Shift Assays (EMSA)—Bovine retinal nuclear extract (RNE) was prepared as described (49Lahiri D.K. Ge Y. Brain Res. Brain Res. Protoc. 2000; 5: 257-265Crossref PubMed Scopus (78) Google Scholar). Solid phase DNaseI footprinting was performed as described (50Sandaltzopoulos R. Becker P.B. Nucleic Acids Res. 1994; 22: 1511-1512Crossref PubMed Scopus (44) Google Scholar), using 100 μg of RNE, and various fragments from the upstream conserved regions of the mouse Nrl promoter were used as template. For EMSA, oligonucleotides containing the wild-type mouse Nrl promoter sequence (oligo III-2 nucleotides -726 to -686: 5′-<ACGGGGAAAAGGTGAGAGGAAGC>-3′, oligo II-1 nucleotides -469 to -427: 5′-<GCAGGGGCTGAAATGTGAGGA>-3′) or deletion of the putative RAREs (mt-Oligo III-2: 5′-<CTGAGACACCGCACGGGGAGGAAGCTGAGGGC>-3′; and mt-Oligo II-1: 5′-<GGTGAAGGTAGGGCAGTGAGGATGCTTGAAAA>-3′) were end-labeled using [γ-32P]ATP (Amersham Biosciences) and incubated in binding buffer (20 mm HEPES pH 7.5, 60 mm KCl, 0.5 mm dithiothreitol, 1 mm MgCl2, 12% glycerol) with RNE (20 μg) and poly(dI-dC) (50 μg/ml) for 30 min at room temperature. In competition experiments, a non-radiolabeled oligonucleotide was used in molar excess of the labeled oligonucleotide. In some gel-shift experiments, antibodies were added after the incubation of 32P-labeled oligonucleotides with RNE. Samples were loaded on 7.5% non-denaturing polyacrylamide gel. After electrophoresis, the gels were dried and exposed to x-ray film. Transient Transfection and Luciferase Assay—Transient transfection of Y79 cells was performed using FuGENE 6 reagent (Roche Diagnostics, Indianapolis, IN). Prior to transfection, cells were serum-starved 24 h in Opti-MEM (Invitrogen), diluted to 1.5 × 105 cells in 250 μl and seeded into 24-well plates. Transfection was performed with 0.5 μg of promoter-luciferase construct and 1.5 μl of FuGENE 6. One hour after transfection, 10 μm RA or 1% ethanol was added to each well. Transfected cells were cultured for additional 24 h and harvested. Luciferase activity was measured using the Luciferase Assay System (Promega, Madison, WI). Experiments were repeated at least three times, and the luciferase activity was calculated as a fold change from the base line luciferase activity obtained in the presence of vector only. Transient transfection of HEK293 (ATCC CRL-1573) cells was performed using Lipofectamine (Invitrogen) according to the manufacturer's instructions. The wild type and mutant Nrl promoter-luciferase constructs, and pCMV-β-gal were added to the cells at a concentration of 0.1 μg and 0.05 μg, respectively. After 3 h, 100 μl of Dulbecco's modified Eagle's medium with 0 or 500 nm atRA was added to each well. Cells were harvested after 24 h in 100 μl of Glo lysis buffer (Promega), and luciferase activity was measured. Serum-deprivation of Y79 Cells—We had shown earlier that NRL is expressed in Y79 cells but not in other tested cell lines (22Swaroop A. Xu J.Z. Pawar H. Jackson A. Skolnick C. Agarwal N. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 266-270Crossref PubMed Scopus (264) Google Scholar). To generate an efficient in vitro model system to study regulation of NRL expression, we carried out serum deprivation of Y79 cells. Northern blot analysis and RT-PCR failed to detect NRL transcripts within 24 h after serum deprivation (data not shown). Immunoblot analysis showed that NRL expression in Y79 cells decreased 8 h after serum depletion and was undetectable by 24 h (Fig. 1A). No cell death was detected because of serum deprivation within the time span of the experiments (data not shown). When serum was supplied to these cells, NRL expression was detectable in 2 h and completely restored within 8 h (Fig. 1B). Multiple immunoreactive bands in 29-35 kDa range represent different phosphorylated isoforms of NRL that are detected by affinity-purified anti-NRL antibody (23Swain P.K. Hicks D. Mears A.J. Apel I.J. Smith J.E. John S.K. Hendrickson A. Milam A.H. Swaroop A. J. Biol. Chem. 2001; 276: 36824-36830Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). Additional bands observed in immunoblots may represent unrelated cross-reactive proteins, and their levels did not change after serum deprivation. RA Effect on NRL Expression—To identify some of the possible activators in serum, we tested the effect of a number of soluble factors on NRL expression. We detected a dose-dependent increase in NRL expression following incubation with atRA and its isomer, 9-cis RA (Fig. 2A). The effect of RA was mimicked by a RAR-specific agonist, TTNPB (Fig. 2B). Northern blot analysis of RNA from the treated cells also showed RA induction of NRL transcripts (data not shown). We then evaluated the time course of NRL induction by RA. An increase in NRL protein was observed in serum-starved Y79 cells after 8 h of incubation with atRA (Fig. 2C). A similar effect was observed with 9-cis RA (data not shown). Treatment of cells with atRA and CHX (20 μg/ml), an inhibitor of protein synthesis (51Vazquez D. Mol. Biol. Biochem. Biophys. 1979; 30 (1-312): i-xPubMed Google Scholar), blocked NRL induction when both were added simultaneously (Fig. 2D). This suggests that intermediate protein synthesis is necessary for RA-mediated induction of NRL expression. However, when cells were pretreated with RA for 8 or 24 h, CHX had no detectable effect on NRL expression (Fig. 2D). These results suggest that synthesis of intermediary factors necessary for NRL induction occurs within 8 h of RA treatment. RA Stimulation of NRL Expression in Rat and Porcine Photoreceptors—To investigate the effect of RA on the expression of NRL in photoreceptors in vitro, we utilized two different culture models. Immunoblotting of proteins isolated from monolayer cultures of newborn rat retina revealed that maintenance of cells in chemically defined conditions for 24 h led to moderate but reproducible decreases in NRL expression levels, and that either re-addition of serum or increasing doses of RA increased the NRL band intensity (Fig. 3A). Only a single NRL-immunoreactive band was visible using the newborn rat retinal cells (Fig. 3A). Similar induction in NRL expression was observed using highly enriched photoreceptor cultures prepared from adult pig retina, which however showed two NRL-immunoreactive bands (Fig. 3B). In both rat and pig cultures, maximal effects were observed with 5-20 μm RA, and higher doses led to some toxicity especially in cells from new-born rat retina. Immunocytochemical studies of pig photoreceptor cultures revealed that NRL was confined to rod nuclei in all cases, and that signal was relatively strong in serum- or RA-supplemented conditions. The serum-free photoreceptor culture displayed a modest but reproducible decrease in NRL-specific signal in the nuclei, as seen in immunoblots (Fig. 3C). Expression levels in newborn rat retinal cultures were too low to be detected by immunocytochemistry (data not shown). Role of RA Receptors—We next examined whether RA acts directly on the Nrl promoter. DNaseI footprinting analysis of conserved sequences upstream of the transcription start site of the mouse Nrl gene identified putative RAREs (regions III-1, III-2, and II-1), in addition to other transcription factor binding elements (Fig. 4, A and B; data not shown). Oligonucleotides encompassing these protected sequences were radiolabeled and used for EMSA analysis (Fig. 4C). We observed mobility shift of the radiolabeled oligonucleotides in the presence of bovine retinal nuclear extracts (Fig. 4D). The intensity of the shifted bands was reduced or eliminated by molar excess of the same non-radiolabeled oligonucleotide, but not by a mutant oligonucleotide carrying a deletion of the putative RAREs. The shifted bands were also diminished when anti-RARα, anti-RXRα, or anti-RXRγ but not RARβ, RARγ, or RXRβ-specific antibodies were added (Fig. 4D). To investigate the functional relevance of the binding of RA receptors to the Nrl promoter, we performed transient transfection experiments in serum-deprived Y79 cells using Nrl promoter-luciferase constructs containing the 2.5-kb fragment (pGL3-Nl) as well as deletion variants encompassing the foo" @default.
• W2158067905 created "2016-06-24" @default.
• W2158067905 creator A5035900540 @default.
• W2158067905 creator A5039673602 @default.
• W2158067905 creator A5050544784 @default.
• W2158067905 creator A5057550617 @default.
• W2158067905 creator A5068742650 @default.
• W2158067905 creator A5071651582 @default.
• W2158067905 date "2006-09-01" @default.
• W2158067905 modified "2023-10-16" @default.
• W2158067905 title "Retinoic Acid Regulates the Expression of Photoreceptor Transcription Factor NRL" @default.
• W2158067905 cites W1508022627 @default.
• W2158067905 cites W1525882285 @default.
• W2158067905 cites W1597109281 @default.
• W2158067905 cites W1940352663 @default.
• W2158067905 cites W1963616355 @default.
• W2158067905 cites W1967195106 @default.
• W2158067905 cites W1968703962 @default.
• W2158067905 cites W1991640883 @default.
• W2158067905 cites W1992858114 @default.
• W2158067905 cites W1997399224 @default.
• W2158067905 cites W2006486865 @default.
• W2158067905 cites W2013036001 @default.
• W2158067905 cites W2014486607 @default.
• W2158067905 cites W2020731149 @default.
• W2158067905 cites W2022184990 @default.
• W2158067905 cites W2023596963 @default.
• W2158067905 cites W2028868015 @default.
• W2158067905 cites W2038170578 @default.
• W2158067905 cites W2041361794 @default.
• W2158067905 cites W2041598409 @default.
• W2158067905 cites W2043372546 @default.
• W2158067905 cites W2059773867 @default.
• W2158067905 cites W2065030928 @default.
• W2158067905 cites W2066564380 @default.
• W2158067905 cites W2072414883 @default.
• W2158067905 cites W2074366705 @default.
• W2158067905 cites W2074823355 @default.
• W2158067905 cites W2077909999 @default.
• W2158067905 cites W2078186919 @default.
• W2158067905 cites W2079604599 @default.
• W2158067905 cites W2085124463 @default.
• W2158067905 cites W2087344433 @default.
• W2158067905 cites W2098664089 @default.
• W2158067905 cites W2098877912 @default.
• W2158067905 cites W2099545629 @default.
• W2158067905 cites W2102870423 @default.
• W2158067905 cites W2103851277 @default.
• W2158067905 cites W2106442096 @default.
• W2158067905 cites W2110999603 @default.
• W2158067905 cites W2113963038 @default.
• W2158067905 cites W2119232833 @default.
• W2158067905 cites W2122194644 @default.
• W2158067905 cites W2123823223 @default.
• W2158067905 cites W2126132206 @default.
• W2158067905 cites W2127724565 @default.
• W2158067905 cites W2129618668 @default.
• W2158067905 cites W2136899592 @default.
• W2158067905 cites W2143713098 @default.
• W2158067905 cites W2148606019 @default.
• W2158067905 cites W2153200502 @default.
• W2158067905 cites W2155015939 @default.
• W2158067905 cites W2157191738 @default.
• W2158067905 cites W2157773282 @default.
• W2158067905 cites W2164954416 @default.
• W2158067905 cites W2171081956 @default.
• W2158067905 cites W2191355326 @default.
• W2158067905 cites W2321626944 @default.
• W2158067905 cites W2340773711 @default.
• W2158067905 doi "https://doi.org/10.1074/jbc.m605500200" @default.
• W2158067905 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/1592579" @default.
• W2158067905 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16854989" @default.
• W2158067905 hasPublicationYear "2006" @default.
• W2158067905 type Work @default.
• W2158067905 sameAs 2158067905 @default.
• W2158067905 citedByCount "59" @default.
• W2158067905 countsByYear W21580679052012 @default.
• W2158067905 countsByYear W21580679052013 @default.
• W2158067905 countsByYear W21580679052015 @default.
• W2158067905 countsByYear W21580679052016 @default.
• W2158067905 countsByYear W21580679052017 @default.
• W2158067905 countsByYear W21580679052018 @default.
• W2158067905 countsByYear W21580679052019 @default.
• W2158067905 countsByYear W21580679052020 @default.
• W2158067905 countsByYear W21580679052022 @default.
• W2158067905 countsByYear W21580679052023 @default.
• W2158067905 crossrefType "journal-article" @default.
• W2158067905 hasAuthorship W2158067905A5035900540 @default.
• W2158067905 hasAuthorship W2158067905A5039673602 @default.
• W2158067905 hasAuthorship W2158067905A5050544784 @default.
• W2158067905 hasAuthorship W2158067905A5057550617 @default.
• W2158067905 hasAuthorship W2158067905A5068742650 @default.
• W2158067905 hasAuthorship W2158067905A5071651582 @default.
• W2158067905 hasBestOaLocation W21580679051 @default.
• W2158067905 hasConcept C104317684 @default.
• W2158067905 hasConcept C120197328 @default.
• W2158067905 hasConcept C138885662 @default.
• W2158067905 hasConcept C139522298 @default.

• next